Application of wheat TaSnRK1 protein and its related biomaterials in improving plant heat tolerance

Abstract

The invention discloses the application of wheat TaSnRK1 protein and related biological materials in improving plant heat resistance. The TaSnRK1 protein is derived from wheat ( Summer wheat L.), the gene encoding TaSnRK1 protein was named TaSnRK1 Gene. The present invention cloned the gene from the wheat cultivar Chinese Spring TaSnRK1 , through the use of genetic engineering technology, it was overexpressed in the wheat variety Fielder, so that TaSnRK1 The overexpressed plants have stronger heat resistance than the wild type. The invention has important significance for the research on plant heat resistance and the breeding of high temperature resistant wheat.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to application of wheat TaSnRK1 protein and related biological materials in improving plant heat resistance. Background Art

[0002] Wheat is the world's second largest food crop, providing 20% ​​of the world's total dietary calories and feeding nearly 40% of the world's population. It plays an important role in agricultural production.

[0003] Wheat is a cold-loving crop. High temperature stress can cause permanent damage to its growth and development, resulting in reduced yield and deterioration of quality. Wheat is susceptible to dry hot winds during the flowering and grain filling periods, which shortens the grain filling period, causes the leaves to lose green color, and reduces yield. According to statistics, for every 1°C increase in global temperature, grain crop yields decrease by about 6%. Therefore, high temperature has become one of the important climate disasters that restrict wheat grain production.

[0004] The breeding and application of heat-resistant varieties are effective methods to improve the heat tolerance of wheat. In-depth exploration of new heat-resistant genes and research on new mechanisms of heat tolerance in wheat are of great significance to improving the heat tolerance of wheat. Summary of the invention

[0005] In view of this, the object of the present invention is to provide the use of wheat TaSnRK1 protein and related biological materials in improving the heat resistance of plants.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] 1. Wheat TaSnRK1 protein, selected from any of the following:

[0008] (a1) a protein having an amino acid sequence as shown in SEQ ID NO.1;

[0009] (a2) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein described in (a1).

[0010] As one of the preferred technical solutions, the tag described in (a2) can be a Flag tag, a His tag, a MBP tag, a HA tag, a myc tag, a GST tag and / or a SUMO tag, etc.

[0011] 2. Genes encoding the aforementioned proteins TaSnRK1 , selected from any of the following:

[0012] (b1) a DNA molecule whose coding region is shown in SEQ ID NO.2;

[0013] (b2) a DNA molecule having a nucleotide sequence as shown in SEQ ID NO.3;

[0014] (b3) A DNA molecule that hybridizes with the DNA molecule defined in (b1) or (b2) under stringent conditions and encodes the protein.

[0015] As one of the preferred technical solutions, the stringent conditions described in (b3) are: hybridization and membrane washing twice at 68°C in a solution of 2×SSC (nucleic acid hybridization washing solution) with a mass fraction of 0.1% SDS (sodium dodecyl sulfate), for 5 minutes each time, and hybridization and membrane washing twice at 68°C in a solution of 0.5×SSC with a mass fraction of 0.1% SDS, for 15 minutes each time.

[0016] 3. Biological materials related to wheat TaSnRK1 protein, selected from any of the following:

[0017] (c1) containing the above TaSnRK1 expression cassette of the gene;

[0018] (c2) containing the above TaSnRK1 A recombinant vector or recombinant microorganism containing the gene or the expression cassette described in (c1);

[0019] (c3) containing the above TaSnRK1 Genetically modified plant cell lines;

[0020] (c4) containing the above TaSnRK1 Genetically modified plant tissue;

[0021] (c5) containing the above TaSnRK1 Genetically modified plant organs;

[0022] (c6) containing the above TaSnRK1 Genetically modified plants;

[0023] (c7) Tissue culture produced from regenerable cells of the transgenic plant described in (c6);

[0024] (c8) Protoplasts produced from the tissue culture described in (c7).

