A glycosyltransferase ugt76g1 mutant and applications thereof

Abstract

This invention discloses a glycosyltransferase UGT76G1 mutant, which is (a) a protein with the amino acid sequence shown in SEQ ID NO.3; or (b) a protein derived from (a) having one or more amino acid sequences substituted, deleted, or added in the amino acid sequence shown in SEQ ID NO.3, and possessing enzymatic activity catalyzing the conversion of rebaudioside D to rebaudioside M. This invention also discloses the gene sequence encoding the glycosyltransferase UGT76G1 mutant of claim 1. This invention significantly improves the enzyme activity of glycosyltransferase UGT76G1 through site-directed mutagenesis. Compared with wild-type glycosyltransferase UGT76G1, the optimal mutant enzyme activity is increased by 4.72 times, thus significantly reducing the amount of enzyme used. This invention heterologously expresses the glycosyltransferase UGT76G1 mutant and sucrose synthase SUS in Pichia pastoris, without purification, and constructs a "UDP-UDPG" cyclic regeneration system using crude enzyme solution, avoiding the need to add additional UDPG as a glycosyl donor, thus significantly reducing costs.

Description

Technical Field

[0001] This invention belongs to the field of bioenzyme engineering technology, specifically, it relates to a glycosyltransferase UGT76G1 mutant and its applications. Background Technology

[0002] With the improvement of living standards, healthy eating has become one of the daily pursuits of people today. However, excessive sugar intake places a heavy burden on the body, leading to various chronic diseases. Therefore, steviol glycosides from stevia have received widespread attention due to their high sweetness, low calories, and high safety. Stevia (5-10% of the dry weight of leaves) and Reb A (2-4% of the dry weight of leaves) are the two most abundant components and are also the main ingredients in commercially available steviol glycoside additives. They have a sweetness 250-300 times greater than sucrose, but their bitter aftertaste significantly affects their taste as sweeteners. Reb M, which is present in lower amounts among steviol glycosides, has a higher sweetness than Reb A and stevia, reduces the bitter aftertaste, and has a faster sweetening effect, thus providing a better taste as a sweetener and is considered a very promising next-generation sweetener. However, the content of RebM in stevia leaves is only 0.4%-0.5%, which is only about one-tenth of the content of Reb A. The cumbersome and complicated extraction method makes it difficult to achieve large-scale production and meet market demand by extracting it only from stevia leaves.

[0003] The biosynthetic preparation of Reb M has been a key research focus in recent years. The glycosyltransferase UGT76G1 can catalyze the conversion of Reb D to Reb M in the presence of uridine diphosphate glucose (UDPG), but its wild-type enzyme activity is low, thus necessitating the development of high-activity, high-conversion-rate processes. Furthermore, UGT76G1 requires UDPG as a glycosyl donor, but the high market price of UDPG limits its industrial production. Summary of the Invention

[0004] To address the aforementioned problems in the prior art, this invention successfully obtained a mutant with high enzyme activity by structurally modifying the glycosyltransferase UGT76G1. The optimal mutant was then combined with sucrose synthase SUS to establish a UDPG recycling system, avoiding the need for the expensive additional addition of UDPG, thus providing a new method for the production of Reb M.

[0005] Therefore, in a first aspect, the present invention provides a glycosyltransferase UGT76G1 mutant, said mutant being:

[0006] (a) A protein with the amino acid sequence shown in SEQ ID NO. 3; or

[0007] (b) A protein derived from (a) having one or more amino acid sequences substituted, deleted or added in the amino acid sequence shown in SEQ ID NO.3 and having enzymatic activity catalyzing the conversion of rebaudioside D to rebaudioside M.

[0008] In a second aspect, the present invention provides a gene sequence encoding the glycosyltransferase UGT76G1 mutant described above.

[0009] A third aspect of the present invention provides a method for preparing the glycosyltransferase UGT76G1 mutant, comprising the following steps:

[0010] S1: The amino acid sequence of glycosyltransferase UGT76G1 was obtained from Genbank according to accession number AGL95113.1, and the sequence was optimized according to the codon preference of Pichia pastoris to obtain the codon-optimized UGT76G1 gene sequence.

[0011] S2: The whole gene was synthesized and ligated into the multiple cloning restriction site of the vector pPICZA to obtain the recombinant plasmid pPICZA-UGT76G1;

[0012] S3: Using recombinant plasmid pPICZA-UGT76G1 as a template, perform full plasmid PCR, and sequentially perform four rounds of site-directed mutagenesis to construct the corresponding recombinant plasmid carrying the mutant.

