sgRNA highly targeted to the human HLA-A gene and its application
By using highly targeted sgRNA and CRISPR systems, the problems of low efficiency and high cytotoxicity of HLA-A gene knockout in the prior art were solved, and the high efficiency and low toxicity of HLA-A gene knockout in 293T cells and umbilical hematopoietic cells were achieved, which has important clinical application potential.
Patent Information
- Application Number
- CN202411229943.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-17
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2044-06-17
AI Technical Summary
There is a lack of efficient methods in the prior art to knock down or knock out the human HLA-A gene, resulting in frequent allograft rejection reactions, low efficiency of ZFN technology and risk of off-target effects and cytotoxicity, making it difficult to apply in vivo.
A highly targeted small guide RNA (sgRNA) of the human HLA-A gene was used to combine the CRISPR gene editing system to design and screen efficient sgRNA sequences, such as HLA-A-ex2-g13, HLA-A-ex3-g167, HLA-A-ex2-g452, was used to efficiently knock out the HLA-A gene in 293T cell lines and hematopoietic cells from umbilical blood-derived.
The knockout efficiency in the 293T cell line reaches more than 20%, and the hematopoietic cells from umbilical blood can reach up to 97%, which significantly improves the knockout efficiency of HLA-A gene, reduces cytotoxicity, has significant specificity, does not affect the expression of HLA-B, HLA-C and HLA-II molecules, and has broad clinical application prospects.
Smart Images

Figure CN118813625B_ABST
Abstract
Description
[0001] Divisional application
[0002] This application is a divisional application of the patent application with application number 202410772696.3, application date June 17, 2024, and invention name “sgRNA highly targeted to human HLA-A gene, its composition and application”. Technical Field
[0003] The present disclosure relates to the field of biotechnology, and in particular, to an sgRNA highly targeted to the human HLA-A gene, and a composition and application thereof. Background Art
[0004] Immune rejection is primarily mediated by the recognition of non-self donor cells by major histocompatibility complex (MHC) molecules on the surface of recipient immune cells. Human MHC molecules are encoded by human leukocyte antigen (HLA) genes. Classic HLA molecules, such as HLA-A, B, C, and DR, are the primary molecular targets of allogeneic transplant rejection. Immune rejection is a major cause of failure in many treatments. For example, hematopoietic stem cell (HSC) transplantation is an important treatment for various malignant hematologic diseases and immune dysfunction. Successful HSC transplantation first requires overcoming the immune barrier to transplantation (immune rejection).
[0005] Knockdown or knockout of HLA-A can reduce transplant rejection, significantly improve HLA matching success rates, and expand the application of clinical-grade allogeneic transplants. Previous studies have used zinc finger nucleases (ZFNs) to knock out the HLA-A gene in cord blood-derived hematopoietic cells, improving allogeneic transplant matching rates while maintaining the in vivo engraftment and lineage differentiation capacity of hematopoietic cells. However, ZFN editing of the HLA-A gene has numerous drawbacks and shortcomings. For example, 1) ZFN technology has a low efficiency of knockout of the HLA-A gene, only approximately 10%, resulting in a poor clinical application prospect. 2) ZFN gene editing is prone to off-target effects and high cytotoxicity. ZFN DNA cleavage requires dimerization of two Fok I cleavage domains and requires at least one recognition unit to bind to DNA. Although the DNA recognition domain has strong specific recognition capabilities, the ZFN cleavage process does not rely entirely on homodimer formation. Therefore, once heterodimers form, off-target effects are likely to occur, ultimately leading to DNA mismatches and sequence alterations, resulting in strong cytotoxicity. When these adverse effects accumulate excessively, exceeding the tolerance of the cell's repair mechanisms, they can cause cell apoptosis. 3) ZFN methods are limited by existing biological research methods, and the precision and consequences of operations within cells are difficult to predict. If ZFNs cause mutations in related genes, this can lead to a series of unexpected consequences, and in human-related applications, it may even cause cancer. To date, ZFN technology can only be used for in vitro operations, where cells extracted from the human body are processed and then reintroduced into the patient. Directly introducing the relevant ZFN elements into the patient's body for gene editing carries significant potential risks and is inefficient. These limitations make ZFN operations cumbersome and difficult to promote. Therefore, there is currently no effective means to effectively knock down or knock out the HLA-A gene in human hematopoietic cells, for example. Solving these problems is an urgent task. Summary of the Invention
[0006] Technical issues solved:
[0007] One aspect of the present invention is to address the problem that the existing technology lacks effective means to efficiently knock down and / or knock out the human HLA-A gene, and provides a sgRNA that is highly targeted to the human HLA-A gene, its composition and application.
[0008] Specifically, the inventors creatively designed small guide RNA (sgRNA) based on the CRISPR gene editing system. When applied alone or in combination to the CRISPR gene editing system, sgRNA can efficiently knock down and / or knock out the human HLA-A gene, thereby solving the problems in the above-mentioned prior art.
[0009] Technical solution:
[0010] An sgRNA, wherein the nucleotide sequence of the sgRNA is shown as one of SEQ ID No. 1-21.
