Santalum album SaERF89 gene and its application in the biosynthesis of α-bisabolol

By overexpressing the SaERF89 gene in sandalwood cells, the content of α-Bisabolol in sandalwood is improved, the environmental and efficiency problems of chemical synthesis methods are solved, and efficient and environmentally friendly biosynthesis effect is achieved.

CN118812684BActive Publication Date: 2025-06-13GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411227400.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-03
Publication Date
2025-06-13
Estimated Expiration
2044-09-03

AI Technical Summary

Technical Problem

In the prior art, α-Bisabolol has problems in the use of expensive chemical reagents, harsh reaction conditions, difficult to control stereoselectivity, lengthy synthetic routes and low overall yields, and the environment is unfriendly.

Method used

By expressing and overexpressing the transcription factor SaERF89 gene in sandalwood, the mRNA expression of the SaERF89 gene or the expression of the encoding protein in sandalwood cells is increased, thereby increasing the content of α-Bisabolol in sandalwood.

Benefits of technology

The content of α-Bisabolol was increased by 34.89% in sandalwood callus, avoiding the disadvantages of chemical synthesis, and the method was environmentally friendly and efficient.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118812684B_ABST
    Figure CN118812684B_ABST
Patent Text Reader

Abstract

The present invention discloses the application of the transcription factor encoded by the SaERF89 gene of Santalum album in the biosynthesis of α-Bisabolol, belonging to the field of biotechnology. The nucleotide sequence of the SaERF89 gene is as shown in SEQ ID NO.1, or is completely complementary to the sequence shown in SEQ ID NO.1, or is a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2. The content of α-Bisabolol in transgenic Santalum album callus is significantly increased, providing a new method for the high-efficient production of α-Bisabolol.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and specifically relates to the Santalum album SaERF89 gene and its application in the biosynthesis of α-bisabolol. Background Art

[0002] Santalum album is a well-known aromatic plant, and its wood and essential oil are highly regarded for their unique aroma and various uses. Santalum album trees are mainly distributed in India, Australia, and Southeast Asia, and are widely planted and studied due to their precious economic value and medicinal value. Sandalwood and its essential oil have important applications in spices, medicine, and cosmetics. Sandalwood essential oil is a high-value spice extracted from sandalwood, with a warm, sweet, and woody aroma. Its aroma is long-lasting and is often used as a base ingredient in high-end perfumes and aromatherapy products. Due to its anti-inflammatory, antibacterial, and moisturizing properties, sandalwood essential oil is widely used in cosmetics and skin care products. Sandalwood essential oil can relieve skin inflammation and promote cell regeneration, and is commonly found in products such as creams, lotions, and body washes.

[0003] α-Bisabolol, also known as bisabolol and costus root alcohol, is one of the sesquiterpene compounds that exist in nature in relatively large amounts. α-Bisabolol is mainly present in chamomile essential oil, balsam poplar essential oil, and the essential oils of some Myoporum and Salvia species. α-Bisabolol has medicinal effects such as anti-inflammatory, sterilizing, healing ulcers, and dissolving gallstones, so α-Bisabolol has a wide range of uses in the pharmaceutical industry. α-Bisabolol can protect and heal the skin from the effects of daily stress, and can accelerate the skin's healing process, especially suitable for sensitive skin and the body. It is widely used in the formulations of personal care (skin and body care lotions, after-sun care products). Coupled with its anti-inflammatory and safe properties, it has become a commonly used active ingredient for skin care. α-Bisabolol has a light and pleasant aroma and is also a fixative with good stability, and its application in fragrances and flavors has also been increasingly valued. α-Bisabolol has gradually become a new favorite among personal skin care raw materials.

[0004] Currently, the synthesis of α-bisabolol mainly adopts chemical synthesis methods, but the chemical reactions involve expensive chemical reagents, harsh reaction conditions, difficult-to-control stereoselectivity, long synthetic routes, low overall yields, and environmental unfriendliness, etc. With the development of synthetic biology, more and more natural products can be artificially prepared through biological cell factories, thus overcoming the above disadvantages. At the same time, α-bisabolol is also one of the active ingredients of sandalwood essential oil. Improving the content of bisabolol in sandalwood callus is also of great significance for improving the quality and market value of sandalwood essential oil. Summary of the Invention

[0005] The technical problem to be solved by the present invention is how to increase the content of α - Bisabolol in sandalwood.