[0025] As one of the preferred technical solutions, the expression cassette in (c1) refers to a DNA capable of expressing the TaSnRK1 protein in a host cell, and the DNA may include not only a promoter for initiating transcription of a protein-coding gene, but also a terminator for terminating transcription of a protein-coding gene. Further, the expression cassette may also include an enhancer sequence. Promoters that can be used in the present invention include, but are not limited to, constitutive promoters, tissue, organ and development-specific promoters, and inducible promoters.

[0026] As one of the preferred technical solutions, the recombinant vector in (c2) is constructed by a plant expression vector, which includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment, such as pAHC25, pWMB123, pBin438, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pBI121, pCAMBIA1391-Xa or pCAMBIA1391-Xb (CAMBIA Company), etc. In order to facilitate the identification and screening of transgenic plants, the expression vector used can be processed, such as adding genes that can produce color-changing enzymes or luminescent compounds expressed in plants, antibiotic resistance markers, or chemical resistance marker genes, etc. Considering the safety of transgenics, no selective marker gene can be added, and the transformed plants can be directly screened by phenotype.

[0027] As one of the preferred technical solutions, the transgenic plant described in (c6) is obtained by the following method: introducing the recombinant vector described in (c2) into a recipient plant, and obtaining a transgenic plant with improved heat resistance through induction, subculture, preculture, co-culture, resistance screening, differentiation, rooting culture, seedling hardening, and transplanting.

[0028] 4. The aforementioned wheat TaSnRK1 protein and the gene encoding the protein TaSnRK1 Or the use of relevant biological materials in regulating plant heat tolerance, wherein the plant is wheat.

[0029] 5. The aforementioned wheat TaSnRK1 protein and the gene encoding the protein TaSnRK1 Or the application of related biological materials in the breeding of heat-resistant wheat varieties.

[0030] 6. A method for breeding heat-resistant wheat varieties, enhancing the activity of the aforementioned TaSnRK1 protein in wheat, or improving the gene TaSnRK1 The expression amount.

[0031] The beneficial effects of the present invention are:

[0032] The present invention relates to the application of wheat TaSnRK1 protein and related biological materials in improving plant heat resistance. The TaSnRK1 protein is derived from wheat ( Triticum aestivum L.), the gene encoding TaSnRK1 protein was named TaSnRK1 Gene. The present invention cloned the gene from the wheat cultivar Chinese Spring TaSnRK1 By using genetic engineering technology, it is overexpressed in the wheat variety Fielder, so that TaSnRK1 overexpressing plants have stronger heat resistance than wild type. The present invention is of great significance for plant heat resistance research and breeding of high temperature resistant wheat. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to make the purpose, technical solution and beneficial effects of the present invention clearer, the present invention provides the following drawings for illustration:

[0034] Figure 1 Schematic diagram of pWMB110 vector.

[0035] Figure 2 This is the electrophoresis diagram of PCR identification of transgenic plants.

[0036] Figure 3 The results are the relative transcription levels of transgenic plants, **** represents p ≤ 0.0001.

[0037] Figure 4 The phenotypic photos of the heat-treated transgenic plants are shown in Figure 1. From left to right, the order is Fielder control wheat, TaSnRK1 Overexpression lines OE1 and OE2.

[0038] Figure 5 The survival rate of the heat treatment group is shown in the figure below. The vertical axis is the survival rate. **** represents p≤0.0001. DETAILED DESCRIPTION

[0039] The preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings.

[0040] The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples are repeated three times, and the results are averaged. Example 1

[0041] Heat tolerance gene in wheat TaSnRK1 Clone

[0042] The wheat variety Chinese Spring was selected as the amplification template because it was the first wheat variety to complete sequencing and assembly. Chinese Spring seeds were placed on seedling paper and cultured for 7 days to obtain wheat seedlings. The wheat seedlings were sampled and frozen in liquid nitrogen for grinding. RNA was extracted by Trizol method, and reverse transcription was performed using RNA as a template to obtain cDNA. PCR amplification was performed using the obtained cDNA as a template.