[0011] In embodiments of the present disclosure, the CRISPR gene editing system is used to identify and knock down and / or knock out the human HLA-A gene in cells using the above-mentioned sgRNAs. The efficiency can reach over 20% in 293T cell lines, and the highest efficiency can reach 97% in cord blood-derived hematopoietic cells, far exceeding the methods in the prior art. Among them, the three sgRNAs HLA-A-ex2-g13, HLA-A-ex3-g167, and HLA-A-ex2-g452 have the best efficiency. Therefore, as a preference, in some embodiments of the present disclosure, the nucleotide sequence of the sgRNA is as shown in SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3.
[0012] In some embodiments of the present disclosure, the nucleotide sequences shown in SEQ ID Nos. 1-21 may be modified as appropriate. Such modifications include, but are not limited to, substitution, insertion, deletion, exchange, or replacement of one or more nucleotides for the purpose of improvement, as well as modification of the nucleotide sequence using other groups.
[0013] Another aspect of the present disclosure provides a composition of sgRNA, comprising one or more sgRNAs selected from the nucleotide sequences shown in SEQ ID No. 1-21.
[0014] Preferably, in some embodiments of the present disclosure, the composition comprises one or more sgRNAs selected from the nucleotide sequences shown in SEQ ID No. 1, SEQ ID No. 2 or SEQ ID No. 3.
[0015] In some embodiments of the present disclosure, the nucleotide sequence in the above composition may be modified. Such modifications include, but are not limited to, substitution, insertion, deletion, exchange, or replacement of one or more nucleotides for improvement purposes, as well as modification of the nucleotide sequence using other groups.
[0016] Another aspect of the present disclosure provides the use of the above-mentioned sgRNA or the above-mentioned composition in preparing a product for knocking out or knocking down the human HLA-A gene. The knocking out or knocking down the human HLA-A gene can be performed in vivo or in an in vitro culture environment.
[0017] Another aspect of the present disclosure is to provide a use of the above-mentioned sgRNA or the above-mentioned composition in the preparation of a drug for preventing or reducing immune rejection reaction.
[0018] Another aspect of the present disclosure is to provide a recombinant vector comprising the above-mentioned nucleotide sequence. In other embodiments of the present disclosure, the above-mentioned recombinant vector may also be loaded with a nucleotide sequence encoding a Cas protein.
[0019] Another aspect of the present disclosure is to provide a kit comprising the above-mentioned sgRNA, the above-mentioned composition or the above-mentioned recombinant vector. In other embodiments of the present disclosure, the kit further comprises a Cas protein or an expression vector of the Cas protein.
[0020] Another aspect of the present disclosure is to provide a pharmaceutical composition, which includes the above-mentioned sgRNA, the above-mentioned composition or the above-mentioned recombinant vector, and a pharmaceutically acceptable carrier.
[0021] Another aspect of the present disclosure provides a method for improving the knockout or knockdown efficiency of the human HLA-A gene in a cell, comprising:
[0022] Step 1) introducing the above-mentioned sgRNA, the above-mentioned composition or the above-mentioned recombinant vector into cells;
[0023] Step 2) introducing the Cas protein or a Cas protein expression vector into the cell;
[0024] Step 3) The cells are grown.
[0025] In some embodiments of the present disclosure, the above cells can be grown in vivo or in an in vitro culture environment.
[0026] Beneficial effects:
[0027] The sgRNAs provided herein can efficiently knock out or down the human HLA-A gene, and they cover nearly all HLA-A genotypes in the Chinese population. The sgRNAs provided herein are highly targeted, with no significant effect on the expression of HLA-B, HLA-C, and HLA-II class molecules after knocking out or down the HLA-A gene in human hematopoietic cells. They also exhibit low cytotoxicity, demonstrating significant advantages in gene therapy and promising clinical applications in cell therapy. BRIEF DESCRIPTION OF THE DRAWINGS
[0028] Figure 1 This is a graph showing the results of flow cytometry detection of HLA-A expression in 293T tool cells in the embodiments of the present disclosure. The results show that HLA-A protein is highly expressed on the surface of 293T cells and is significantly separated from the negative group. This result indicates that 293T cells can be used as tool cells for HLA-AsgRNA library screening;
[0029] Figure 2Figure 1 is a flow cytometry result of a virus-infected group after Puro drug screening in the disclosed embodiment. The figure shows the clustering of HLA-A low-expressing cells. The overall HLA-A expression of cells shifts to the left, and the proportion of the HLA-A low-expressing population increases. Flow cytometry sorts out 10% of HLA-A low-expressing cells, 70% of intermediate-expressing cells, and 10% of high-expressing cells.
[0030] Figure 3 This is a graph showing the enrichment of sgRNAs in the HLA-A low expression group compared to the unsorted group in the disclosed embodiment, thereby screening out 24 effective sgRNAs;
[0031] Figure 4 Figure 1 is a graph showing the knockout effects of 21 sgRNAs screened by transient transfection in 293T cell lines in the disclosed embodiments. The figure shows the proportion of HLA-A low-expressing cells after knockout by each sgRNA. The HLA-A-ex2-g13 group, which had the best knockout effect, achieved a 60% HLA-A knockout cell ratio. The figure also indicates the HLA-A gene locus targeted by each sgRNA, where P stands for Promoter, Ex stands for Exon, and Int stands for Intron.