[0006] To achieve the above - mentioned invention object, the present invention provides the following technical solutions:

[0007] On the one hand, the present invention provides a transcription factor SaERF89 for increasing the content of α - Bisabolol in sandalwood, and its amino acid sequence contains the sequence shown in SEQ ID NO.2.

[0008] On the other hand, the present invention provides a gene SaERF89 for increasing the content of α - Bisabolol in sandalwood, and its sequence is a nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2,

[0009] Or based on the principle of complementary pairing, the gene provided by the present invention can be a sequence that is completely complementary to the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2.

[0010] In a preferred embodiment, the nucleotide sequence of the above - mentioned gene is as shown in SEQ ID NO:1, or a nucleotide sequence that is completely complementary to the sequence shown in SEQ ID NO.1.

[0011] It is well - known to those skilled in the art that gene sequences can also contain introns, promoters, and various regulatory elements. Therefore, the nucleotide sequence of the above - mentioned gene can also contain introns, promoters, and various regulatory elements.

[0012] On the other hand, the present invention provides an application of the transcription factor SaERF89 in increasing the content of α - Bisabolol in sandalwood, and the amino acid sequence of the transcription factor SaERF89 is the sequence shown in SEQ ID NO.2.

[0013] On the other hand, the present invention provides an application of the transcription factor SaERF89 gene in increasing the content of α - Bisabolol in sandalwood, and the nucleic acid sequence of the transcription factor SaERF89 gene encodes a nucleotide sequence containing the amino acid sequence shown in SEQ ID NO.2, or a sequence that is completely complementary to the nucleotide sequence encoding the amino acid sequence shown in SEQ ID NO.2.

[0014] In a preferred embodiment, the nucleotide sequence of the above - mentioned transcription factor SaERF89 gene is as shown in SEQ ID NO:1, or a nucleotide sequence that is completely complementary to the sequence shown in SEQ ID NO.1.

[0015] On the other hand, the present invention provides a method for increasing the content of α-Bisabolol in sandalwood, which is characterized by increasing the mRNA expression level of the transcription factor SaERF89 gene or the protein expression level of the protein encoded by the transcription factor SaERF89 gene in sandalwood cells to increase the content of α-Bisabolol in sandalwood.

[0016] In a preferred embodiment, the mRNA expression level of the transcription factor SaERF89 gene or the protein expression level of the protein encoded by the transcription factor SaERF89 gene is achieved by directly overexpressing the transcription factor SaERF89 gene in sandalwood cells.

[0017] In a preferred embodiment, the mRNA expression level of the transcription factor SaERF89 gene or the protein expression level of the protein encoded by the transcription factor SaERF89 gene is achieved by expressing other regulatory genes that positively regulate the transcription factor SaERF89 gene in sandalwood cells.

[0018] In a preferred embodiment, the increase in the content of α-Bisabolol in sandalwood refers to the increase in the content of α-Bisabolol in sandalwood callus.

[0019] On the other hand, the present invention provides an application of the aforementioned protein or the aforementioned gene in cultivating sandalwood varieties with high α-Bisabolol content.

[0020] Furthermore, the cultivation of sandalwood varieties with high α-Bisabolol content is to obtain sandalwood varieties with high α-Bisabolol content by overexpressing the aforementioned protein or the aforementioned gene.

[0021] A method for increasing the content of α-Bisabolol in sandalwood callus, which is characterized in that the method comprises the following steps:

[0022] 1) Obtain the gene as described in claim 2;

[0023] 2) Connect the gene described in step 1) with an overexpression vector to obtain a recombinant vector;

[0024] 3) Culture sandalwood callus;

[0025] 4) Transform the recombinant vector described in step 2) into the sandalwood callus described in step 3).

[0026] Compared with the prior art, the present invention has the following advantages:

[0027] The present invention provides a novel gene for regulating the content of α - Bisabolol and the protein encoded thereby, as well as a method for regulating the content of α - Bisabolol. The method can be implemented in tissue - cultured cells and can avoid a series of drawbacks of chemical synthesis. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The beneficial effects of the present invention will be described in detail below in conjunction with the drawings and specific embodiments.

[0029] Figure 1 It is the GFP signal of transgenic sandalwood callus.

