Method, system and application for large-fragment DNA cascade assembly
By using two orthogonal serine integase systems and TG1int integase in bacteria, the problems of low assembly efficiency and unanticipated recombination of large fragment DNA in the prior art are solved, and efficient cascade assembly and introduction are achieved.
Patent Information
- Application Number
- CN202410793906.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-19
- Publication Date
- 2025-06-03
- Estimated Expiration
- 2044-06-19
AI Technical Summary
The prior art is difficult to efficiently realize the cascade assembly of large fragments of DNA in bacteria, and there are problems of low recombination efficiency, unexpected recombination and vector backbone integration.
By using two orthogonal serine integrase systems, receptor bacteria containing integrase expression cassettes and recognition sites were constructed, and the shuttle plasmid backbone was excised by TG1int integrase, and the cascade assembly of large fragments of DNA was achieved.
The efficient assembly and introduction of large fragments of DNA is achieved, with the assembly efficiency up to 100%, avoiding the problems of unexpected recombination and vector skeleton integration.
Smart Images

Figure CN118813656B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and in particular relates to a method, system and application for large-fragment DNA cascade assembly. Background Art
[0002] The statements in this part only provide background technical information related to the present invention, and do not necessarily constitute prior art.
[0003] It is the goal of synthetic biologists to modify the genomes of organisms according to human will. Using synthetic biology techniques, the construction and rewriting of artificial chromosomes have been achieved, such as the artificial synthesis and replacement of mycoplasma genomes, the construction of mycoplasma minimal genomes, the rewriting of the Escherichia coli genetic code, and the de novo synthesis of yeast chromosomes (Science, 2010, 329: 52-56; Science, 2016, 351: aad6253; Nature, 2016, 539: 59-64). Since yeast can still survive after removing the cell wall, it is relatively easy to introduce DNA fragments at the Mb level. For prokaryotic bacteria without cell walls, such as mycoplasma, it is also easy to introduce large DNA fragments. However, for most prokaryotic bacteria, the presence and complexity of the cell wall limit the length of the introduced DNA, and it is also difficult to introduce large foreign DNA fragments through protoplast fusion by removing the cell wall. Therefore, it is usually necessary to introduce small DNA fragments into bacteria for assembly. Although existing homologous recombination-based techniques can achieve the assembly of DNA fragments over 100 kb in prokaryotic bacteria, these techniques have several disadvantages: one is that the assembly based on the host's own recombination system requires relatively long homologous arms, for example, dozens of kb in Bacillus subtilis and several kb even in Escherichia coli with higher recombination efficiency; the second is that when there are sequences homologous to the foreign DNA at non-target sites on the chassis bacterium genome, recombination based on DNA sequence homology is likely to cause unexpected recombination or form chimeras, resulting in the breakage of the introduced sequence (Nature, 2023, 619: 555-562; Nature, 2016, 539: 59-64); the third is that the recombination efficiency is not high, for example, the correct assembly rate in Escherichia coli is only about 10% (Nature, 2023, 619: 555-562); the fourth is that the ultra-long DNA assembly techniques based on the CRISPR-Cas system and the Escherichia coli or yeast recombination system are cumbersome to operate and are restricted by CRISPR-Cas technology patents, with potential application risks.
[0004] Serine integrases derived from bacteriophages can recognize specific sequences attB and attP on bacterial and phage genomes and mediate the integration of DNA between the two sites. For example, those derived from Streptomyces phages Integrases such as BxB1 and TG1 recognize the attP site on the phage genome and the corresponding attB site on the host bacterial chromosome and catalyze the recombination of the two sites to integrate the phage genome into the host chromosome. The recombination between the attP and attB sites generates two new sites, attL and attR. The disadvantage of using serine integrases to integrate large foreign DNA fragments into the host chromosome is that the newly generated attL and attR sites cannot be used for the next round of integration, and at the same time, the vector fragments carrying the DNA will be integrated together, which will make it difficult to carry out the next round of integration. There are research reports that by designing incompatible attP-attB integration sites, 7 DNA fragments were assembled into a 62.4 kb circular plasmid in vitro using the ΦBT1 integrase (Scientific Reports, DOI: 10.1038 / srep00141). However, due to factors such as the stability of linear DNA and the DNA import efficiency, it is impossible to use this method to assemble multi-fragment and large-fragment DNA in bacteria. Therefore, it is generally considered that serine integrases cannot be used for iterative assembly of DNA fragments. So far, no method has been found to efficiently and continuously introduce large-fragment DNA into the bacterial genome. Summary of the Invention
[0005] To overcome the deficiencies of the above-mentioned prior art, the present invention provides a method, system and application for cascading assembly of large-fragment DNA. Based on the bacterial chromosome assembly technology of the integrase system, the present invention can efficiently assemble large-fragment DNA into ultra-long DNA in sequence and introduce it into the bacterial genome by using two sets of orthogonal serine integrase systems.