[0032] Figure 5 This is a diagram showing the knockout sites of HLA-A-ex2-g13 (SEQ ID No. 1), HLA-A-ex3-g167 (SEQ ID No. 2), and HLA-A-ex2-g452 (SEQ ID No. 3) on the human HLA-A gene in the examples disclosed herein;
[0033] Figure 6 In the embodiment of the present disclosure, the three sgRNAs with the best knockout effect of HLA-A protein on 293T cell line were selected: HLA-A-ex2-g13 (SEQ ID No. 1), HLA-A-ex3-g167 (SEQ ID No. 2), and HLA-A-ex2-g452 (SEQ ID No. 3). The knockout effect was further tested on hematopoietic cells derived from umbilical cord blood. The flow cytometry graph is CD34 + , CD34 + CD90 + and CD34 + CD90 - Cell gating strategy.
[0034] Figure 7 、 Figure 8This is a diagram showing the knockout effect of HLA-A-ex2-g13 (SEQ ID No. 1), HLA-A-ex3-g167 (SEQ ID No. 2), and HLA-A-ex2-g452 (SEQ ID No. 3) on cord blood-derived hematopoietic cells in the embodiments of the present disclosure, wherein: Figure 7 It showed that all three sgRNAs could effectively knock out CD34 + , CD34 + CD90 + and CD34 + CD90 - Cell surface HLA-A protein, 3 sgRNA knockout CD34 + CD90 + The cell ratio was above 94%, and the HLA-A-ex2-g13 (SEQ ID No. 1) group CD34 + CD90 + The proportion of HLA-A knockout cells can reach 97%, Figure 8 Statistical analysis showed that after knockout of the three sgRNAs, the proportion of HLA-A positive cell populations decreased significantly;
[0035] Figure 9 、 Figure 10 This is a specific result diagram in the embodiment of the present disclosure, wherein: Figure 9 Compared with the control group, the CD34 + CD90 + There was no significant difference in the expression of HLA-ABC on the cell surface, indicating that the three sgRNAs targeting HLA-A knockout had significant specificity. The use of these three sgRNAs to knock out HLA-A did not affect CD34 + , CD34 + CD90 + and CD34 + CD90 - Expression of HLA-B and HLA-C molecules on the cell surface, Figure 10 Statistical analysis showed that the proportion of HLA-ABC positive cell population did not change significantly after knockout of the three sgRNAs;
[0036] Figure 11 、 Figure 12 This is a specific result diagram in the embodiment of the present disclosure, wherein: Figure 11 Compared with the control group, there was no significant difference in the expression of HLA-DR molecules on the surface of CD34+CD90+ cells after knocking out HLA-A by three sgRNAs. Figure 12Statistical analysis showed that the proportion of HLA-DR-positive cell populations did not change significantly after knockout of the three sgRNAs, indicating that the three sgRNAs targeted knockout of HLA-A with remarkable specificity. Knockout of HLA-A using these three sgRNAs did not affect the expression of HLA-II molecules on the surface of CD34+, CD34+CD90+, and CD34+CD90- cells.
[0037] Sequence Description
[0038] Sequence Listing
[0039] Sequence number Sequence name Sequence SEQ ID No.1 HLA-A-ex2-g13 GGATGTGAAGAAATACCTCA SEQ ID No.2 HLA-A-ex3-g167 GGACCTGCGCTCTTGGACCG SEQ ID No.3 HLA-A-ex2-g452 GGATGGAGCCGCGGGCGCCG SEQ ID No.4 HLA-A-ex3-g448 GGCCGCCTCCCACTTGCGCT SEQ ID No.5 HLA-A-ex2-g274 CTGGTTGTAGTAGCCGCGCA SEQ ID No.6 HLA-A-ex2-g440 CGTGTCCCGGCCCGGCCGCG SEQ ID No.7 HLA-A-ex4-g107 CACAGCCGCCCACTTCTGGA SEQ ID No.8 HLA-A-ex5-g410 ATTGCTGGCCTGGTTCTCCT SEQ ID No.9 HLA-A-promoter-g258 ACCCAATGGGAGTGAGAACT SEQ ID No.10 HLA-A-ex4-g461 GTCCTCCCCATCCCGCTGCC SEQ ID No.11 HLA-A-ex2-83 GAGCCAGAGGATGGAGCCGC SEQ ID No.12 HLA-A-promoter-190 ACCCAGTTCTCACTCCCATT SEQ ID No.13 HLA-A-promoter-57 GAGAGGGAGAAAAGAAACTG SEQ ID No.14 HLA-A-ex4-g227 AGGTCAGTGTGATCTCCGCA SEQ ID No.15 HLA-A-ex1-g269 GACCCCGCACTCACCCGCCC SEQ ID No.16 HLA-A-promoter-28 CTGGAAACCCGACACCCAAT SEQ ID No.17 HLA-A-ex1-g35 GAGGGTTCGGGGCGCCATGA SEQ ID No.18 HLA-A-promoter-g63 TCTGGAAACCCGACACCCAA SEQ ID No.19 HLA-A-int2-g404 GGGGGACTGGGCTGACCGCG SEQ ID No.20 HLA-A-ex2-g246 CGGCTCCATCCTCTGGCTCG SEQ ID No.21 HLA-A-promoter-g118 GGGAGAATCTGAGTCCCGGT DETAILED DESCRIPTION
[0040] The present invention discloses an sgRNA and its application. Those skilled in the art can refer to the contents herein and appropriately improve the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. It is also clear that relevant persons can modify or appropriately change and combine the contents described herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.