[0043] The primer pairs used to amplify the TaSnRK1 gene are as follows:

[0044] TaSnRK1-F:5'-ATGAAGGCGACGGTCAAGGGC-3';

[0045] TaSnRK1-R:5'-GATCTCATAGTTCCACGTGCT-3';

[0046] The PCR reaction program was: 94°C 3min pre-denaturation; 98°C 10s, 58°C 15s, 68°C 40s, 35 cycles; 68°C 5min extension. The PCR product was connected to a blunt-end T vector for sequencing to obtain the T-TaSnRK1 vector.

[0047] The method used in this embodiment TaSnRK1 The gene overexpression vector is the recombinant plasmid pWMB110-TaSnRK1-GFP. pWMB110-TaSnRK1-GFP is a recombinant vector obtained by adding a GFP fusion tag gene to the pWMB110-GFP vector (pWMB110-GFP is a special overexpression transformation vector pWMB110 in wheat transformation); Figure 1 ,Related literature: Yanan Chang, Junxian Liu, Chang Liu, Huiyun Liu, Huali Tang, Yuliang Qiu, Zhishan Lin, Ke Wang, Yueming Yan, Xingguo Ye.(2024).Establishment of a transformation system in close relatives of wheat under the assistance of TaWOX5.Journal of Integrative Agriculture,23(6), 1839-1849. https: / / doi.org / 10.1016 / j.jia.2023.06.021) was used to insert the nucleotide sequence shown in SEQ ID NO.2 into the BamHI site of pWMB110, while keeping the other nucleotide sequences of the pWMB110 vector unchanged to obtain the recombinant vector. Example 2

[0048] Heat tolerance gene in wheat TaSnRK1 Construction of expression vector

[0049] The T-TaSnRK1 vector obtained by sequencing was used as a template and the following primers were used

[0050] pWMB110-TaSnRK1-F:5'- AGGTCGACTCTAGAGGATCC ATGGACGCAGCAGGCAGAGA-3'

[0051] pWMB110-TaSnRK1-R:5'- AGCTCGGTACCCGGGGATCC GAGGACTCTCAGCTGGGTTA-3'

[0052] Perform PCR amplification (the underlined part of the primer is the vector connection part sequence), and the amplified product is gel-recovered and purified (Zhuangmeng Micro-column Concentrated DNA Gel Recovery Kit ZPV202) to obtain the purified PCR product for subsequent connection;

[0053] The vector pWMB110-GFP connected to the maize ubiquitin promoter was digested with restriction endonuclease BamHI, and the vector digestion product and PCR product were connected (connection conditions: 50℃, 20min) to obtain the recombinant plasmid. The recombinant plasmid was sequenced to verify that the primers were universal primers for the pWMB110 vector:

[0054] Ubi-F:5'-TTTAGCCCTGCCTTCATACGC-3',

[0055] Tnos-R:5'-AGACCGGCAACAGGATTCAATC-3'

[0056] Get the content TaSnRK1 The positive recombinant plasmid pWMB110-TaSnRK1-GFP of the gene, the recombinant vector plasmid pWMB110-TaSnRK1-GFP contains the TaSnRK1 The CDS sequence of the gene can express the TaSnRK1 protein shown in SEQ ID NO.1. Example 3

[0057] Obtaining transgenic plants and observing their phenotypes

[0058] The recombinant plasmid pWMB110-TaSnRK1-GFP was transformed into Agrobacterium EHA105 (WEIDI, CAT#: AC1013). The transformation method of plants was carried out by Agrobacterium-mediated method. The screening marker in plants is Bar. 1 μg of the recombinant vector plasmid pWMB110-TaSnRK1-GFP prepared in Example 2 was taken to transform the competent cells of Agrobacterium EHA105, and cultured in LB medium (containing kanamycin 50 mg / L and rifampicin 25 mg / L) at 28°C for two days to select positive clones.

[0059] PCR identification was performed using primers Ubi-F and Tnos-R. The positive bacterial solution obtained by PCR identification was named recombinant Agrobacterium EHA105 / pWMB110-TaSnRK1-GFP and stored at -80°C.

