A method for constructing a ttc21b gene-deficient animal model and its application

Abstract

The present application relates to the field of biotechnology, and in particular to a method for constructing an animal model of ttc21b gene deletion and its application; the construction method comprises: designing a sgRNA sequence targeting the ttc21b gene; using the sgRNA sequence to amplify a template by PCR to obtain a transcription template gDNA, in vitro transcribing the transcription template gDNA and a pT3‑Cas9 plasmid and mixing them to obtain a mixture of sgRNA and Cas9mRNA; injecting the mixture into a zebrafish single-cell fertilized egg to obtain a zebrafish containing a mutant gene; raising the zebrafish containing the mutant gene and then screening to obtain a zebrafish model of ttc21b gene deletion; the present application obtains a zebrafish model of ttc21b gene deletion by using CRISPR / Cas9 gene editing technology, which can provide an ideal animal model for studying the pathogenesis of nephronophthisis and its related ciliopathy and screening of therapeutic drugs.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to the construction and application of a ttc21b gene-deficient animal model. Background Art

[0002] Nephronophthisis (NPHP) is an autosomal recessive tubulointerstitial disease and one of the most common genetic diseases causing end-stage renal disease in children. Clinical symptoms of nephronophthisis include polyuria, polydipsia, secondary enuresis, anemia, and growth retardation. In addition to the renal phenotype, the disease may also involve a variety of extrarenal organs, including the liver, pancreas, eyes, and bones. Currently, NPHP can be divided into infantile, juvenile, and adult NPHP according to the age of progression to end-stage renal disease, among which NPHP12 is one of the most common infantile NPHP.

[0003] The pathogenic gene of NPHP12 is TTC21B, which belongs to the TTC21 family and is located on chromosome 2q24.3. It has 5415 base pairs and contains 29 exons. It encodes the intraflagellar transport protein 139 (IFT139) with 1316 amino acids. IFT139 is one of the components of the IFT-A complex and is mainly involved in the reverse transport of substances from the tip of the cilium to the base. The IFT139 protein contains 19 TPR domains, which are composed of 34 amino acids and are generally formed by multiple TPR sequences arranged in series. This domain will produce a right-handed superhelical structure, which is associated with the multi-protein complex.

[0004] In recent years, zebrafish has attracted more and more attention as a new model organism, among which zebrafish human disease models are the main ones. Zebrafish human disease models not only retain many advantages of mammalian models, but also have many advantages of their own: first, zebrafish are easy to raise, and more than 100 embryos can be produced at a time. Many organs, tissues and cell systems and their related physiological functions are highly conserved with mammals; second, zebrafish develop in vitro, and the whole body is transparent during the embryonic period, which is convenient for observing the development process of various tissues and organs under a microscope; at the same time, the zebrafish genome has been studied very well and can be well associated with human diseases, so gene editing technology can be easily implemented on zebrafish. So far, zebrafish can be used as a model organism to study a variety of hereditary kidney diseases. Morpholino-mediated ttc21b gene knockdown zebrafish was used to study the modified gene status of different point mutations of Ttc21b. Although this provides a usable model for studying the pathogenicity of different point mutations of ttc21b, the Morpholino used in this study can only reduce the expression of genes in the organism in the short term, and cannot study the long-term effects of loss of function of the target gene. At the same time, Ttc21b homozygous mice are embryonically lethal and cannot be used to better study kidney diseases. Therefore, how to provide an animal model with ttc21b gene deletion to provide an animal model for the study of the pathological mechanism of nephronophthisis and its related ciliary diseases is a technical problem that urgently needs to be solved. Summary of the invention

[0005] The present application provides a method for constructing a ttc21b gene-deficient animal model to solve the technical problem that there is no zebrafish animal model in the prior art that can be used for the study of nephronophthisis with long-term loss of target gene function.