[0041] In the present invention, unless otherwise indicated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Unless otherwise expressly indicated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprising" etc. will be understood to include the elements or components stated, without excluding other elements or other components. The term "one (a)" ("a", "an" and "the") includes plural indicators. The term "multiple (multiple)" refers to two (kinds) or more (kinds). The terms "such as", "for example" etc. are intended to refer to exemplary embodiments and are not intended to limit the scope of the present disclosure.
[0042] In this disclosure, when a range of values is provided, it is understood that the endpoints are included in the range and that each intervening value between the upper and lower limits of the range and any other specified value or intervening value in the stated range and any smaller range between the specified values are encompassed unless the context clearly dictates otherwise.
[0043] In this disclosure, the term "about" generally refers to a variation within a range of 0.5%-10% above or below a specified value, for example, 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value.
[0044] In this disclosure, unless otherwise specified, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. For definitions of common terms in molecular biology, see Lewin's GENES, Twelfth Edition, Jocelyn E. Krebs, Elliott S. Goldstein, Stephen T. Kilpatrick, Publisher: Jones & Bartlett Learning. For definitions of common terms in biochemistry, see Lehninger Principles of Biochemistry, Eighth Edition, David L. Nelson, Michael M. Cox, Publisher: WH Freeman. For definitions of common terms in cell biology, see Molecular Biology of the Cell, Sixth Edition, Bruce Alberts, Alexander Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter, Publisher: Garland Science. For definitions of common terms in genetics, see Genetics: Analysis of Genes and Genomes, Eighth Edition, Daniel L. Hartl, Maryellen Ruvolo, Publisher: Jones & Bartlett Learning.
[0045] Unless otherwise specified, the laboratory techniques herein utilize conventional techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, which can be found in standard texts such as Molecular Cloning: A Laboratory Manual; Cell Biology: A Laboratory Handbook, etc.
[0046] definition:
[0047] The term "knockout" in this disclosure is used to describe the process of completely or partially inactivating a specific gene in an organism through gene editing technology. Knockout technology generally involves the use of gene editing tools, such as the CRISPR-Cas9 system, to accurately locate and cut the DNA sequence of the target gene. After the DNA sequence is cut, the cell usually attempts to repair the broken DNA through mechanisms such as non-homologous end joining (NHEJ) or homologous recombination (HDR). However, these repair processes may result in the insertion, deletion or replacement of the gene sequence, thereby causing the target gene to lose its original function or expression level.
[0048] The term "knock down" in the present disclosure refers to reducing the expression level of a certain gene in an organism by specific technical means, rather than completely eliminating the function of the gene, such as achieved by methods such as interference (CRISPRi) of antisense RNA, ribonuclease or CRISPR-Cas systems. The main difference between knocking down and knocking out is the degree: knocking out is the complete or partial elimination of the function of a gene, while knocking down only reduces its expression level. Therefore, knocking down allows researchers to study the effects of gene expression reduction, rather than the effects of complete absence.
[0049] The term "HLA-A" in this disclosure is an abbreviation for human leukocyte antigen A, also known as MHC class I antigen. It is a glycoprotein expressed on the surface of almost all cells in the human body and is part of the major histocompatibility complex (MHC). The heavy chain of the HLA-A molecule is approximately 45 kDa, and its gene contains 8 exons. Exon 1 encodes the leader peptide, exons 2 and 3 encode the α1 and α2 domains (both of which bind peptides), exon 4 encodes the α3 domain, exon 5 encodes the transmembrane region, and exons 6 and 7 encode the cytoplasmic tail. In particular, polymorphisms within exon 2 and exon 3 are related to the peptide binding specificity of each HLA-A molecule, and typing of these polymorphisms is commonly used for matching in bone marrow and kidney transplants.