[0013] S4: The recombinant plasmid that has been identified as correct is transformed into the host bacteria to obtain transformants;

[0014] S5: Ferment the obtained transformants to obtain the glycosyltransferase UGT76G1 mutant;

[0015] The primer pair sequences for the four rounds of site-directed mutagenesis in step S3 are as follows:

[0016] P84H-F: TGGTCATTTGGCTGGTATGAGGATTCCAATTATTAATGAAC; (SEQ ID NO.4)

[0017] P84H-R: ATACCAGCCAAATGACCATGAGTTGGCAAATTAGAAATTCTTTCA; (SEQ ID NO.5)

[0018] I199A-F: CAAGCTTTGAAAGAAATTTTGGGTAAAATGATTAAACAAACTAGAG; (SEQ ID NO. 6)

[0019] I199A-R: AATTTCTTTCAACGATTGCCAGTTAGAATAAGCAGATTTAATATCCTTAAC; (SEQ IDNO.7)

[0020] T284S-F: TTCTTCTTCTGAAGTTGATGAAAAAGATTTTTTGGAAATTGC; (SEQ ID NO.8)

[0021] T284S-R: TCAACTTCAGAAGAAGAACCAAAAGAAACATACAAAACAGAAGATG; (SEQ ID NO.9)

[0022] W359F-F:ATTCTTTTTGGAACTCTACTTTGGAATCTGTTTGTGAAGG; (SEQ ID NO.10)

[0023] W359F-R: TAGAGTTAAAACCAGAATGAGTCCAAAAAGCACC; (SEQ ID NO.11)

[0024] According to a preferred embodiment of the present invention, the sequence of the codon-optimized UGT76G1 gene described in step S1 is shown in SEQ ID NO.1.

[0025] In a fourth aspect, the present invention provides a recombinant expression vector having cloned a gene sequence encoding the glycosyltransferase UGT76G1 mutant.

[0026] In a fifth aspect, the present invention provides a recombinant Pichia pastoris strain, wherein the recombinant strain is cloned with the recombinant expression vector described above.

[0027] According to a preferred embodiment of the present invention, the recombinant strain is obtained by transforming the recombinant expression vector into Pichia pastoris X33.

[0028] A sixth aspect of the present invention provides a method for synthesizing rebaudioside M, wherein the method utilizes the aforementioned glycosyltransferase UGT76G1 mutant in combination with sucrose synthase SUS to catalyze a reaction using rebaudioside D as a substrate to obtain rebaudioside M.

[0029] According to a preferred embodiment of the present invention, the sequence of the gene encoding the sucrose synthase SUS is shown in SEQ ID NO.2.

[0030] According to a preferred embodiment of the present invention, the reaction temperature of the catalytic reaction is 40°C, and the reaction system, in 10 mL increments, comprises:

[0031] 100mM potassium phosphate buffer (pH 8.0, containing 100mM NaCl), 400mM sucrose, 0.8mM UDP, 20g / LRebD, 10mg sucrose synthase SUS, 50mg glycosyltransferase UGT76G1.

[0032] A seventh aspect of the present invention provides an application of the aforementioned glycosyltransferase UGT76G1 mutant for catalyzing the synthesis of rebaudioside M from rebaudioside D.

[0033] The present invention has the following beneficial effects:

[0034] 1. This invention significantly improves the enzyme activity of glycosyltransferase UGT76G1 through site-directed mutagenesis. Compared with wild-type glycosyltransferase UGT76G1, the optimal mutant enzyme activity is increased by 4.72 times, thus significantly reducing the amount of enzyme used.

[0035] 2. In this invention, the glycosyltransferase UGT76G1 mutant and sucrose synthase SUS are heterologously expressed in Pichia pastoris, respectively. No purification is required. A "UDP-UDPG" cyclic regeneration system is constructed using crude enzyme solution, avoiding the need to add UDPG as a glycosyl donor, thus significantly reducing costs.

[0036] 3. This invention further improves the conversion rate of Reb D and the yield of Reb M by optimizing the catalytic reaction conditions, and has good application prospects. Detailed Implementation

[0037] The following specific embodiments further illustrate the present invention, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in this technical field.