[0006] In a first aspect, the present application provides a method for constructing a ttc21b gene-deficient animal model, the method comprising:

[0007] Design sgRNA sequence targeting ttc21b gene;

[0008] Using the sgRNA sequence as a forward primer and a universal reverse primer to perform PCR amplification on the template to obtain the transcription template gDNA of the sgRNA; wherein the template is a pT7-gRNA plasmid;

[0009] The transcription template gDNA and the linearized pT3-Cas9 plasmid are respectively transcribed in vitro and mixed to obtain a mixture containing sgRNA and Cas9mRNA;

[0010] Injecting the mixture into a fertilized egg at the one-cell stage of an animal model, shearing a specific site of the ttc21b gene in the animal model to generate a DNA double-strand break in the ttc21b gene, and then performing DNA repair to obtain an animal model containing a mutant gene;

[0011] The animal model containing the mutant gene is raised to obtain an animal model with ttc21b gene deletion.

[0012] Optionally, the sgRNA sequence is located at the target site of exon 6 of the ttc21b gene;

[0013] The nucleotide sequence of the exon 6 target site is shown in SEQ ID NO.1.

[0014] Optionally, the sgRNA sequence includes a target site nucleotide complementary sequence of exon 6, a sgRNA backbone sequence and a T7 promoter sequence, wherein the sgRNA backbone sequence is located at the 3' end of the target site nucleotide complementary sequence of exon 6, and the T7 promoter sequence is located at the 5' end of the target site nucleotide complementary sequence of exon 6.

[0015] Optionally, the step of separately transcribing the transcription template gDNA and the linearized pT3-Cas9 plasmid in vitro and mixing them to obtain a mixture of sgRNA and Cas9mRNA comprises the following steps:

[0016] The transcription template gDNA is in vitro transcribed using a T7 promoter in vitro transcription kit to obtain an sgRNA targeting the ttc21b gene;

[0017] The linearized pT3-Cas9 plasmid was in vitro transcribed using the T3 promoter in vitro transcription kit to obtain Cas9 mRNA;

[0018] The ttc21b gene sgRNA and the Cas9mRNA are mixed to obtain a mixture of sgRNA and Cas9mRNA.

[0019] Optionally, the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO.2.

[0020] Optionally, the method of injecting the mixture into a fertilized egg at the one-cell stage of an animal model, shearing the target site of the ttc21b gene in the animal model to generate a double-stranded DNA break in the ttc21b gene, and then performing DNA repair to obtain an animal model containing a mutant gene comprises the steps of:

[0021] The mixture is introduced into a fertilized egg at the one-cell stage of the animal model to cut the target site of the ttc21b gene in the animal model, and then DNA repair is performed to obtain an F0 generation animal model embryo containing a mutant gene.

[0022] Optionally, the raising of the animal model containing the mutant gene to obtain an animal model with ttc21b gene deletion comprises the steps of:

[0023] Raising the F0 generation animal model embryos, and then mating with wild-type animal models to obtain F1 generation animal models;

[0024] Screening the F1 generation animal model to obtain an F1 generation animal model containing a ttc21b gene mutation;

[0025] The F1 generation ttc21b heterozygous animal model is mated with a wild-type animal model to obtain an F2 generation ttc21b heterozygous animal model;

[0026] Self-pollinating the F2 generation ttc21b heterozygous animal model to obtain an F3 generation ttc21b homozygous animal model;

[0027] The F3 generation homozygous animal model is collected to obtain an animal model with ttc21b gene deletion.

[0028] Optionally, the screening includes screening using a sequencing primer pair;

[0029] The upstream primer of the sequencing primer pair is shown as SEQ ID NO.3, and the downstream primer of the sequencing primer pair is shown as SEQ ID NO.4.

[0030] In a second aspect, the present application provides an application of a method for constructing a ttc21b gene-deficient animal model, the application comprising using the animal model obtained by the construction method described in the first aspect for the study of the pathogenesis of nephronophthisis and its related ciliary diseases for the purpose of non-disease diagnosis or treatment, and for the screening of therapeutic drugs.