[0030] Figure 2 It is the analysis of the expression of the SaERF89 gene in transgenic sandalwood callus.

[0031] Figure 3 It is the analysis of the relative content of α - Bisabolol after the transformation of SaERF89 into sandalwood callus.

[0032] Figure 4 It is the integral graph of α - Bisabolol. SPECIFIC EMBODIMENTS

[0033] The technical solutions in the embodiments of the present invention will be described clearly and completely below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of them. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without any creative work belong to the scope of protection of the present invention.

[0034] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by those of ordinary skill in the technical field to which this application belongs. The experimental methods in the following embodiments are all conventional methods unless otherwise specified. The test materials used in the following embodiments are all obtained from regular biochemical reagent stores unless otherwise specified.

[0035] The nucleotide sequence of the sandalwood SaERF89 gene involved in the present invention is shown as SEQ ID NO.1:

[0036] ATGTGCGGCGGTGCCATCATCTCCGATTACGACCCCGGCAACCGAGGCCGCAAACTCACCACGGAGGAGCTCTGGTCTGAACTCGACGCCTTCTCCGATTTCTTCAGCTTCGATCCCACGGGAGTCAATGATTTCTCATGCCACAAGCTCTCTTCCAAGCAAGAGCAACTCTCCCAAGTGACTGTTGGAGACATGGGGACGGCGGCGGGTCGCAACAACAAGGAGAAGAAGACTCAGAGGGCTCGGAAGAACGTGTACAGAGGAATCCGGCAGAGGCCGTGGGGGAAGTGGGCCGCGGAAATCCGCGACCCGCACAAGGGAGTCCGAGTCTGGCTCGGCACCTTCAACACCGCGGAAGACGCCGCGAGAGCTTACGACGCCGCCGCCAAGCGCATCCGCGGCGACAAGGCCAAGCTCAACTTCCCTAACCAACCTCCGCCGGGGGCTCCTCTGCCCAAGAGGCGGTGCCTCACCACCGAGTCGACTCGGTTCCCGACCCCTCCGAGTCGCCGCAGGGGCTGCCCCTTCCACGACAACGGAGTGTGCCCTCAGAACCAGGTGGCCAGCGAGGTGGGGCTGAAGGAGCGGATCTCGAGCTTGGAGTCCTTCCTGGGGCTGGAGCCGGAGCCGGAGTTGGCGAGCTCGGCGAGCGGAACCGGTGAGTCGACTCAGGACGATCTCTGGGTTCTGGGCGATTTCCCCCTCACAGGAGAGGGTGGATTCTAG。

[0037] The amino acid sequence of the Santalum album SaERF89 protein is shown in SEQ ID NO.2:

[0038] MCGGAIISDYDPGNRGRKLTTEELWSELDAFSDFFSFDPTGVNDFSCHKLSSKQEQLSQVTVGDMGTAAGRNNKEKKTQRARKNVYRGIRQRPWGKWAAEIRDPHKGVRVWLGTFNTAEDAARAYDAAAKRIRGDKAKLNFPNQPPPGAPLPKRRCLTTESTRFPTPPSRRRGCPFHDNGVCPQNQVASEVGLKERISSLESFLGLEPEPELASSASGTGESTQDDLWVLGDFPLTGEGGF。

[0039] Example 1 Cloning of Santalum album SaERF89 Gene

[0040] Based on the transcriptome data of Santalum album, the gene SaERF89, which is closely related to the genes in the santalol synthesis pathway, was screened using gene expression patterns. Primers were designed: SaERF89ORF F: ATGTGCGGCGGTGCCATCATC, SaERF89ORF R: ACCTAGAATCCACCCTCTCCT. RNA was extracted from Santalum album leaves, and after reverse transcription, cDNA was synthesized. Using this cDNA as a template, the full-length ORF sequence of SaERF89 was amplified and sequenced.