[0038] Unless otherwise specified, the reagents and materials used in the following examples are commercially available or can be prepared by conventional methods known in the art.

[0039] The Pichia pastoris host strain X33 used in the following examples is a commercial strain that can be obtained through conventional commercial channels.

[0040] The plasmid vector pPICZA used in the following examples is a commercially available plasmid that can be obtained through conventional commercial channels.

[0041] Unless otherwise specified, the methods used in the following embodiments are conventional operations in this technical field or are performed in accordance with the product manual.

[0042] Example 1: Obtaining the glycosyltransferase UGT76G1 gene and constructing mutants

[0043] The amino acid sequences of stevia-derived glycosyltransferase UGT76G1 (accession number: AGL95113.1) and mung bean-derived sucrose synthase SUS (accession number: BAA01108.1) were downloaded from Genbank. The sequences were then optimized according to the codon preference of Pichia pastoris to obtain the codon-optimized UGT76G1 and SUS genes, whose sequences are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively.

[0044] The whole gene was synthesized by Suzhou Genewise Biotechnology Co., Ltd. and ligated into the multiple cloning restriction sites of the vector pPICZA to obtain recombinant plasmids pPICZA-UGT76G1 and pPICZA-SUS.

[0045] Using recombinant plasmid pPICZA-UGT76G1 as a template, full plasmid PCR was performed using the following primer pairs, followed by one or more rounds of site-directed mutagenesis to construct the corresponding recombinant plasmids carrying the mutants:

[0046] P84H-F: TGGTCATTTGGCTGGTATGAGGATTCCAATTATTAATGAAC;

[0047] P84H-R: ATACCAGCCAAATGACCATGAGTTGGCAAATTAGAAATTCTTTCA;

[0048] N151D-F: CTTCTTTGTTTGATTTTCATGCTCATGTTTCTTTGCCACA;

[0049] N151D-R:GAAAATCAAACAAAGAAGAAGTCATCAAAACCAATCTTCT;

[0050] I199A-F: CAAGCTTTGAAAGAAATTTTGGGTAAAATGATTAAACAAACTAGAG;

[0051] I199A-R: AATTTCTTTCAACGATTGCCAGTTAGAATAAGCAGATTTAATATCCTTAAC;

[0052] T284S-F:TTCTTCTTCTGAAGTTGATGAAAAAGATTTTTTGGAAATTGC;

[0053] T284S-R:TCAACTTCAGAAGAAGAACCAAAAGAAACATACAAAACAGAAGATG;

[0054] W338A-F:AAAGCTGTTCCACAACAAGAAGTTTTGGCTCA;

[0055] W338A-R:TTGTTGTGGAACAGCTTTAACAATTCTACCTCTTTCACCCAAAAAACC;

[0056] W359F-F:ATTCTTTTTGGAACTCTACTTTGGAATCTGTTTGTGAAGG;

[0057] W359F-R:TAGAGTTAAAACCAGAATGAGTCCAAAAAGCACC;

[0058] Q381W-F:TGGATTGGCCATTGAATGCTAGATATATGTCTGATGTTTTGAA;

[0059] Q381W-R:CATTCAATGGACCATCCAAACCAAAATCAGAAAAAATCATTGGAACA;

[0060] The obtained mutant plasmids were sequenced and identified by Suzhou Genewise Biotechnology Co., Ltd. The plasmids pPICZA-UGT76G1-P84H, pPICZA-UGT76G1-N151D, pPICZA-UGT76G1-I199A, pPICZA-UGT76G1-T284S, pPICZA-UGT76G1-W338A, pPICZA-UGT76G1-W359F, and pPICZA-UGT76G1-Q381 were confirmed to be mutants. W. pPICZA-UGT76G1-P84H / T284S, pPICZA-UGT76G1-I199A / T284S, pPICZA-UGT76G1-T284S / W359F, pPICZA-UG T76G1-P84H / I199A / T284S, pPICZA-UGT76G1-I199A / T284S / W359F, pPICZA-UGT76G1-P84H / I199A / T284S / W359 F and wild-type plasmid pPICZA-UGT76G1 were linearized and purified by enzyme digestion, then electroporated into Pichia pastoris host strain X33 competent cells, and plated onto YPDS solid plates containing 100 μg / mL bleomycin (20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose, 182.17 g / L sorbitol). The plates were incubated upside down at 30°C, and positive transformants were screened, resulting in 14 recombinant Pichia pastoris strains, named X33-P84H, X33-N, etc. 151D, X33-I199A, X33-T284S, X33-W338A, X33-W359F, X33-Q381W, 84S / W359F, X33-P84H / I199A / T284S, X33-I199A / T284S / W359F,

[0061] Example 2: Induction and expression of recombinant Pichia pastoris strain and preparation of crude enzyme solution

[0062] Fourteen recombinant Pichia pastoris strains obtained in Example 1 were inoculated into YPG (20 g / L peptone, 10 g / L yeast extract, 10 g / L glycerol) medium and cultured at 220 rpm and 30 °C for 20-22 h with shaking to obtain primary seed culture.