[0031] The above technical solution provided by the embodiment of the present application has the following advantages compared with the prior art:

[0032] The method for constructing a ttc21b gene deletion animal model provided in the embodiment of the present application is compared with the traditional animal model constructed by using Morpholino-mediated ttc21b gene knockdown zebrafish. The mutation site of the ttc21b gene is first designed, the sgRNA sequence is synthesized, and the sgRNA sequence is used as a forward primer and a universal reverse primer to perform PCR amplification on the template to obtain the transcription template gDNA of the sgRNA, and then the transcription template gDNA containing the target sequence and the linearized pT3-Cas9 plasmid are respectively transcribed in vitro to obtain a mixture of sgRNA and Cas9mRNA. The mixture can be used to achieve shearing of the ttc21b gene target site in the animal model, thereby obtaining an animal model of the mutant gene. Finally, after screening and breeding, an animal model of the ttc21b gene deletion can be obtained. The animal model of the ttc21b gene deletion can be obtained by using this CRISPR / Cas9 gene editing technology, which can not only provide a new construction method for the study of nephronophthisis, but also observe the long-term effects of the loss of function of the target gene. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments consistent with the present application and, together with the description, serve to explain the principles of the present application.

[0034] In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, for ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0035] Figure 1 A schematic diagram of a method for constructing a ttc21b gene-deficient animal model provided in an embodiment of the present application;

[0036] Figure 2 A detailed schematic diagram of a method for constructing a ttc21b gene-deficient animal model provided in an embodiment of the present application;

[0037] Figure 3 A schematic diagram of the sequencing results of the exon 6 target site provided in the examples of the present application;

[0038] Figure 4 A schematic diagram of mutants screened at the target site of exon 6 provided in the examples of the present application;

[0039] Figure 5 A comparison diagram of the IFT139 protein translated from the mutant provided in the examples of the present application and the normal IFT139 protein;

[0040] Figure 6 A schematic diagram of the morphological appearance of a zebrafish with a ttc21b gene deletion provided in an embodiment of the present application;

[0041] Figure 7 Schematic diagram of spinal curvature changes in zebrafish with ttc21b gene deletion provided in the examples of the present application. DETAILED DESCRIPTION

[0042] In order to make the purpose, technical solution and advantages of the embodiments of the present application clearer, the technical solution in the embodiments of the present application will be clearly and completely described below in conjunction with the drawings in the embodiments of the present application. Obviously, the described embodiments are part of the embodiments of the present application, not all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of this application.

[0043] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in this application can be purchased from the market or prepared by existing methods.

[0044] The creative thinking of this application is:

[0045] CRISPR refers to clustered regularly interspaced short palindromic repeats present in prokaryotes. The CRISPR / Cas system is the acquired immune system of prokaryotes and is present in most archaea and bacteria. The system integrates exogenous DNA fragments such as phages, viruses, and plasmids into CRISPR, called spacer sequences, which are then transcribed and processed into mature guide crRNAs that include spacer sequences. When exogenous viruses or plasmids invade again, the Cas protein and mature crRNA form a complex to recognize the genome of the virus or plasmid containing the homologous sequence and then perform targeted cutting, thereby resisting the invasion of exogenous genomes. The CRISPR / Cas9 system used for gene editing technology mainly consists of two parts: the modified Cas9 protein and sgRNA. The sgRNA is a nucleotide guide sequence of about 100 bp. The Cas9 protein binds to the last 80 nucleotides of the sgRNA, while the first 20 nucleotides are designed to locate the specific target site sequence of the DNA to be edited. When the target site sequence in the sgRNA binds to the DNA through base complementary pairing, the endonuclease in the Cas9 protein is activated to cut the targeted DNA 3bp to 8bp upstream of the PAM to induce DNA double-strand breaks. The generation of DBSs in the genome is extremely harmful, and the DBS repair system in the body will quickly repair it through non-homologous end joining or homologous recombination. When there is a homologous repair template in the body, the CRISPR / Cas9 system uses the homologous template for homologous recombination repair. This method can be used to accurately edit the genome, such as point mutations. In the absence of a template, the non-homologous end joining repair mechanism directly connects the two ends of the broken DNA sequences, which usually leads to the deletion of small fragments or insertion mutations causing the gene open reading frame to shift, thereby causing premature termination of translation.

