A gene OsERF7 related to rice sheath blight resistance and its encoded protein and application

Abstract

The present invention discloses a gene OsERF7 related to rice sheath blight resistance, a protein encoded therein and an application thereof. The CDS sequence of the gene OsERF7 is shown in SEQ ID NO.1, the full-length sequence is shown in SEQ ID NO.2, and the protein sequence encoded by the gene OsERF7 related to rice sheath blight resistance is shown in SEQ ID NO.3. The present invention finds that the OsERF7 gene is expressed by sheath blight infection, and tissue-specific expression finds that it is mainly expressed in leaf sheaths, and the highest expression is at the rice booting stage. In the present invention, the resistance of rice to sheath blight is significantly reduced by overexpressing OsERF7, and the resistance of rice to sheath blight is significantly enhanced after knocking out the gene. The rice gene OsERF7 of the present invention has a significant effect on the resistance to rice sheath blight, can be applied to rice sheath blight resistance breeding, and has important significance for the genetic improvement of rice resistance.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a gene OsERF7 related to rice sheath blight resistance, a coded protein and an application thereof. Background Art

[0002] Rice sheath blight is an important fungal disease caused by Rhizoctonia soalni Kühn and is one of the three major rice diseases. The disease occurs in a wide area, seriously threatening the yield and quality of rice. At present, the main way to prevent and control rice sheath blight is to spray chemical agents. Although this method can control the occurrence of sheath blight to a certain extent, long-term use will lead to drug resistance in pathogens and cause environmental pollution. Breeding sheath blight-resistant varieties is the most economical and effective measure to reduce the harm of sheath blight and protect the environment. However, there is a lack of available resistance gene resources, and people lack a deep understanding of the interaction mechanism between rice and sheath blight pathogens, and sheath blight resistance breeding is significantly lagging behind. Discovering sheath blight-resistant genes and analyzing their resistance analysis mechanisms can provide genetic resources and theoretical basis for molecular breeding of sheath blight resistance. Summary of the invention

[0003] Purpose of the invention: In order to solve the above technical problems, the present invention aims to provide a CDS sequence of the gene OsERF7 related to rice sheath blight resistance, the sequence is shown in SEQ ID NO.1, which solves the problem of lagging breeding for sheath blight resistance.

[0004] The present invention also provides the coding protein of the gene OsERF7 related to rice sheath blight resistance and its application

[0005] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a CDS sequence of a gene OsERF7 related to rice sheath blight resistance, and the CDS sequence is shown in SEQ ID NO.1.

[0006] The full-length sequence of the gene OsERF7 related to rice sheath blight resistance of the present invention is shown in SEQ ID NO.2.

[0007] The amino acid sequence of the protein encoded by the gene OsERF7 related to rice sheath blight resistance described in the present invention is shown in SEQ ID NO.3.

[0008] The invention discloses an overexpression vector pCAMBIA1300-OsERF7 of the gene OsERF7 related to rice sheath blight resistance.

[0009] Furthermore, the overexpression vector pCAMBIA1300-OsERF7 is constructed by amplifying the CDS sequence of OsERF7, connecting it to the pCAMBIA1300 vector, and then transforming and extracting the plasmid to finally obtain the overexpression vector pCAMBIA1300-OsERF7.

[0010] The invention discloses a gene knockout vector for the gene OsERF7 related to rice sheath blight resistance.

[0011] Furthermore, the gene knockout vector construction method is to design and synthesize the OsU3-target fragment (GAGGAGGGAGGCAGTATCGC) and gRNA (GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT), connect them to the pYLCRISPR / Cas9-MH vector, extract the plasmid through transformation, and finally obtain the gene knockout vector.

[0012] The CDS sequence of the gene OsERF7 or the full-length sequence of the gene OsERF7 or the protein or the overexpression vector or the knockout vector of the present invention is used in regulating resistance to rice sheath blight.

[0013] Furthermore, overexpression of the rice OsERF7 gene reduced rice resistance to sheath blight, while knockout of the rice OsERF7 gene enhanced rice resistance to sheath blight.