[0050] CRISPR-Cas system:
[0051] The CRISPR-Cas system is widely found on the chromosomes of bacteria and archaea and is associated with their immunity, used to defend against foreign genetic material and acquire phage resistance. The CRISPR-Cas system is the third-generation gene editing technology, following the introduction of ZFNs, TALENs, and other gene editing technologies. CRISPR-Cas systems can be divided into three main types: Type I, Type II, and Type III. The CRISPR Type I system was the first to be discovered and studied, and is primarily found in most bacteria and archaea. This system consists of multiple Cas proteins and multiple CRISPR RNAs (crRNAs), forming a complex Cas protein complex. This complex recognizes and cleaves target DNA fragments through complementary pairing between crRNAs and exogenous DNA. The Type I system is characterized by the presence of multiple Cas proteins, of which the Cas3 protein possesses RNA-dependent DNA nuclease activity, responsible for cleaving target DNA. The CRISPR Type II system, also known as the CRISPR / Cas9 system, is currently the most widely used gene editing tool. The CRISPR / Cas9 system only requires Cas9 protein and crRNA to form a complex with trans-activating CRISPR-derived RNA (tracrRNA) to identify and shear the target DNA fragment. The Cas9 protein has two nuclease activities, HNH and RuvC, which can shear the two chains of the target DNA respectively. The structure and function of the CRISPR Type III system are similar to those of the Type I system, but it has more Cas proteins and a more complex mechanism. Similar to the Type I system, the Type III system also requires multiple Cas proteins and crRNA to form a complex, which recognizes and shears the target fragment through complementary pairing with exogenous DNA. However, the shearing mechanism of the Type III system is different from that of the Type I system. It relies on the RNase activity of the Cas protein to cut the target DNA. In an embodiment of the present disclosure, the sgRNA is used in a Type II CRISPR-Cas system.
[0052] Cas proteins:
[0053] In the embodiments of the present disclosure, the Cas protein used in the CRISPR-Cas system is mainly Cas9. Cas9 is a nuclease that can accurately recognize and cut DNA sequences under the guidance of sgRNA (small guide RNA). In some embodiments of the present disclosure, the Cas9 protein can be isolated or loaded onto a vector for expression in cells. In addition to Cas9, other embodiments of the present disclosure may also include other auxiliary proteins, including but not limited to Cas1, Cas2, etc. They may play an auxiliary role in the DNA cutting process, or participate in other links of the CRISPR system, such as DNA acquisition and processing.
[0054] In an embodiment of the present disclosure, the Cas protein may be modified. The modification may include mutation, insertion or deletion of amino acid residues, codon optimization, and other chemical modifications. The purpose may be to change the activity or specificity of the Cas protein without changing its main function. For example, U.S. Patent US20180100148A1 describes mutations in Streptococcus pyogenes Cas9 nucleic acid and protein to reduce the off-target effects of the system.
[0055] sgRNA and its combination:
[0056] In the embodiments of the present disclosure, the nucleotide sequences of the sgRNAs shown in SEQ ID No. 1-21 are derived from an sgRNA library (unpublished) constructed internally by the Institute of Hematology, Chinese Academy of Medical Sciences. We designed a guide RNA (gRNA) database based on the HLA-A gene information (HLA-A major histocompatibility complex, class I, A [Homosapiens (human)], Gene ID: 3105) provided by NCBI. The library includes a total of 520 sgRNAs, including 50 negative controls. The inventors obtained the sgRNAs and their combinations after library screening. After knowing the nucleotide sequence, it can be obtained by suitable methods in the prior art, including but not limited to chemical synthesis, polymerase chain reaction (PCR), etc.
[0057] In the process of gene editing, the above-mentioned sgRNA can be used alone. In some embodiments of the present disclosure, it can achieve an editing efficiency of about 20%, about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99%. It can also be used in combination, or with the addition of other sgRNAs. In other embodiments of the present disclosure, it can also achieve an editing efficiency of about 20%, about 30%, about 40%, about 50%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 98%, or about 99%. In some embodiments of the present disclosure, the sgRNAs can be loaded into the same container or loaded into different containers and introduced into cells.
[0058] The nucleotide sequence of the above-mentioned sgRNA can be modified. The modification includes, but is not limited to, substitution, insertion, deletion or exchange or replacement region of one or more nucleotides for the purpose of improvement, and modification of the nucleotide sequence using other groups. In some embodiments of the present disclosure, the mutated sgRNA nucleotide sequence can have at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, or at least 70%, at least 80%, at least 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% identity compared to SEQ No. 1-21.
[0059] Vector or recombinant vector:
[0060] In an embodiment of the present disclosure, the provided vector or recombinant vector contains at least one sgRNA nucleotide sequence. Its purpose is to transfer the nucleic acid to the target cell for gene editing. In some embodiments of the present disclosure, the vector or recombinant vector also contains a nucleotide sequence encoding a Cas protein, which is operably linked to a suitable promoter.
[0061] In some embodiments of the present disclosure, the vector or recombinant vector can be encapsulated into a virus or virus-like particle and thus transferred to the target cell. Examples of the vector or recombinant vector include, but are not limited to, a plasmid vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector or a retroviral vector. In some embodiments of the present disclosure, the vector can be a linear vector or a circular vector. It can be a non-viral vector such as a plasmid, a viral vector, or a vector that utilizes a transposon. The vector can contain regulatory sequences such as promoters and terminators, as well as marker sequences such as drug-resistant genes and reporter genes.