[0046] Therefore, CRISPR / Cas gene editing technology can be used to construct an animal model with long-term loss of gene function, and the constructed animal model can provide a good animal model for studying the pathogenesis of nephronophthisis and its related ciliary diseases.

[0047] like Figure 1 As shown, the present application embodiment provides a method for constructing a ttc21b gene-deficient animal model, the construction method comprising:

[0048] S1. Design the sgRNA sequence targeting the ttc21b gene;

[0049] S2. Performing PCR amplification on the template using the sgRNA sequence as a forward primer and a universal reverse primer to obtain a transcription template gDNA of the sgRNA; wherein the template is a pT7-gRNA plasmid;

[0050] S3. The transcription template gDNA and the linearized pT3-Cas9 plasmid are respectively transcribed in vitro and mixed to obtain a mixture having sgRNA and Cas9mRNA;

[0051] S4. injecting the mixture into a fertilized egg at the one-cell stage of the animal model, and shearing the target site of the ttc21b gene in the animal model to generate a DNA double-strand break in the ttc21b gene, followed by DNA repair to obtain an animal model containing a mutant gene;

[0052] S5. Raise the animal model containing the mutant gene to obtain an animal model with ttc21b gene deletion.

[0053] In some optional embodiments, the sgRNA sequence is located at the target site of exon 6 of the ttc21b gene;

[0054] The nucleotide sequence of the exon 6 target site is shown in SEQ ID NO.1.

[0055] In the embodiment of the present application, the design is carried out for the target site of exon 6 of the gene. Since this target site is located in the front region of the ttc21b gene (the ttc21b gene has a total of 29 exons), after the targeted knockout of this target site by CRISPR / Cas9 gene editing technology, ttc21b can be translated into a truncated protein, which can effectively affect the expression of the ttc21b gene function, thereby achieving long-term loss of the ttc21b gene function.

[0056] In some optional embodiments, the sgRNA sequence includes a target site nucleotide complementary sequence of exon 6, a sgRNA backbone sequence and a T7 promoter sequence, wherein the sgRNA backbone sequence is located at the 3' end of the target site nucleotide complementary sequence of exon 6, and the T7 promoter sequence is located at the 5' end of the target site nucleotide complementary sequence of exon 6.

[0057] In an embodiment of the present application, by introducing a target site nucleotide complementary sequence of exon 6 without a PAM sequence into the sgRNA sequence, and then combining it with the sgRNA backbone sequence and the T7 promoter sequence, PCR amplification can be used to obtain a gDNA containing a T7 promoter, a ttc21b targeting site and an sgRNA backbone sequence, and then in vitro transcription is performed to obtain an sgRNA that can target ttc21b. After mixing with Cas9 mRNA and introducing it into an animal model, CRISPR / Cas9 gene editing technology can be used to achieve the construction of an animal model with knockout at the exon 6 target site.

[0058] like Figure 2As shown, in some optional embodiments, the transcription template gDNA and the linearized pT3-Cas9 plasmid are respectively transcribed in vitro and mixed to obtain a mixture having sgRNA and Cas9mRNA, comprising the steps of:

[0059] S301. Using a T7 promoter in vitro transcription kit to perform in vitro transcription on the transcription template gDNA to obtain an sgRNA targeting the ttc21b gene;

[0060] S302. Using a T3 promoter in vitro transcription kit to perform in vitro transcription on the linearized pT3-Cas9 plasmid to obtain Cas9 mRNA;

[0061] S303. Mix the pT7-gRNA targeting the ttc21b gene and the Cas9mRNA to obtain a mixture of sgRNA and Cas9mRNA.

[0062] In the examples of the present application, a universal reverse primer and an sgRNA primer are used to perform PCR amplification with the pT7-gRNA plasmid as a template to obtain gDNA, and then the gDNA is in vitro transcribed using a T7 promoter in vitro transcription kit to obtain sgRNA. At the same time, the linearized pT3-Cas9 plasmid is in vitro transcribed using a T3 promoter in vitro transcription kit to obtain Cas9mRNA. The two products are mixed to facilitate the subsequent CRISPR / Cas9 gene editing process.