[0063] The primary seed culture was inoculated into 200 mL of YPG medium at a ratio of 10% (v / v) and cultured overnight at 220 rpm and 30 °C to obtain the secondary seed culture.

[0064] The secondary seed culture was inoculated into a fermenter containing fermentation medium at a ratio of 10% (v / v). The fermentation medium was formulated as follows: 26.07 mL / L phosphate, 1.18 g / L calcium sulfate dihydrate, 18.2 g / L potassium sulfate, 14.9 g / L magnesium sulfate heptahydrate, 4.13 g / L potassium hydroxide, 40 g / L glycerol, and 8.7 mL / L PTM1.

[0065] The fermenter speed was controlled at <700 rpm, the aeration ratio at 1V / V / min, and the temperature at 30℃ with the pH controlled at 5.0. Fermentation was carried out for 96 hours to obtain the fermentation broth. The fermentation broth was centrifuged at 8000 rpm and 4℃ for 30 min to collect the bacterial cells. The cells were then washed three times with ultrapure water and resuspended in 100 mM potassium phosphate buffer (pH 8.0). After high-pressure homogenization, the cells were centrifuged at 8000 rpm and 4℃ for 40 min, and the supernatant was collected as the crude enzyme solution.

[0066] Crude enzyme solutions of glycosyltransferase UGT76G1 from 14 Pichia pastoris strains were obtained using the above method and labeled as P84H, N151D, I199A, T284S, W338A, W359F, Q381W, P84H / T284S, I199A / T284S, T284S / W359F, P84H / I199A / T284S, I199A / T284S / W359F, P84H / I199A / T284S / W359F, and wild type, respectively.

[0067] Example 3: Enzyme activity assay of mutants

[0068] Reaction systems were prepared using crude enzyme solutions of 14 glycosyltransferases UGT76G1 obtained in Example 2 to determine enzyme activity. The wild-type crude enzyme solution was used as a control. 1 mL of the reaction system contained the following components:

[0069] 50 mM Tris-HCl buffer (pH 8.0), 2 mM MgCl2, 2 mM UDPG, 2 mM Reb D, 0.5 mg glycosyltransferase UGT76G1.

[0070] The reaction was carried out at 40℃ and 200 rpm for 1 h. After the reaction was completed, a sample was taken and heated at 95℃ for 5 min to terminate the reaction. After cooling, 4 volumes of methanol were added, and the mixture was centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μM filter membrane and used for liquid chromatography detection to calculate enzyme activity. The results are shown in Table 1.

[0071] Table 1: Enzyme activity of UGT76G1 mutant

[0072] mutant Enzyme activity (U / g) Relative enzyme activity (times) wild type 90.23 1.00 P84H 115.21 1.28 N151D 75.31 0.83 I199A 120.15 1.33 T284S 128.16 1.42 W338A 79.25 0.88 W359F 110.35 1.22 Q381W 80.61 0.89 P84H / T284S 185.97 2.06 I199A / T284S 262.70 2.91 T284S / W359F 156.01 1.73 P84H / I199A / T284S 355.21 3.94 I199A / T284S / W359F 301.65 3.34 P84H / I199A / T284S / W359F 426.15 4.72

[0073] As shown in Table 1, compared with the wild-type enzyme, the catalytic activity of 3 of the 13 mutant crude enzyme solutions was significantly reduced, while the activity of the remaining 10 mutant enzymes was significantly increased. The highest activity was that of P84H / I199A / T284S / W359F, which carries four mutations, with an activity 4.72 times higher than that of the wild-type enzyme, showing a very significant improvement.

[0074] Subsequently, the enzyme with the highest activity, P84H / I199A / T284S / W359F (amino acid sequence shown in SEQ ID NO.3), was selected to investigate the effects of reaction temperature, pH, sucrose concentration, and UDP concentration on the catalytic reaction in order to screen for the optimal reaction conditions.