[0041] Example 2 Construction of Overexpression Vector of Santalum album SaERF89 Gene

[0042] ECORⅠ and XbaⅠ were used for double digestion of the pGreen35S-GFP(C17) vector, and the ORF of SaERF89 was homologously recombined onto the C17 vector using the infusion technique to obtain the 35S::SaERF89-GFP recombinant plasmid. The primers used are as follows:

[0043] 35S::SaERF89-F: GCTTGATATCGAATTCATGTGCGGCGGTGCCATCATCTCC

[0044] 35S::SaERF89-R: CAGCGAATTATCTAGAGAATCCACCCTCTCCTGTGAGGG

[0045] Example 3 Obtaining and Identification of SaERF89 Transgenic Santalum album Callus

[0046] (1) The SaERF89 overexpression plasmid was transformed into Agrobacterium tumefaciens, and positive clones were picked and placed in a liquid medium containing 1 mL LB+Kan(50 mg / L) and cultured with shaking at 28 °C and 200 rpm for 12 h.

[0047] (2) Propagation: Take 50 μL of the above-mentioned microbial suspension and add it to 50 mL of LB liquid medium containing Kan (50 mg / L). Incubate at 28°C, 200 rpm, and shake for 21 h until the OD value is about 0.6.

[0048] (3) The bacterial solution was centrifuged at 5000 g for 10 min, the bacteria were collected, and then suspended in 20 mL of infection solution (MS+AS 100 μM), and the above centrifugation conditions were repeated once.

[0049] (4) Use an equal volume of infection solution (MS+AS 100 μM) to suspend the bacteria (adjust to an OD value of 0.6) and then place it in a dark incubator at 28°C for 2-3 hours. This is the infection solution.

[0050] (5) Select sandalwood calli with good and consistent growth status, crush them with tweezers, place them in the infection solution, and infect them on a shaker at 100 rpm / min for 12 min (shake continuously during the period to ensure full contact between the infection solution and the explant).

[0051] (6) Filter the infected callus with sterile gauze in a clean bench, then place it on sterile filter paper and blow it for about 10 min to remove as much bacterial liquid as possible from the surface of the callus. Then transfer it evenly to MS solid culture medium (+0.8 mg / L 2,4-D + 100 μM AS) and culture it in the dark for 3 days.

[0052] (7) After dark culture, the callus was washed twice with sterile water for 1 min each time, then washed three times with a liquid containing 200 mg / L Timentin (antibacterial agent) for 2 min each time, and then washed three times with sterile water. Then, the callus was inoculated on a solid medium of MS + 2,4-D (0.8 mg / L) + Timentin (200 mg / L) + BASTA (0.1 mg / L) and cultured normally.

[0053] (8) After 3 days of normal culture, samples were taken and observed using an inverted fluorescence microscope. Then, on the 7th day, the infection was observed using a fluorescent microscope, and samples with obvious GFP signals were taken and stored at -80°C. Figure 1 ).

[0054] (9) Extraction of RNA from sandalwood callus

[0055] RNA was extracted from uninfected calli, 7-day-old calli transformed with empty vector C17, and 7-day-old calli transformed with 35S::SaERF89-GFP. The integrity of RNA was verified by gel electrophoresis, and the concentration of RNA was measured by a micro-spectrophotometer before subsequent reverse transcription.

[0056] (10) Reverse transcription into cDNA and qPCR analysis

[0057] The above-mentioned RNAs were respectively reverse-transcribed using the ReverTra Ace reverse transcription kit from Toyobo. 1 μg of each sample was reverse-transcribed, and SaActin was used as an internal reference to detect gene expression by qPCR. The results are as Figure 2 shown.

[0058] Example 3: SaERF89 transgenic sandalwood callus increased the content of α-Bisabolol

[0059] The content of α-Bisabolol in the samples was detected by GC-MS. The steps are as follows:

[0060] 1. Sample extraction process

[0061] (1) Take out the sample (no special requirements, default is fresh sample) from the -80 °C refrigerator, grind it in liquid nitrogen, and vortex to mix evenly. Weigh about 500 mg (1 mL for liquid) of each sample into a headspace vial; (2) Add saturated NaCl solution and 20 μL (10 μg / mL) internal standard solution respectively; (3) Perform sample extraction by automatic headspace solid-phase microextraction (HS-SPME) for GC-MS analysis.

[0062] 2. Chromatography and mass spectrometry collection conditions

[0063] HS-SPME extraction conditions: Under the constant temperature condition of 60 °C, shake for 5 min. Insert the 120 μm DVB / CWR / PDMS extraction head into the headspace vial of the sample, perform headspace extraction for 15 min, desorb at 250 °C for 5 min, and then perform GC-MS separation and identification. Before sampling, the extraction head is aged at 250 °C in the Fiber Conditioning Station for 5 min. Note: The new extraction head is aged for 2 h in the Fiber Conditioning Station before extraction. And SPME Arrow is used, whose sensitivity can reach 10 times that of the traditional SPME fiber head.