[0063] In some optional embodiments, the nucleotide sequence of the universal reverse primer is shown as SEQ ID NO.2.

[0064] In some optional embodiments, the mixture is injected into a fertilized egg at the one-cell stage of an animal model, and the target site of the ttc21b gene in the animal model is sheared to generate a DNA double-strand break in the ttc21b gene, followed by DNA repair to obtain an animal model containing a mutant gene, comprising the steps of:

[0065] S401. Introducing the mixture into a one-cell stage fertilized egg of an animal model to cut the target site of the ttc21b gene in the animal model, and then performing DNA repair to obtain an F0 generation animal model embryo containing a mutant gene.

[0066] In the embodiment of the present application, by injecting the mixture into the animal model fertilized egg in the one-cell stage, using Cas9mRNA and sgRNA to cut the exon 6 target site in the ttc21b gene in the animal model fertilized egg, and then screening and breeding are carried out, the F0 generation animal model embryos with ttc21b gene deletion can be obtained.

[0067] In some optional embodiments, the raising of the animal model containing the mutant gene to obtain the animal model with ttc21b gene deletion comprises the steps of:

[0068] S501. raising the F0 generation animal model embryos, and then mating with wild-type animal models to obtain F1 generation animal models;

[0069] S502. Screening the F1 generation animal model to obtain an F1 generation animal model containing a ttc21b gene mutation, and then breeding to obtain an F1 generation ttc21b heterozygous animal model;

[0070] S503. mating the F1 generation ttc21b heterozygous animal model with a wild-type animal model to obtain an F2 generation ttc21b heterozygous animal model;

[0071] S504. self-pollinating the F2 generation ttc21b heterozygous animal model to obtain an F3 generation homozygous animal model;

[0072] S505. Collect the F3 generation homozygous animal model to obtain an animal model with ttc21b gene deletion.

[0073] In the embodiments of the present application, a wild-type animal model and an F0 generation animal model embryo are mated to obtain a heterozygous F1 generation animal model, and then screening is performed to obtain an F1 generation ttc21b heterozygous animal model. The wild-type animal model and the F1 generation ttc21b heterozygous animal model are then mated to obtain an F2 generation ttc21b heterozygous animal model. Finally, after self-pollination, the obtained F3 generation homozygous animal model is an animal model for the ttc21b gene deletion. Therefore, a homozygous ttc21b gene knockout animal model can be obtained after two-step hybridization and self-pollination.

[0074] In some optional embodiments, the screening includes screening using a sequencing primer pair;

[0075] The upstream primer of the sequencing primer pair is shown as SEQ ID NO.3, and the downstream primer of the sequencing primer pair is shown as SEQ ID NO.4.

[0076] In the embodiment of the present application, by introducing a sequencing primer set to screen the F1 generation animal model, the exon 6 target site of the ttc21b gene can be detected, thereby accurately screening the F1 generation animal model containing the ttc21b gene frameshift mutation.

[0077] Based on a general inventive concept, an embodiment of the present application provides an application of a method for constructing a ttc21b gene-deficient animal model, wherein the application includes using the animal model obtained by the construction method described in the first aspect for the study of the pathogenesis of nephronophthisis and its related ciliary diseases for the purpose of non-disease diagnosis or treatment, and for screening therapeutic drugs.

[0078] The application is implemented based on the above-mentioned construction method. The specific steps of the construction method can refer to the above-mentioned embodiments. Since the application system adopts part or all of the technical solutions of the above-mentioned embodiments, it has at least all the beneficial effects brought by the technical solutions of the above-mentioned embodiments, which will not be repeated here one by one.

[0079] The present application will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are intended only to illustrate the present application and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are usually measured according to national standards. If there is no corresponding national standard, then the conditions recommended by the manufacturer are followed.