[0062] Applied cells:
[0063] In embodiments of the present disclosure, gene editing using the sgRNA or sgRNA composition to knock out or knock down the human HLA-A gene can be used on any cell containing human HLA-A. For example, in some embodiments of the present disclosure, the cell is a human cell, including but not limited to embryonic stem cells, induced pluripotent stem cells, germ cells, fibroblasts, oligodendritic glial cells, glial cells, hematopoietic stem cells / hematopoietic progenitor cells, neuronal progenitor cells, neurons, muscle cells, bone cells, liver cells, pancreatic cells, retinal cells, cancer cells, T cells, B cells, NK cells, fetal cardiomyocytes, myofibroblasts, mesenchymal stem cells, autologous transplanted expanded cardiomyocytes, adipocytes, differentiated totipotent cells, multipotent cells, The cells may be derived from human embryonic stem cells, hematopoietic stem cells, myoblasts, adult stem cells, bone marrow cells, mesenchymal cells, parenchymal cells, epithelial cells, endothelial cells, mesothelial cells, fibroblasts, osteoblasts, chondrocytes, exogenous cells, endogenous cells, stem cells, hematopoietic stem cells, bone marrow-derived progenitor cells, cardiomyocytes, bone marrow cells, fetal cells, undifferentiated cells, multipotent progenitor cells, unipotent progenitor cells, monocytes, cardiomyoblasts, skeletal myoblasts, macrophages, capillary endothelial cells, xenogeneic cells, allogeneic cells, or postpartum stem cells. In other embodiments of the present disclosure, the cells may also be cells grown in other organisms but containing human HLA-A.
[0064] In some embodiments of the present disclosure, the gene editing can occur in vivo or in vitro. The components of the CRISPR-Cas system described herein can be transferred into the cells using any suitable method, including, but not limited to, transfection, viral infection, electroporation of RNPs, and the like.
[0065] In order to enable those skilled in the art to better understand the technical solutions of the present invention, the present invention is further described in detail below with reference to specific embodiments.
[0066] Example:
[0067] The sgRNA library used in this example was constructed internally at the Institute of Hematology, Chinese Academy of Medical Sciences (unpublished). We designed a guide RNA (gRNA) library based on HLA-A gene information (HLA-Amajorhistocompatibility complex, class I, A [Homo sapiens (human)], Gene ID: 3105) provided by NCBI. The library includes 520 sgRNAs, including 50 negative controls.
[0068] Example 1: HLA-A sgRNA library screening
[0069] 1. First, detect the expression level of HLA-A on the surface of 293T cells. 293T cells were cultured in DMEM complete medium: DMEM + 10% FBS + 1% penicillin / streptomycin.
[0070] 1) Both the experimental group and the control group took 2×10 5 Cells in the experimental group were labeled with HLA-A2 APC-Cy7 antibody and incubated at 4°C for 30 minutes.
[0071] 2) Add 1 ml of PBE buffer to wash the antibody, centrifuge at 1500 rpm for 5 min, discard the supernatant, resuspend the cells in 300 μl of PBE + 2% FBS, and add DAPI at a dilution of 1:1000 before detection.
[0072] 3) Flow cytometry results showed that HLA-A protein was highly expressed on the surface of 293T cells and was significantly separated from the negative group. This result indicates that 293T cells can be used as tool cells for HLA-A sgRNA library screening (see the results). Figure 1 ).
[0073] 2. Package the HLA-A sgRNA plasmid library into lentivirus. Package the virus in a 10 cm culture dish. The packaging system is as follows (Table 1):
[0074] Table 1
[0075]
[0076] 1) Replace DMEM complete medium with 6 ml of Opti medium and place in the incubator.
[0077] 2) Prepare the transfection system: Add 1 ml of Opti medium to the EP tube, then add the vortexed PAX2, VSVG, and sgRNA library plasmids according to the above system.
[0078] 3) Vortex and briefly centrifuge.
[0079] 4) Add PEI according to the amount and mix thoroughly by pipetting.
[0080] 5) Let it stand for 20 minutes.
[0081] 6) Add the plasmid system to the dish and shake well.
[0082] 7) After 8 hours, the medium was replaced with complete DMEM.
[0083] 8) After 48 hours, collect the viral supernatant and store at 4°C.
[0084] 3. Measure the virus titer.
[0085] 1) One day in advance, 293T cells were plated in a 48-well plate, with 6 × 10 cells per well. 4 Cells, 300ul DMEM complete medium.
[0086] 2) Centrifuge the collected viral supernatant at 2000g for 5 minutes and filter the supernatant using a 0.45 μm filter.
[0087] 3) Prepare the viral infection system according to Table 2, with 500 μL of infection system per well. Prepare six viral gradients, with duplicate wells for each gradient. Also, prepare six control wells without virus.
[0088] Table 2
[0089]
[0090]
[0091] 4) Aspirate the culture medium from the culture plate and add the virus infection system.
[0092] 5) 48 hours after infection, add 2 μg / ml puromycin to one duplicate well of cells in each virus gradient group and the control group, and the other well serves as a control.
[0093] 6) After 48 hours of puromycin selection, all cells in the control group should be observed to be dead. Record the number of viable cells in the puromycin group and the non-puromycin group for each virus gradient.