[0060] 3. The recombinant Agrobacterium obtained in step 2 was used to infect the embryonic callus of wheat Fielder, referring to the wheat transformation method of Hayta et al. (relevant literature: Hayta, S., Smedley, MA, Clarke, M., Forner, M., and Harwood, WA. (2021). An efficient Agrobacterium-mediated transformation protocol for hexaploid and tetraploid wheat. Curr. Protoc. 1: e58.), and then differentiation culture, rooting culture, and herbicide resistance screening (screening concentration was 250 mg / L) were carried out in sequence to obtain 6 T0 generation regenerated plants.

[0061] 4. The six T0 generation regenerated plants obtained in step 3 were identified by PCR.

[0062] PCR identification method: Take plant leaves, extract genomic DNA, and use the primer pair consisting of Ubi-F and Tnos-R for PCR amplification. If an amplification product with the correct fragment size is obtained, the identification result is positive and the plant is a transgenic plant.

[0063] The electrophoresis diagram of transgenic plants identified by PCR is shown in Figure 2 . Figure 2 In the figure, M is a molecular weight marker, #1 to #6 represent different transgenic plants, + represents the recombinant plasmid pWMB110-TaSnRK1-GFP (positive control), and WT represents wheat Fielder plants (negative control).

[0064] Among the 6 T0 generation regenerated plants, 6 were transgenic plants. The T0 generation positive transgenic overexpression wheat was planted and harvested to obtain T1 generation transgenic overexpression wheat seeds and planted to obtain T1 generation plants. The T1 generation plants were also PCR identified using Bar gene detection primers to obtain positive T1 generation plants. The seeds of the T1 generation positive plants were harvested and further planted and tested to obtain 2 T2 generation positive transgenic wheat homozygous lines. TaSnRK1-OE1 , TaSnRK1-OE2 .

[0065] 5. Detection of TaSnRK1 transgenic expression

[0066] In the two TaSnRK1 transgenic T2 overexpression lines TaSnRK1 The gene expression level was detected.

[0067] The experiment was repeated three times. Each repeated experiment was set up as follows: total RNA from leaves of two transgenic overexpression lines and wild-type (WT) wheat Fielder was extracted and reverse transcribed into cDNA. Real-time RT-PCR was used to detect wheat-actin as the internal standard gene. TaSnRK1 The relative expression of genes. The primer sequences are as follows:

[0068] q TaSnRK1-F: 5′-GGGGGAATATACACCCTTCC- 3′;

[0069] q TaSnRK1-R: 5′-GAGGAGGCACAGCCAAATAG-3′.

[0070] The primer pairs used to detect the internal reference gene (wheat-actin gene) are as follows:

[0071] q wheat-actin-F: 5′-GGAATCCATGAGACCACCTAC-3′;

[0072] q wheat-actin-R: 5′-GACCCAGACAACTCGCAAC-3′.

[0073] The reaction system of real-time quantitative PCR (10 μl): 2× Green Master Mix 5 μl, primer F (2 μM) 1 μl, primer R (2 μM) 1 μl, cDNA template 1 μl, ddH2O 2 μl.

[0074] The reaction procedure of real-time quantitative PCR was as follows: pre-denaturation at 94°C for 5 min; 40 cycles of 94°C for 20 s, 60°C for 20 s, and 72°C for 25 s; 72°C for 5 min; 60°C-95°C, reading the plate every 0.2°C for melting curve.

[0075] C =2 -△CT , ΔCt =Ct 目标基因 –Ct 内参基因 The average of the three replicate C values ​​was calculated as the relative expression level of the target gene. t The results are shown in Figure 3 .

[0076] 6. Identification of resistance to (high temperature) heat stress

[0077] Seeds for testing: TaSnRK1-OE1 T2 generation seeds of the line, TaSnRK1-OE2 T2 generation seeds of the line and wheat Fielder seeds.

[0078] Culture conditions: 22°C, 16h light / 8h dark.