[0080] Example 1

[0081] 1. Screening of active sgRNA:

[0082] 1. sgRNA design: The sgRNA target site is generally 20bp. The target site is generally designed in the first 2 / 3 of the gene coding sequence or before the key domain and after the start codon ATG to ensure maximum destruction of the gene domain or transcript. The target site can also be selected at the junction of exons and introns to disrupt mRNA splicing.

[0083] Specific sgRNA primers were designed using the online CRISPR target site design website CHOPCHOP

[0084] (http: / / chopchop.cbu.uib.no / ) was used to search for potential CRISPR / Cas9 targeting sequences of zebrafish ttc21b gene, and sequences with forward exons and high scores were preferred. The target site sequences that met the requirements were aligned in the Ensembl database to confirm the specificity of the target site and check whether there were SNP sites at the target site. Then, the T7 promoter sequence (TAATACGACTCACTATAGGG) was added to the 5' end of the target site sequence that did not contain the PAM sequence, and the sgRNA backbone sequence (GTTTTAGAGCTAGAAATAGC) was added to the 3' end, which was a specific targeting sgRNA primer (SEQ ID NO.5, as shown in Table 1), and the universal reverse primer ZF-cp-R (AGCACCGACTCGGTGCCACT) (SEQ ID NO.2) on the sgRNA backbone was synthesized at the same time.

[0085] The target sites that meet the above requirements were selected and located on exon 6 (GTCCTTTCTACCGGCTCTGG) (SEQ ID NO. 1), all located after the translation start codon ATG.

[0086] Among them, sgRNA forward primer and ZF-cp - The reverse primers are listed in Table 1.

[0087] Table 1 sgRNA primers and ZF_cp_R primers

[0088]

[0089] (1) Synthesis of sgRNA in vitro transcription template: obtained by conventional PCR amplification. The PCR reaction system is shown in Table 2.

[0090] Table 2 PCR reaction system

[0091] Reagent name Dosage pT7-sgRNA Plasmid 1ng 10x Taq buffer 5μL dNTP(10mM) 1.0μL sgRNA primer (25 μM) 1.0μL Universal reverse primer (25 μM) 1.0μL Taq DNA polymerase 0.5μL Double distilled water Make up to 50 μL

[0092] Two 50 μL systems were amplified for each target site, and the PCR reaction procedure and gel electrophoresis were the same as before. After amplification, the concentration and purity were measured after purification using the AxyPrep cleaning kit.

[0093] (2) In vitro transcription of sgRNA: The in vitro transcription system is prepared as shown in Table 2.

[0094] Table 2 In vitro transcription system

[0095] Reagent name Dosage gDNA 400ng Transcription buffer 2.0μL dNTP(10mM) 1.0μL RNase inhibitors 1.0μL T7 RNA polymerase 2.0μL Nuclease-Free Water Make up to 20 μL

[0096] The system was incubated in a 37°C water bath for 2 h, 1 μL of RNAse free DNAse I was added, and incubated in a 37°C water bath for 15 min. The sgRNA was purified using anhydrous ethanol precipitation method.

[0097] 2. Preparation of Cas9 mRNA:

[0098] Cas9 mRNA was obtained by in vitro transcription of pT3-Cas9 plasmid. The linearized pT3-Cas9 plasmid was transferred into mMESSAGEmMACHINE TM T3 in vitro transcription kit was used for in vitro transcription, and MEGAclearTM Kit was used for purification after transcription.

[0099] Example 2

[0100] Further operations were performed based on the sgRNA and Cas9mRNA obtained in Example 1:

[0101] 3. Microinjection of zebrafish fertilized eggs:

[0102] The TU strain zebrafish fertilized eggs were collected and neatly arranged on an egg plate made of agarose gel. The prepared sgRNA and Cas9mRNA were mixed so that the final concentrations of sgRNA and Cas9mRNA were 80 ng / L and 350 ng / L, respectively.

[0103] Turn on the injection system, adjust various parameters, and immediately draw 2 μL of the CRISPR / Cas9 mixed system into the injection needle after collecting the embryos. Fix the injection needle on the injection device, and use tweezers under a stereomicroscope to break the needle to a suitable thickness before starting the injection.