[0075] Those skilled in the art will readily understand that, based on the amino acid sequence shown in SEQ ID NO.3, proteins that still possess the enzymatic activity to catalyze the synthesis of rebaudioside M from rebaudioside D can be easily obtained through conventional means, such as substitution, deletion, or addition of one or more amino acid sequences. Therefore, these mutants also fall within the scope of this invention.

[0076] Example 4: Preparation of crude sucrose synthase (SUS) solution

[0077] The plasmid pPICZA-SUS obtained in Example 1 was linearized by enzyme digestion and purified. Then, it was electroporated into Pichia pastoris host strain X33 competent cells and plated onto YPDS solid plates containing 100 μg / mL bleomycin (20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose, 182.17 g / L sorbitol). The plates were incubated upside down at 30°C, and positive transformants were screened to obtain the corresponding recombinant Pichia pastoris strain X33-SUS.

[0078] The recombinant Pichia pastoris strain was inoculated into YPG (20 g / L peptone, 10 g / L yeast extract, 10 g / L glycerol) medium and cultured at 220 rpm and 30 °C for 20-22 h with shaking to obtain the primary seed culture.

[0079] The primary seed culture was inoculated into 200 mL of YPG medium at a ratio of 10% (v / v) and cultured overnight at 220 rpm and 30 °C to obtain the secondary seed culture.

[0080] The secondary seed culture was inoculated into a fermenter containing fermentation medium at a ratio of 10% (v / v). The fermentation medium formula was as follows: 26.07 mL / L phosphate, 1.18 g / L calcium sulfate dihydrate, 18.2 g / L potassium sulfate, 14.9 g / L magnesium sulfate heptahydrate, 4.13 g / L potassium hydroxide, 40 g / L glycerol, and 8.7 mL / L PTM1.

[0081] The fermenter speed was controlled at <700 rpm, the aeration ratio at 1V / V / min, and the temperature at 30℃ with the pH controlled at 5.0. Fermentation was carried out for 96 hours to obtain the fermentation broth. The fermentation broth was centrifuged at 8000 rpm and 4℃ for 30 min to collect the bacterial cells. The cells were then washed three times with ultrapure water and resuspended in 100 mM potassium phosphate buffer (pH 8.0). After high-pressure homogenization, the cells were centrifuged at 8000 rpm and 4℃ for 40 min, and the supernatant was collected as the crude enzyme solution.

[0082] The crude sucrose synthase SUS solution was obtained using the method described above.

[0083] Example 5: Effect of reaction temperature on catalytic reaction

[0084] The reaction system was prepared using the glycosyltransferase P84H / I199A / T284S / W359F obtained in Example 2 and the sucrose synthase SUS obtained in Example 4. Each 10 mL reaction system contained the following components:

[0085] 100mM potassium phosphate buffer (pH 8.0, containing 100mM NaCl), 200mM sucrose, 2mM UDP, 20g / L Reb D, 10mg sucrose synthase SUS, 50mg glycosyltransferase UGT76G1.

[0086] The reactions were carried out at 30, 35, 40, 45, 50 °C and 200 rpm for 24 h. After the reaction was completed, a sample was taken and heated at 95 °C for 5 min to terminate the reaction. After cooling, 4 volumes of methanol were added, and the mixture was centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μM filter membrane and used for liquid chromatography to detect and calculate the Reb M content. The results are shown in Table 2.

[0087] Table 2: Reb M content at different reaction temperatures

[0088] Temperature (°C) Reb M (g / L) 30 10.65 35 14.98 40 16.52 45 15.68 50 12.68

[0089] The results in Table 2 show that the optimal reaction temperature for this catalytic reaction is 40℃, and the corresponding yield of Reb M reaches 16.52 g / L.

[0090] Example 6: Effect of reaction pH on catalytic reaction

[0091] The reaction system was prepared using the glycosyltransferase P84H / I199A / T284S / W359F obtained in Example 2 and the sucrose synthase SUS obtained in Example 4. Each 10 mL reaction system contained the following components:

[0092] Buffer, 200mM sucrose, 2mM UDP, 20g / L Reb D, 10mg sucrose synthase SUS, 50mg glycosyltransferase UGT76G1.