[0064] Chromatography conditions: DB-MS capillary column (30 m × 0.25 mm × 0.25 μm, Agilent J&W Scientific, Folsom, CA, USA), the carrier gas is high-purity helium (purity not less than 99.999%), the constant flow rate is 1.2 mL / min, the injection port temperature is 250 °C, splitless injection, and the solvent delay is 3.5 min. Program temperature rise: Keep at 40 °C for 3.5 min, rise to 100 °C at a rate of 10 °C / min, then rise to 180 °C at a rate of 7 °C / min, and finally rise to 280 °C at a rate of 25 °C / min and keep for 5 min.

[0065] Mass spectrometry conditions: Electron impact ionization source (EI), ion source temperature 230 °C, quadrupole temperature 150 °C, mass spectrometry interface temperature 280 °C, electron energy 70 eV, scanning mode is selected ion monitoring (SIM), qualitative and quantitative ions are accurately scanned (GB 23200.8-2016).

[0066] 3. Based on multiple species, literature, some reference standards and retention indices, a database was independently established, including determined RT and qualitative and quantitative ions for accurate scanning in selected ion monitoring mode. For each compound, 1 quantitative ion and 2 - 3 qualitative ions were selected for accurate scanning in selected ion monitoring mode. All the ions to be detected in each group were detected separately at different time intervals according to the elution order. If the detected retention time was consistent with the standard reference and the selected ions all appeared in the sample mass spectrum after background subtraction, the substance was determined (Yuan et al., 2021); the quantitative ions were selected for integration and calibration to enhance the accuracy of quantification. The original data after mass spectrometry analysis was processed by MassHunter software for qualitative and quantitative analysis.

[0067] The results showed that after overexpression of SaERF89 in sandalwood callus, the relative content of α-Bisabolol increased by an average of 34.89%, showing a highly significant difference ( Figure 3 、 Figure 4 ).

[0068] The above are only the preferred embodiments of the present invention, and do not impose any form of limitation on the present invention. Although the present invention has been disclosed as above with preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make some changes or modifications to equivalent embodiments by using the disclosed technical content within the scope of the technical solution of the present invention. However, any brief modifications, equivalent changes and modifications made to the above embodiments based on the technical essence of the present invention without departing from the content of the technical solution of the present invention still fall within the scope of the technical solution of the present invention.

Claims

1. The use of protein in regulating the content of α-bisabolol in sandalwood, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.2; the regulation of the α-bisabolol content in sandalwood is to increase the expression level of the protein in sandalwood cells to achieve the increase of the α-bisabolol content in sandalwood.

2. The application of gene in regulating the content of α-bisabolol in sandalwood, characterized in that: The gene sequence encodes an amino acid sequence as shown in SEQ ID NO.2; the regulation of the α-bisabolol content in sandalwood is to increase the α-bisabolol content in sandalwood by increasing the expression level of the gene in sandalwood cells.

3. The use according to claim 1 or 2, characterized in that: The regulating the α-bisabolol content in sandalwood refers to increasing the α-bisabolol content in sandalwood callus.

4. The use of protein in cultivating sandalwood varieties with high α-bisabolol content, characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.2; the cultivation of sandalwood varieties with high α-bisabolol content is achieved by overexpressing the protein.

5. Application of the gene in breeding sandalwood varieties with high α-bisabolol content, characterized in that: The gene sequence encodes the amino acid sequence shown in SEQ ID NO.2; the cultivation of sandalwood varieties with high α-bisabolol content is achieved by overexpressing the gene.

6. A method for increasing the content of α-bisabolol in sandalwood callus, characterized in that: The method comprises the following steps: 1) obtaining a gene, wherein the gene sequence encodes an amino acid sequence as shown in SEQ ID NO.2; 2) connecting the gene in step 1) with an overexpression vector to obtain a recombinant vector; 3) Cultivating sandalwood callus; 4) Transforming the recombinant vector described in step 2) into the sandalwood callus described in step 3).