[0014] The CDS gene of the gene OsERF7 or the full-length sequence of the gene OsERF7 or the protein or the overexpression vector or the knockout vector of the present invention is used in cultivating rice germplasm resistant to sheath blight.

[0015] Among them, the present invention is an application of reducing the expression amount and / or activity of the OsERF7 gene in the recipient rice in cultivating transgenic rice with improved sheath blight resistance.

[0016] Furthermore, the present invention provides an application of reducing the expression level and / or activity of the OsERF7 gene in the recipient rice in breeding for resistance to sheath blight of rice.

[0017] The application of the protein encoded by the gene OsERF7 of the present invention in any of the following:

[0018] (1) Regulate plant resistance to sheath blight;

[0019] (2) A protein having the same function as that of rice, wherein one or more amino acid residues of the amino acid sequence shown in SEQ ID No. 3 are replaced and / or deleted and / or added.

[0020] The expression level and / or activity of the OsERF7 protein of the present invention is reduced, and the resistance of the plant to sheath blight is enhanced.

[0021] The expression level and / or activity of the OsERF7 protein of the present invention is increased, and the resistance of the plant to sheath blight is enhanced.

[0022] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0023] The present invention identifies a gene OsERF7 that regulates rice sheath blight resistance. The OsERF7 gene negatively regulates rice resistance to sheath blight pathogens. Overexpression of the gene significantly weakens rice resistance to sheath blight. Knocking out the gene significantly enhances rice resistance to sheath blight. Gene knockout-free sheath blight resistance-enhancing materials can be obtained, which can be used in resistance breeding and have important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The induction and tissue-specific expression pattern analysis of rice OsERF7 gene, where A is the expression pattern of OsERF7 gene in response to sheath blight infection, B is the expression pattern of OsERF7 gene under ethylene (ETH) and ethylene inhibitor (AOA) treatment, C is the expression pattern of OsERF7 gene in various rice tissues, and D is the expression pattern of OsERF7 gene in leaf sheath tissues at different growth stages. Different capital letters represent multiple comparison results at the P < 0.05 level. ** indicates a significant level of P < 0.01;

[0025] Figure 2 Phenotype identification of sheath blight of OsERF7 overexpressed and wild-type materials in greenhouse adult stage, where A is the sheath blight phenotype of OsERF7 overexpressed materials in greenhouse adult stage 10 days after inoculation, B is the expression analysis of OsERF7 gene in OsERF7 overexpressed materials, C is the lesion length of OsERF7 overexpressed materials in greenhouse adult stage 5, 10, 15 days after inoculation, ** indicates significant level P < 0.01;

[0026] Figure 3 Phenotypic identification of sheath blight of OsERF7 knockout line materials and wild type control at greenhouse adult stage, where A is the knockout target sequence of OsERF7 gene, B is the base deletion of OsERF7 knockout line, C is the phenotype 10 days after inoculation at greenhouse adult stage, D is the length of lesions 5, 10, 15 days after inoculation at the end of tillering stage in greenhouse, ** indicates significant level P < 0.01;

[0027] Figure 4 Figure 2 Identification of sheath blight phenotype of OsERF7 transgenic materials and wild type in vitro, where A is the sheath blight phenotype of OsERF7 overexpressing materials and wild type in vitro stems 7 days after inoculation, B is the lesion length of OsERF7 overexpressing materials and wild type in vitro stems 7 days after inoculation, C is the sheath blight phenotype of OsERF7 knockout materials and wild type in vitro stems 7 days after inoculation, D is the lesion length of OsERF7 knockout materials and wild type in vitro stems 7 days after inoculation, * indicates significant level P < 0.05, ** indicates significant level P < 0.01. DETAILED DESCRIPTION

[0028] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0029] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Experimental methods without specific conditions specified in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0030] Xu Dao No. 3: Xie et al., Molecular Plant Pathology, 2023;24:1535–1551.

[0031] Sheath blight pathogenic bacteria strain RH-9: Zuo et al., Theoretical and Applied Genetics, 2013, 126: 1257-1272.