[0094] 7) Calculate the virus gradient according to the formula:
[0095] (60,000*(number of viable cells in the puromycin group / number of cells in the group without puromycin)) / virus volume (ml) = virus titer TU / ml
[0096] 4. Use the viral supernatant to infect the Cas9 stably transfected 293T cell line.
[0097] 1) Plate cells in a 10 cm dish one day in advance. Calculate the cell number and virus volume to ensure a viral infection rate of less than 30%. Infection system: x ml viral supernatant + (10 - x) ml DMEM complete medium + 10 µl polybrene. Perform three replicates and one control group without virus.
[0098] 2) 2ug / ml puromycin was added 48 hours after virus infection. On the 17th day of drug screening, HLA-A knockout was detected by flow cytometry. It was observed that the proportion of HLA-A low-expressing cell populations in the virus group increased compared with the control group. Flow cytometry was used to sort out the 10% HLA-A low-expressing cell population and the 10% high-expressing cell population, while retaining the unsorted cell population (results see Figure 2 ).
[0099] 5. Extract the genome of the HLA-A low-expressing cell population and the unsorted cell population, amplify the sgRNA fragment using PCR technology, and perform NGS sequencing on the amplified sgRNA fragment.
[0100] 1) The genomes of the HLA-A low-expressing cell population and the unsorted cell population were extracted using the TIANGEN DNA extraction kit and the DNA concentration of each group was measured.
[0101] 2) Use PCR technology to amplify the sgRNA fragment, a total of 2 steps of PCR:
[0102] PCR1 (345 bp)
[0103] Primers:
[0104] CRISPR_PCR1_F:5'-AGGGCCTATTTCCCATGATT
[0105] CRISPR_PCR1_R:5'-CGGTGCCACTTTTTCAAGTT
[0106] PCR1 system and conditions:
[0107]
[0108]
[0109] PCR2 (265 bp)
[0110] Primers:
[0111] B5xx_CRISPR_PCR_2F:5'-:NNNNNNNNAGGCTGTTAGAGAGATAA
[0112] B7xx_CRISPR_PCR_2R:5'-NNNNNNNNGCTGTTTCCAGCATAG
[0113] PCR2 system and conditions (8 reactions per sample):
[0114]
[0115] 6. Purify the PCR product using the ZYMO RESEARCH DNA purification kit and measure the DNA concentration. 500 ng of each sample was sent for next-generation sequencing.
[0116] 7. Based on the sequencing results, bioinformatics analysis was performed on the enrichment of sgRNA in the HLA-A low expression group compared with the unsorted group. A total of 24 effective sgRNAs were screened (see the results). Figure 3 ).
[0117] 8. Query the China MAP database (http: / / www.mbiobank.com), which contains HLA gene variant sites (SNPs) and the frequencies of the corresponding variant sites for the Chinese population. Compare all HLA-A SNPs provided by the database (95 mutation sites) with the 24 effective sgRNAs screened above, and exclude three sgRNAs containing variant sites. Because the lowest SNP frequency provided by this database is less than 1 in 10,000, the 21 sgRNAs screened (excluding the variant sites) are considered to cover >99% of the Chinese population. The sequences are shown in SEQ ID Nos. 1-21.
[0118] Example 2: Testing the knockout effect of the selected sgRNA in 293T cell lines using transient transfection
[0119] 1) 293T cells were plated in 24-well plates 24 hours in advance, with 2×10 cells per well. 5 cell.
[0120] 2) Replace the DMEM complete medium with 0.4 ml of DMEM medium (containing 10% FBS, without penicillin / streptomycin) and place the cells in the incubator.
[0121] 3) Prepare the transfection system: Add 50 μl of Opti medium to a 1.5 ml EP tube, then add 1 μg / well of the target plasmid (0.5 μg / well each of the sg plasmid and Cas9 plasmid, prepared using conventional methods). Invert to mix thoroughly; do not vortex.
[0122] 4) Take another 1.5ml EP tube, add 50ul of Opti medium first, then add 3ug / well PEI, invert and mix thoroughly, do not vortex.
[0123] 5) Leave at room temperature for 5 minutes.
[0124] 6) Combine 3) and 4) in one tube, invert to mix thoroughly, do not vortex, and let stand for 20 minutes.
[0125] 7) Add the plasmid system to the dish and shake well.
[0126] 8) After 12-16 hours, the medium was replaced with complete DMEM.
[0127] 9) 48 hours after transfection, add 2ug / ml puromycin.
[0128] 10) After 48 hours of puromycin screening, the HLA-A knockout effect of each sgRNA was detected.
[0129] 11) Flow cytometry results showed that among the 21 sgRNAs, HLA-A-ex2-g13 (SEQ ID No. 1), HLA-A-ex3-g167 (SEQ ID No. 2), and HLA-A-ex2-g452 (SEQ ID No. 3) had the best knockout effects, with the HLA-A-ex2-g13 group achieving a 60% HLA-A knockout cell ratio. (See results in the original text.) Figure 4 ).