[0006] To achieve the above object, one or more embodiments of the present invention provide the following technical solutions:
[0007] In the first aspect of the present invention, a method for inserting a large DNA fragment into a bacterial genome is provided, including:
[0008] S1: Construct a recipient bacterium containing the integrase expression cassette and its recognition site or ;
[0009] S2: Transform the recipient bacterium in S1 with a donor plasmid containing the recognition site of the integrase, the recognition site of the TG1int integrase, and the foreign DNA fragment, and induce recombination to integrate the foreign DNA fragment into the host cell of the genome;
[0010] Or,
[0011] S1’: Construct a recipient bacterium containing the integrase recognition site or The recipient bacterium
[0012] S2’: Introduce the helper plasmid II containing the integrase and the TG1int integrase gene into the recipient bacterium obtained in S1’;
[0013] Wherein, the recognition sites of the integrase and the TG1int integrase are respectively or attB T , attP T ;
[0014] The donor plasmid includes tandem selection marker 1, attB T , a shuttle plasmid backbone, attP T , and an exogenous DNA fragment.
[0015] In a specific embodiment of the present invention, the method further includes:
[0016] S3: Induce the expression of the helper plasmid I containing the TG1int integrase in the host cell in which the exogenous DNA fragment obtained in S2 is integrated into the genome, so as to obtain a host cell from which the shuttle plasmid backbone is removed;
[0017] Or,
[0018] S3’: Transform the donor plasmid containing the recognition site of the integrase, the recognition site of the TG1int integrase, and the exogenous DNA fragment into the recipient bacterium obtained in S2’, induce recombination, so as to integrate the exogenous DNA fragment into the genome of the host cell and remove the shuttle plasmid backbone;
[0019] The shuttle plasmid backbone includes a yeast replication origin and its selection marker 2, a recipient bacterium replication origin and its selection marker 3, and a counter-selection marker 4.
[0020] In a specific embodiment of the present invention, the method further includes:
[0021] S4: Repeat steps S2 - S3 or S2’ - S3’ multiple times to obtain a host cell with multi-fragment insertion;
[0022] S5: Use the Red / ET homologous recombination technology and counter-selection in the host cell obtained in S4 to remove the non-target DNA introduced exogenously on the host cell genome, and achieve large-fragment insertion.
[0023] In a specific embodiment of the present invention, in step S4, the multiple repetitions are divided into odd rounds and even rounds, wherein the selection resistances of the donor plasmids used in the odd rounds and the even rounds in the host cell are different, and the sequences of the exogenous DNA fragments are the same or different.
[0024] In a specific embodiment of the present invention, the donor plasmid used in odd rounds is pBOY-contig-N, and the donor plasmid used in even rounds is pBEY-contig-M;
[0025] The odd-round assembly refers to the 1st round of assembly, the 3rd round of assembly, the 5th round of assembly, the nth round of assembly, and so on, where n is an odd number, and N = 1, 3, 5......n; the even-round assembly refers to the 2nd round of assembly, the 4th round of assembly, the 6th round of assembly, the (n + 1)th round of assembly, and so on, where M = 2, 4, 6......n + 1;
[0026] The selection marker 3 in pBOY-contig-N is different from that in pBEY-contig-M.
[0027] In a specific embodiment of the present invention, the recipient bacterium includes Escherichia coli;
[0028] The Escherichia coli includes GB2005, MG1655, DH5α, BL21, TOP10, JM109, HB101, SCS110, JM110 or Xl1-Blue.