[0032] The above materials and strains were provided by Yangzhou University.

[0033] Example 1

[0034] Identification and cloning of OsERF7 gene

[0035] The genome sequence of rice OsERF7 gene was obtained through gene number LOC_Os06g07030, and primers were designed: F: ATGGATAGGAGGGAGGCCACCG, R: CTACTCGTCGTCGGAGGTGTCC, and the cDNA of leaves of 4-5 leaf stage seedlings of Xudao No. 3 was used as a template to amplify the CDS sequence of rice OsERF7 gene as shown in SEQ ID NO.1, its amino acid sequence as shown in SEO ID NO.3, and the full length of OsERF7 gene as shown in SEQ ID NO.2.

[0036] Example 2

[0037] Analysis of the expression pattern of OsERF7 gene

[0038] The wild-type material Xudao No. 3 at the end of tillering was inoculated with the strain RH-9 of Rhizoctonia solani. The embedding method was used (He Min et al., Acta Botanica Sinica, 2020, 55: 577-587). The wood bark with a thickness of 0.8 mm and a length of 1.0 cm attached to the hyphae of Rhizoctonia solani was carefully embedded in the leaf sheath 1 cm-2 cm below the second leaf of rice. The water in the 1 cm section above and below the inoculum was cut at 0 h before inoculation and 12 h and 24 h after inoculation. Rice leaf sheaths were quickly stored in liquid nitrogen; secondly, ETH (1mM) and AOA (1mM) reagents were sprayed on rice materials in the seedling stage, and plant samples were taken 0h before treatment and 3h, 6h, and 12h after treatment, and stored in liquid nitrogen; samples of different tissue parts (roots, stems, leaves, leaf sheaths, panicles) of the rice variety Xudao No. 3 in the mature stage and leaf sheath samples at different growth stages (seedling stage, tillering stage, booting stage, heading stage) were quickly stored in liquid nitrogen. According to the steps in the manual (TransGen), Trizol was used to extract total RNA from each rice sample and different growth stages, and then a kit (HiScriptIII RT SuperMix) produced by Novozyme was used for reverse transcription experiments to obtain the corresponding total cDNA. Using the cDNA of the above-mentioned different tissues as templates and rice Actin gene as an internal reference (Actin gene amplification primers F1: CTTCATAGGAATGGAAGCTGCGGGTA and R1: CGACCACCTTGATCTTCATGCTGCTA), real-time quantitative PCR was performed using OsERF7 gene-specific quantitative primers (ERF7-qF: GGGAGGAGGGAGGCAGTATCG, ERF7-qR: GCTGGTCGGGGAAGTTGAGGC). The reaction conditions were: pre-denaturation at 95°C for 5 min, and then entering the following cycles: 95°C: 30 sec, 60°C; 30 sec, 72°C; 30 sec for a total of 40 cycles.

[0039] The results of real-time quantitative PCR showed that the expression of OsERF7 gene could be induced and upregulated after infection by Rhizoctonia solani ( Figure 1 A), and its expression is inhibited by ethylene signal ( Figure 1 B). It was further found that OsERF7 was highly expressed mainly in leaf sheaths ( Figure 1 C), and the expression level reaches a peak at the booting stage ( Figure 1 D), which is consistent with the characteristic that rice sheath blight mainly harms leaf sheaths, proving that the OsERF7 gene is closely related to rice sheath blight resistance.

[0040] Example 3

[0041] Vector construction and genetic transformation to construct transgenic material