[0130] 12) HLA-A-ex2-g13 (SEQ ID No. 1), HLA-A-ex3-g167 (SEQ ID No. 2), HLA-A-ex2-g452 (SEQ ID No. 3) knockout sites on the human HLA-A gene Figure 5 shown.
[0131] Example 3: Detecting the knockout effect of the selected sgRNA on cord blood-derived hematopoietic cells
[0132] 1. Enrichment of cord blood CD34 + Cells were cultured overnight in hematopoietic cell basal medium. The hematopoietic cell basal medium was SFEMII medium supplemented with the following cytokines (Table 3):
[0133] Table 3
[0134] cytokines Use concentration hSCF 100ng / ml hFlt3-L 50ng / ml hTPO 100ng / ml
[0135] 2. Select three sgRNAs with good knockout effects on 293T cells: HLA-A-ex2-g13 (SEQ ID No. 1), HLA-A-ex3-g167 (SEQ ID No. 2), and HLA-A-ex2-g452 (SEQ ID No. 3). TM X Kit S electroporation method: CD34 knockout by electroporation of RNP + Cell surface HLA-A protein.
[0136] 1) CD34 + Cell count: 2 × 10 cells per sample 5 cell.
[0137] 2) Prepare the electroporation system: First add buffer to each tube, then add 75 pmol spCas9 protein and 150 pmol sgRNA, a total of 5 μl. Incubate at room temperature for 20-30 minutes.
[0138] 3) Resuspend the cells in 15 μl of buffer, add RNP (to make a 20 μl system), and pipette >10 times. Be careful not to introduce air bubbles when adding liquid.
[0139] 4) Follow the instructions of the 4D electroporation instrument.
[0140] 5) After electroporation, transfer the cell suspension from the electroporation chamber to a 1.5 ml centrifuge tube. Centrifuge at 500 g for 5 minutes and discard the supernatant.
[0141] 3. Transfer cells to 24-well plates for culture and observation. After 72 hours, CD34 + 、CD34 + CD90 + and CD34 + CD90 - The expression of HLA-A, HLA-ABC, and HLA-DR on the cell surface. The antibodies labeled by flow cytometry are shown in Table 4.
[0142] Table 4
[0143] Detection protein Fluorescein Antibody (ul / sample) CD34 PE 1 CD90 percp-cy5.5 1 HLA-A2 APC-cy7 0.5 HLA-ABC APC 0.5 HLA-DR FITC 0.5
[0144] 4. Flow cytometry results showed that all three sgRNAs could significantly knock out CD34 + 、CD34 + CD90 + and CD34 + CD90 - HLA-A protein on the cell surface, 3 sgRNAs knock out CD34 + The cell ratio was above 94%, and the HLA-A-ex2-g13 group CD34 + CD90 + The proportion of HLA-A knockout cells on cells can reach 97% ( Figure 6 It is a flow gate strategy, and the results are shown in Figure 7 、 Figure 8 ). In addition, three sgRNA groups CD34 + 、CD34 + CD90 + and CD34 + CD90 - There was no significant change in the proportion of HLA-ABC and HLA-DR positive groups on the cells. After statistical analysis, the three sgRNAs knocked out HLA-A and had an effect on HLA-B and HLA-C in the HLA-I molecules of the three groups of cells (see the results). Figure 9 、 Figure 10 ) and HLA-II class molecule expression had no significant effect (see Figure 11 , 12), that is, the sgRNA we used is highly targeted.
[0145] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as within the scope of protection of the present invention.
Claims
1. An sgRNA, characterized in that The nucleotide sequence of the sgRNA is shown in SEQ ID No.
2.
2. The sgRNA according to claim 1, characterized in that The nucleotide sequence is modified.
3. Use of the sgRNA according to claim 1 or 2 in preparing a product for knocking out or knocking down the human HLA-A gene.
4. Use of the sgRNA according to claim 1 or 2 in the preparation of a drug for preventing or reducing immune rejection.
5. A recombinant vector, characterized in that The recombinant vector comprises the nucleotide sequence of the sgRNA according to claim 1 or 2.
6. The recombinant vector according to claim 5, characterized in that The recombinant vector also contains a nucleotide sequence encoding a Cas protein.
7. A kit, characterized in that The kit includes the sgRNA according to claims 1 to 2 or the recombinant vector according to claims 5 to 6.
8. The kit according to claim 7, characterized in that The kit also includes a Cas protein or an expression vector of the Cas protein.
9. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the sgRNA according to claims 1 to 2, or the recombinant vector according to claims 5 to 6, and a pharmaceutically acceptable carrier.
10. A method for improving the knockout or knockdown efficiency of human HLA-A gene in cells, characterized in that: include: Step 1) introducing the sgRNA according to claims 1 to 2, or the recombinant vector according to claims 5 to 6 into the cell; Step 2) introducing the Cas protein or a Cas protein expression vector into the cell; Step 3) growing the cells; The method is non-therapeutic.
Citation Information
Patent Citations
S. pyogenes CAS9 mutant genes and polypeptides encoded by same
US20180100148A1
HLA-A and HLA-B co-knockout multi-blood-line differentiation potential immortalized cell and manufacturing method thereof
CN116694574A