[0104] It is best to inject at the embryonic one-cell stage. After injection, transfer the zebrafish embryo to a culture dish, add E3 culture medium containing methylene blue, and place it in a constant temperature incubator at 28.5°C.

[0105] 4. Detection of target site effectiveness:

[0106] On the second day of culture of the targeted embryos, 30 wild-type and 30 zebrafish embryos injected at each target site were collected to extract genomic DNA for PCR amplification, and the PCR products were sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing.

[0107] The F0 generation is a mosaic and may have multiple frameshift mutations. Therefore, the target sequence contains multiple base peaks in addition to the normal peak. The sequencing results showed that there were mixed peaks near the target site of exon 6 (such as Figure 3 This demonstrates that this site can be effectively targeted for gene expression.

[0108] 5. Screening of F0 and F1 generation mutants:

[0109] The injected embryos were cultured to about 2 months of age, and genomic DNA was extracted by cutting the tail fin. The F0 generation individuals with successful targeting were further screened by PCR amplification, and the mutant F0 generation obtained by screening were mated with TU wild-type zebrafish to obtain the F1 generation.

[0110] When the F1 grows to about 2 months old, the tail fin is cut off to extract genomic DNA. After PCR amplification, the sample is sent for sequencing. Since the F1 generation is a heterozygous, the sequencing result of the mutant is a double peak near the PAM sequence. Through sequence reading, the genotypes of different mutants can be screened out in the F1 generation of fish.

[0111] An effective mutant (e.g. Figure 4 As shown in the figure, the mutant screened at target site 6 is c.644-664delCCTTTCTACCGGCTCTGGTGAins GTGAGTT, which causes the amino acid change to p.Ser215Cysfs*30; this mutant is a frameshift mutation and will introduce a stop codon in advance, resulting in premature termination of IFT139 protein translation to form an abnormal truncated protein (such as Figure 5 shown).

[0112] 6. Screening of mutants in F2 generation and beyond:

[0113] The F1 generation mutants were mated with wild-type zebrafish to obtain the F2 generation zebrafish. After the F2 generation embryos grew to 2 months old, they were identified and typed. After typing the F2 generation zebrafish, more female and male fish with the same mutation type could be obtained. After sexual maturity, the F2 generation zebrafish with the same genotype were self-fertilized to obtain F3 generation embryos containing homozygous mutants for experimental research.

[0114] 7. The morphological appearance of zebrafish with ttc21b gene deletion constructed by the above method was observed and studied. In the F3 generation zebrafish embryos, some young fish were found to have renal cysts and mild pericardial edema on the third day after fertilization (3dpf), which was more obvious on the 5th dpf. From the side view and dorsal view, it can be observed that the renal cysts were obviously protruding (such as Figure 6 As shown in the figure, all zebrafish embryos with cysts were determined to be homozygous mutants. Homozygous embryos of the F3 generation were selected and cultured separately, and it was found that the homozygous fry began to die after 15 days. Around the 20th day, the homozygous mutant fish were observed to have spinal curvature and slow growth and development (as shown in the figure). Figure 7 shown).

[0115] In summary, the method for constructing an animal model of ttc21b gene deletion provided in the embodiments of the present application, by adopting CRISPR / Cas9 gene editing technology to construct an animal model of ttc21b gene deletion, can obtain an animal model with stable and long-term loss of ttc21b gene function. Therefore, it can provide a new construction method for zebrafish animal model for the study of nephronophthisis and related ciliary diseases. At the same time, the constructed animal model can be used for the study of the pathogenesis of nephronophthisis and related ciliary diseases and for the screening of therapeutic drugs.

[0116] Various embodiments of the present application may be presented in the form of a range; it should be understood that the description in the form of a range is merely for convenience and brevity and should not be understood as a rigid limitation on the scope of the present application; therefore, it should be considered that the range description has specifically disclosed all possible sub-ranges and single numerical values ​​within the range.

[0117] In this article, "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. Wherein A and B can be singular or plural. In this article, "at least one" means one or more, and "plural" means two or more. "At least one", "at least one of the following" or similar expressions refer to any combination of these items, including any combination of single or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c", can all mean: a, b, c, ab (i.e. a and b), ac, bc or abc, where a, b, c can be single or multiple, respectively.