[0042] The main steps of overexpression vector construction are as follows: high-fidelity DNA polymerase was used to amplify the cDNA of the booting sheath tissue of Xudao No. 3 as a template, primers F: CATTTACGAACGATAGCCggtaccATGGATAG GAGGGAGGCCACCG, R: ATCATGATCTTTGTAATCggatccCTACTCGTCGTCGGAGG TGTCC, and the CDS sequence of OsERF7 with homology arms was obtained. The restriction endonucleases KpnI and BamHI (Thermo Scientific TM ,FD0524,ER0051) to digest the overexpression vector pCAMBIA1300 to make it linear, and then introduce the target gene into the overexpression vector pCAMBIA1300 by homologous recombination enzyme. The specific operation method is as follows: first, the amplified CDS sequence and the digested vector are homologously recombined with the obtained OsERF7 CDS sequence and the above digested pCAM BIA1300 linear vector by homologous recombination enzyme (ClonExpress II One Step Cloning Kit reagent of Novozymes) for 2 hours, and then introduced into Escherichia coli competent cells by heat shock transformation, and then 500uL of LB solution is added to culture at 37 degrees for 30 minutes for recovery, and finally the plate is placed on a kana resistant culture plate and placed in a 37 degree incubator for 12 hours. The monoclonal colony on the culture dish was selected for culture, the plasmid was extracted and subjected to enzyme digestion detection, the positive plasmid was selected for sequencing, and finally the positive plasmid without mutation that was successfully recombined was obtained, and then the overexpression vector pCAMBIA1300-OsERF7 was transferred into Xudao No. 3 through Agrobacterium EHA105 mediation to obtain the OsERF7 overexpression material. The genetic transformation of the transgenic of the present invention was obtained by Wuhan Boyuan Biotechnology Co., Ltd. according to conventional transgenic technology experiments. Three transgenic lines were selected and named OsERF7-OE1, OsE RF7-OE2, and OsERF7-OE3. Through expression detection, the expression of OsERF7 in these three families was significantly overexpressed ( Figure 2 B).

[0043] The main steps for constructing a knockout vector are as follows: (1) Design a gene knockout target, such as Figure 3As shown in A; (2) Amplification of sgRNA box: Using OsU3 plasmid as template (Ma et al., Molecular Plant, 2015, 3: 1274-1284), OsU3-target fragment (GAGGAGGGAGGCAGTATCGC) and gRNA (GTTTTAG AGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAA GTGGCACCGAGTCGGTGCTTTTTTT) were designed and synthesized. (3) The two products designed and synthesized above were recombined with the pYLCRISPR / Cas9-MH vector (Ma et al., Molecular Plant, 2015, 3: 1274-1284) digested with Bsa I by homologous recombinase (ClonExpress II One Step Cloning Kit reagent from Novazonics) to construct the knockout vector; (4) Escherichia coli was transformed and single clone colonies were selected for culture; (5) After plasmid extraction, PCR amplification and plasmid restriction enzyme digestion were performed to verify positive clones (amplification primers F: GAGGAGGGAGGCAGTATCGCgttttagagctagaaat, R: AACAAGCGGTCGCGGATCTGTgccacggatcatctgc); (6) The recombinant positive plasmid was transferred into Agrobacterium EHA105; (7) Positive Agrobacterium single clones were verified and preserved. The constructed knockout vector plasmid was transferred into Xudao No. 3 by Agrobacterium-mediated transformation for rice genetic transformation. After the rice genetic transformation was completed, three mutant transgenic strains were identified by sequencing the target site (sequencing primers F: GCGAGGATGGATAGGAGGGAG, R: CCTCAACTTCCC CGACCA), which were named OsERF7-KO1, OsERF 7-KO2 and OsERF7-KO3. The genetic transformation of the transgenic of the present invention was obtained by Wuhan Boyuan Biotechnology Co., Ltd. according to conventional transgenic technology experiments. The sequencing results showed that there was a deletion near the knockout target site, and the specific deletion was as follows ( Figure 3 As shown in B), the three lines are missing the bases CAGTA, GGCAGTA and GCAGT respectively.

[0044] Example 4

[0045] Identification of resistance to sheath blight

[0046] The resistance of the wild type (WT, wild type Xudao No. 3), knockout lines (OsERF7-KO1, OsERF7-KO2 and OsERF7-KO3) and overexpression lines (OsERF7-OE1, OsERF7-OE2, OsERF7-OE3) of this gene to sheath blight was identified by greenhouse inoculation and in vitro inoculation methods.