[0093] The buffer solutions selected are: 100mM potassium phosphate buffer, pH 6.0-8.0 (containing 100mM NaCl), and 100mM Tris-HCl buffer, pH 8.0-9.0 (containing 100mM NaCl).

[0094] The reaction was carried out at 40℃ and 200 rpm for 24 h. After the reaction was completed, a sample was taken and heated at 95℃ for 5 min to terminate the reaction. After cooling, 4 volumes of methanol were added, and the mixture was centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μM filter membrane and used for liquid chromatography to detect and calculate the Reb M content. The results are shown in Table 3.

[0095] Table 3: Reb M content at different reaction pH levels

[0096] Buffer pH Reb M (g / L) Potassium phosphate pH 6.0 5.26 Potassium phosphate pH 6.5 7.21 Potassium phosphate, pH 7.0 12.26 Potassium phosphate pH 7.5 14.15 Potassium phosphate pH 8.0 16.52 Tris-HCl pH 8.0 15.31 Tris-HCl pH 8.5 14.01 Tris-HCl pH 9.0 10.16

[0097] The results in Table 3 show that the optimal reaction buffer for this catalytic reaction is potassium phosphate (pH 8.0), and the corresponding Reb M yield reaches 16.52 g / L.

[0098] Example 7: Effect of sucrose concentration on catalytic reaction

[0099] The reaction system was prepared using the glycosyltransferase P84H / I199A / T284S / W359F obtained in Example 2 and the sucrose synthase SUS obtained in Example 4. Each 10 mL reaction system contained the following components:

[0100] 100mM potassium phosphate buffer (pH 8.0, containing 100mM NaCl), sucrose (100, 200, 300, 400, 500mM), 2mM UDP, 20g / L Reb D, 10mg sucrose synthase SUS, 50mg glycosyltransferase UGT76G1.

[0101] The reaction was carried out at 40℃ and 200 rpm for 24 h. After the reaction was completed, a sample was taken and heated at 95℃ for 5 min to terminate the reaction. After cooling, 4 volumes of methanol were added, and the mixture was centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μM filter membrane and used for liquid chromatography to detect and calculate the Reb M content. The results are shown in Table 4.

[0102] Table 4: Reb M content at different sucrose concentrations

[0103] Sucrose concentration (mM) Reb M (g / L) 100 14.25 200 16.52 300 18.64 400 21.75 500 20.15

[0104] The results in Table 4 show that the optimal sucrose concentration for this catalytic reaction is 400 mM, corresponding to a Reb M yield of 21.75 g / L.

[0105] Example 8: Effect of UDP concentration on catalytic reaction

[0106] The reaction system was prepared using the glycosyltransferase P84H / I199A / T284S / W359F obtained in Example 2 and the sucrose synthase SUS obtained in Example 4. Each 10 mL reaction system contained the following components:

[0107] 100mM potassium phosphate buffer (pH 8.0, containing 100mM NaCl), 400mM sucrose, UDP (0.4, 0.8, 1.2, 1.6, 2.0mM), 20g / L Reb D, 10mg sucrose synthase SUS, 50mg glycosyltransferase UGT76G1.

[0108] The reaction was carried out at 40℃ and 200 rpm for 24 h. After the reaction was completed, a sample was taken and heated at 95℃ for 5 min to terminate the reaction. After cooling, 4 volumes of methanol were added, and the mixture was centrifuged at 12000 rpm for 5 min. The supernatant was filtered through a 0.22 μM filter membrane and used for liquid chromatography to detect and calculate the Reb M content. The results are shown in Table 5.

[0109] Table 5: Reb M content at different UDP concentrations

[0110] UDP concentration Reb M (g / L) 0.4 15.48 0.8 21.94 1.2 21.74 1.6 21.85 2.0 21.79

[0111] The results in Table 5 show that the optimal UDP concentration for this catalytic reaction is 0.8 mM, corresponding to a Reb M yield of 21.94 g / L.

[0112] As can be seen from Examples 5-8 above, the optimal reaction conditions are:

[0113] The crude enzyme solution P84H / I199A / T284S / W359F obtained after induction and expression by recombinant Pichia pastoris strain X33-P84H / I199A / T284S / W359F was used for the reaction. The 10 mL reaction system included:

[0114] 100mM potassium phosphate buffer (pH 8.0, containing 100mM NaCl), 400mM sucrose, 0.8mM UDP, 20g / L RebD, 10mg sucrose synthase SUS, 50mg glycosyltransferase UGT76G1.