[0118] The above description is only a specific implementation of the present application, so that those skilled in the art can understand or implement the present application. Various modifications to these embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present application. Therefore, the present application will not be limited to the embodiments shown herein, but will conform to the widest range consistent with the principles and novel features applied for herein.

Claims

1. A method for constructing a ttc21b gene-deficient animal model, characterized in that: The construction method comprises: S1. Designing a sgRNA sequence targeting the ttc21b gene; wherein the sgRNA sequence targets the exon 6 target site of the ttc21b gene; the nucleotide sequence of the exon 6 target site is shown in SEQ ID NO.1; S2. Perform PCR amplification on the template using the sgRNA sequence as a forward primer and a universal reverse primer to obtain a transcription template gDNA of the sgRNA; wherein the template is a pT7-gRNA plasmid; wherein the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.2; S3. The transcription template gDNA and the linearized pT3-Cas9 plasmid are respectively transcribed in vitro and mixed to obtain a mixture having sgRNA and Cas9 mRNA; S4. injecting the mixture containing sgRNA and Cas9 mRNA into a fertilized egg at the one-cell stage of the animal model, and shearing the target site of the ttc21b gene in the animal model to generate a DNA double-strand break in the ttc21b gene, followed by DNA repair, to obtain an animal model containing a mutant gene; S5. Raise and screen the animal model containing the mutant gene to obtain an animal model with ttc21b gene deletion; the animal model is a zebrafish animal model.

2. The construction method according to claim 1, characterized in that: The sgRNA sequence consists of a target site nucleotide complementary sequence of exon 6, an sgRNA backbone sequence and a T7 promoter sequence, wherein the sgRNA backbone sequence is located at the 3' end of the target site nucleotide complementary sequence of exon 6, and the T7 promoter sequence is located at the 5' end of the target site nucleotide complementary sequence of exon 6.

3. The construction method according to claim 1, characterized in that: The S3 comprises the steps of: The transcription template gDNA is in vitro transcribed using a T7 promoter in vitro transcription kit to obtain an sgRNA targeting the ttc21b gene; The linearized pT3-Cas9 plasmid was in vitro transcribed using the T3 promoter in vitro transcription kit to obtain Cas9 mRNA; The sgRNA targeting the ttc21b gene and the Cas9 mRNA are mixed to obtain a mixture of sgRNA and Cas9 mRNA.

4. The construction method according to claim 1, characterized in that: The S4 comprises the steps of: The mixture containing sgRNA and Cas9 mRNA is introduced into the one-cell stage fertilized egg of the animal model to cut the target site of the ttc21b gene in the animal model, followed by DNA repair to obtain F0 generation animal model embryos containing the mutant gene.

5. The construction method according to claim 4, characterized in that: S5 comprises the steps of: Raising the F0 generation animal model embryos, and then mating with wild-type animal models to obtain F1 generation animal models; Screening the F1 generation animal model to obtain an F1 generation animal model containing a ttc21b gene mutation; The F1 generation ttc21b heterozygous animal model is mated with a wild-type animal model to obtain an F2 generation ttc21b heterozygous animal model; Selfing the F2 generation ttc21b heterozygous animal model to obtain an F3 generation homozygous animal model; The F3 generation homozygous animal model was collected to obtain a ttc21b gene knockout animal model.

6. The construction method according to claim 5, characterized in that: The screening includes screening using sequencing primer pairs; The upstream primer of the sequencing primer pair is shown as SEQ ID NO.3, and the downstream primer of the sequencing primer pair is shown as SEQ ID NO.

4.

7. Application of a method for constructing a ttc21b gene-deficient animal model, characterized in that: The application includes using the animal model obtained by the construction method as described in any one of claims 1 to 6 for the study of the pathogenesis of nephronophthisis and its related ciliary diseases for the purpose of non-disease diagnosis or treatment, and for the screening of therapeutic drugs.

Images