[0047] The identification and inoculation methods of sheath blight resistance were carried out according to the methods described by the previous researchers (He Min et al., Acta Botanica Sinica, 2020, 55: 577-587), and the highly pathogenic sheath blight fungus strain RH-9 (Zuo et al., Theoretical and Applied Genetics, 2013, 126: 1257-1272) was used to inoculate rice. Sheath blight fungi were first cultured on potato dextrose agar medium at 28°C for 3 days, and then the fungal blocks (about 0.5 cm in diameter) were transferred to potato dextrose broth medium containing wood bark with a thickness of 0.8 mm and a length of 1.0 cm, and grown at 28°C for about 3 days until the mycelium completely covered the wood bark, and the wood bark colonized with mycelium was used as the inoculum.

[0048] For greenhouse inoculation, when the rice plants grow to the end of tillering, each plant and the wild-type plant are transferred to a greenhouse with a relative humidity of 75%-85%. The temperature and light conditions in the greenhouse are set to 14h light (30℃) and 10h dark (26℃). The four main tillers of each plant are inoculated in the same way as field inoculation. The inoculation method is artificial inoculation by embedding method. The above-mentioned cultured wood bark with a thickness of 0.8mm and a length of 1.0cm with the hyphae of Rhizoctonia solani is carefully placed on the leaf sheath 1cm below the second leaf. Five seedlings are inoculated in each pot, and each seedling is inoculated with 5 stems with relatively consistent growth periods. The length of the lesions is measured 5, 10, and 15 days after inoculation, and the average value of three repetitions is calculated.

[0049] For inoculation of in vitro stem materials, in vitro stem sampling was performed when the rice plants grew to the early stage of booting. After cutting the rice stems of each plant and the wild-type plant, only the sword leaf and the second leaf were left. The rice was placed in water overnight to adapt the rice to the climate chamber environment and prevent the rice from losing water. The next day, the embedded method was also used for inoculation. The cultured wood bark with a thickness of 0.8 mm and a length of 1.0 cm with the hyphae of Rhizoctonia solani was carefully placed in the leaf sheath 1 cm below the second leaf. After the inoculation, the stem was inserted into a test tube rack embedded with floral mud and then moved into the nutrient solution. It was then placed in an environment with a temperature and light setting of 14h light (30°C), 10h dark (26°C), and a humidity setting of 90% for growth. 8-10 in vitro stems were collected from each family, and the length of the lesions was investigated 7 days after inoculation.

[0050] Phenotypic identification results showed that in greenhouse living materials, OsERF7 overexpression materials significantly reduced rice sheath blight resistance ( Figure 2 A, C), while the knockout material's resistance to sheath blight increased significantly ( Figure 3 C and D in the middle). The phenotype of the in vitro stem materials further confirmed that the overexpression materials reduced the resistance to sheath blight, while the knockout materials enhanced the resistance to sheath blight in rice ( Figure 4 (in AD).

Claims

1. Reduce the genes related to resistance to sheath blight in rice OsERF7 The use of the expression amount of in enhancing the resistance of rice to sheath blight is characterized in that, The gene OsERF7 The full-length sequence of the gene is shown in SEQ ID NO.

2. OsERF The CDS sequence is shown in SEQ ID NO.

1.

2. Reduce the genes related to resistance to sheath blight in rice OsERF7 The use of the activity of the encoded protein in enhancing resistance to rice sheath blight is characterized in that: The amino acid sequence of the protein is shown in SEQ ID NO.

3.

3. A gene related to rice resistance to sheath blight according to claim 1 OsERF7 Use of a gene knockout vector in enhancing resistance to rice sheath blight, characterized in that: The gene knockout vector construction method comprises designing and synthesizing an OsU3-target fragment and a gRNA, connecting them to a pYLCRISPR / Cas9-MH vector, and finally obtaining a gene knockout vector by transformation and extracting a plasmid. The OsU3-target fragment is GAGGAGGGAGGCAGTATCGC, and the gRNA fragment is GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT.

4. Use of the knockout vector according to claim 3 in cultivating rice germplasm resistant to sheath blight.

Images