[0115] The reaction was carried out at 40℃ and 200 rpm. After 24 h of reaction, a sample was taken and heated at 95℃ for 5 min to terminate the reaction. After cooling, 4 times the volume of methanol was added, and the supernatant was collected by centrifugation at 12000 rpm for 5 min. The highest Reb M yield was obtained, at 21.94 g / L, with a conversion rate of 96%.

[0116] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be determined by the claims.

Claims

1. A glycosyltransferase UGT76G1 mutant, characterized in that, The mutant is: The protein with the amino acid sequence shown in SEQ ID NO.

3.

2. The gene sequence encoding the glycosyltransferase UGT76G1 mutant of claim 1.

3. The method for preparing the glycosyltransferase UGT76G1 mutant according to claim 1, characterized in that... Includes the following steps: S1: The amino acid sequence of glycosyltransferase UGT76G1 was obtained from Genbank according to accession number AGL95113.1, and the sequence was optimized according to the codon preference of Pichia pastoris to obtain the codon-optimized UGT76G1 gene sequence. S2: The whole gene was synthesized and ligated into the multiple cloning restriction site of the vector pPICZA to obtain the recombinant plasmid pPICZA-UGT76G1; S3: Using recombinant plasmid pPICZA-UGT76G1 as a template, perform full plasmid PCR, and sequentially perform four rounds of site-directed mutagenesis to construct the corresponding recombinant plasmid carrying the mutant. S4: The recombinant plasmid that has been identified as correct is transformed into the host bacteria to obtain transformants; S5: Ferment the obtained transformants to obtain the glycosyltransferase UGT76G1 mutant; The primer pair sequences for the four rounds of site-directed mutagenesis in step S3 are as follows: P84H-F: TGGTCATTTGGCTGGTATGAGGATTCCAATTATTAATGAAC; P84H-R: ATACCAGCCAAATGACCATGAGTTGGCAAATTAGAAATTCTTTCA; I199A-F: CAAGCTTTGAAAGAAATTTTGGGTAAAATGATTAAACAAACTAGAG; I199A-R: AATTTCTTTCAACGATTGCCAGTTAGAATAAGCAGATTTAATATCCTTAAC; T284S-F: TTCTTCTTCTGAAGTTGATGAAAAAGATTTTTTGGAAATTGC; T284S-R: TCAACTTCAGAAGAAGAACCAAAAGAAACATACAAAACAGAAGATG; W359F-F:ATTCTTTTTGGAACTCTACTTTGGAATCTGTTTGTGAAGG; W359F-R: TAGAGTTAAAACCAGAATGAGTCCAAAAAGCACC.

4. The preparation method according to claim 3, characterized in that, The sequence of the codon-optimized UGT76G1 gene described in step S1 is shown in SEQ ID NO.

1.

5. A recombinant expression vector, characterized in that, The recombinant expression vector clones the gene sequence encoding the glycosyltransferase UGT76G1 mutant of claim 1.

6. A recombinant strain of Pichia pastoris, characterized in that, The recombinant strain clone has the recombinant expression vector as described in claim 5.

7. The Pichia pastoris recombinant strain according to claim 6, characterized in that, The recombinant strain was obtained by transforming the recombinant expression vector of claim 5 into Pichia pastoris X33.

8. A method for synthesizing rebaudioside M, characterized in that, The method described herein utilizes the glycosyltransferase UGT76G1 mutant described in claim 1 in combination with sucrose synthase SUS, and uses rebaudioside D as a substrate to carry out a catalytic reaction to obtain rebaudioside M.

9. The synthesis method according to claim 8, characterized in that, The sequence of the gene encoding the sucrose synthase SUS is shown in SEQ ID NO.

2.

10. The synthesis method according to claim 8, characterized in that, The catalytic reaction is carried out at a temperature of 40°C, and the reaction system, in 10 mL units, comprises: 100mM potassium phosphate buffer, 400mM sucrose, 0.8mM UDP, 20g / L Reb D, 10mg sucrose synthase SUS, 50mg glycosyltransferase UGT76G1; The 100mM potassium phosphate buffer solution has a pH of 8.0 and contains 100mM NaCl.

11. The application of the glycosyltransferase UGT76G1 mutant according to claim 1, characterized in that, Used to catalyze the synthesis of rebaudine D from rebaudine M.