[0079] (1) Take the test seeds, soak them in a 1% sodium hypochlorite aqueous solution for 15 min, and then wash them with distilled water for 6 times.

[0080] (2) Take the seeds obtained in step (1) and place them in a dark place at 4°C for 3 days.

[0081] (3) Take the seeds obtained in step (2) and culture them until the seedlings germinate for 2 days.

[0082] (4) Select seedlings with consistent growth and transfer them to a pH 6.0 Hogland nutrient solution for hydroponics (the nutrient solution was changed every 2 days). After 7 days of hydroponics, transfer them to a 42°C incubator for 6 days and then transfer them to a 20°C incubator for recovery for one week. The survival rate was calculated. The results showed that after high temperature treatment at 42°C, TaSnRK1 Compared with the wild-type Fielder, the overexpressed material has more upright plants, less wilting and yellowing of leaves, and thicker stems than the wild-type Fielder ( Figure 4 ), the plant survival rate is higher ( Figure 5 ), with a better (high temperature) heat stress tolerance phenotype.

[0083] Therefore, TaSnRK1 protein has the function of improving wheat resistance to (high temperature) heat stress. Overexpression of TaSnRK1 protein can significantly improve the heat resistance of plants and can be applied to plant heat-resistant breeding and variety improvement.

[0084] Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that various changes can be made in form and details without departing from the scope defined by the claims of the present invention.

Claims

1. Application of wheat TaSnRK1 protein, gene TaSnRK1 encoding the protein or related biological materials in regulating plant heat tolerance, wherein the plant is wheat; Wheat TaSnRK1 protein, the amino acid sequence of which is shown in SEQ ID NO.1; The gene encoding the protein, TaSnRK1, is selected from any of the following: (b1) a DNA molecule whose coding region is shown in SEQ ID NO.2; (b2) a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.3; The related biological material is selected from any one of the following: (c1) an expression cassette containing the TaSnRK1 gene described in (b1) or (b2); (c2) A recombinant vector or a recombinant microorganism containing the TaSnRK1 gene described in (b1) or (b2) or the expression cassette described in (c1).

2. The use according to claim 1, characterized in that: The expression cassette in (c1) refers to a DNA capable of expressing the TaSnRK1 protein in a host cell.

3. The use according to claim 1, characterized in that: The recombinant vector in (c2) is constructed from a plant expression vector, which includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment.

4. Application of wheat TaSnRK1 protein, the gene TaSnRK1 encoding the protein or related biological materials in breeding heat-resistant wheat varieties; Wheat TaSnRK1 protein, the amino acid sequence of which is shown in SEQ ID NO.1; The gene encoding the protein, TaSnRK1, is selected from any of the following: (b1) a DNA molecule whose coding region is shown in SEQ ID NO.2; (b2) a DNA molecule with a nucleotide sequence as shown in SEQ ID NO.3; The related biological material is selected from any one of the following: (c1) an expression cassette containing the TaSnRK1 gene described in (b1) or (b2); (c2) A recombinant vector or a recombinant microorganism containing the TaSnRK1 gene described in (b1) or (b2) or the expression cassette described in (c1).

5. The use according to claim 4, characterized in that: The expression cassette in (c1) refers to a DNA capable of expressing the TaSnRK1 protein in a host cell.

6. The use according to claim 4, characterized in that: The recombinant vector in (c2) is constructed from a plant expression vector, which includes a binary Agrobacterium vector and a vector that can be used for plant microprojectile bombardment.

7. A method for breeding heat-resistant wheat varieties, characterized in that: Enhance the activity of TaSnRK1 protein in wheat, or increase the expression level of gene TaSnRK1; Wheat TaSnRK1 protein, the amino acid sequence of which is shown in SEQ ID NO.1; The gene encoding the protein, TaSnRK1, is selected from any of the following: (b1) a DNA molecule whose coding region is shown in SEQ ID NO.2; (b2) A DNA molecule having a nucleotide sequence as shown in SEQ ID NO.3.

Images