[0029] In a specific embodiment of the present invention, the exogenous DNA fragment is ≥1 kb, ≥30 kb, ≥60 kb, ≥90 kb, ≥130 kb, ≥150 kb, ≥300 kb, ≥450 kb, ≥700 kb or ≥1000 kb;
[0030] Preferably, the exogenous DNA fragment is ≥130 kb;
[0031] Preferably, the exogenous DNA fragment is derived from DNA of any species or artificially synthesized DNA, including chromosomal DNA of organisms, biosynthetic gene clusters of natural or artificially modified secondary metabolites, and artificially designed and synthesized DNA.
[0032] In a second aspect of the present invention, there is provided a system for inserting a large DNA fragment into a bacterial genome, the system comprising a donor plasmid, an auxiliary plasmid I, a recipient bacterium I or a donor plasmid, an auxiliary plasmid II, a recipient bacterium II;
[0033] The donor plasmid includes tandem selection marker 1, attB T , a shuttle plasmid backbone, attP T , and an exogenous DNA fragment;
[0034] The shuttle plasmid backbone includes a yeast replication origin and its selection marker 2, a recipient bacterium replication origin and its selection marker 3, and a counter-selection marker 4;
[0035] The auxiliary plasmid I includes an expression cassette of the TG1int integrase;
[0036] The auxiliary plasmid II includes expression cassettes of integrase and TG1int integrase;
[0037] The recipient bacterium I contains an integrase expression cassette and its recognition site or
[0038] The recipient bacterium II contains an integrase recognition site or
[0039] In the third aspect of the present invention, a kit is provided, which includes the system described in the second aspect.
[0040] In the fourth aspect of the present invention, a genetically engineered strain is provided. The genetically engineered strain is Escherichia coli, and the engineered strain inserts a large fragment of foreign DNA into the genome by the method described in the first aspect.
[0041] In the fifth aspect of the present invention, the applications of the above method, system or kit are provided. The applications include constructing a gene recombinant bacterium with large fragment insertion, genomic cloning and constructing a genomic library, studying gene function, studying genomic structure and dynamics, constructing an organism containing a hybrid genome, constructing an expression strain of a metabolic pathway, constructing a recombinant bacterium with increased gene copy number to improve the yield of proteins and metabolites, and constructing a biological information storage body, any one or more of them.
[0042] The above one or more technical solutions have the following beneficial effects:
[0043] 1) The method provided by the present invention is an innovation in the use method of the serine integrase system. Tandem sites are introduced on the plasmid carrying the DNA fragment. When using integrase to integrate the plasmid into the site on the Escherichia coli genome, a new site will be introduced simultaneously to facilitate the next round of DNA integration; 2) A pair of recognition sites attP T and attB T, after the plasmid carrying the DNA fragment is integrated into the Escherichia coli genome, the vector backbone can be excised by expressing the TG1 integrase, so that the vector can be reused; 3) The constructed Escherichia coli - yeast shuttle vector has multiple functions (it can assemble and replicate multiple DNA fragments in yeast, can replicate as a single copy in Escherichia coli, can integrate the plasmid into the Escherichia coli or yeast chromosome when expressing the integrase, and can excise the vector when expressing the TG1int integrase); 4) The DNA assembly efficiency based on this method can reach 100%, and no false positives will be generated, which is far superior to the existing DNA assembly methods based on homologous recombination.
[0044] The method and system provided by the present invention can perform cascade assembly of DNA in Escherichia coli. In particular, it can successively assemble large DNA fragments of more than 100 kb into ultra-long DNA through multiple rounds of assembly, and has important application values in aspects such as DNA assembly, large-scale genomic modification, synthesis of artificial chromosomes, and construction of artificial living organisms.
[0045] Advantages of additional aspects of the present invention will be partially given in the following description, partially become obvious from the following description, or be understood through the practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0046] The specification drawings forming a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation to the present invention.
[0047] Figure 1 It is a flow chart of the cascade assembly of large DNA fragments of the present invention. A, Structural diagrams of the multifunctional large DNA integration vectors pBOY and pBEY; B, Flow chart of assembling small DNA fragments into medium-length and large fragments; C, Flow chart of assembling large DNA fragments into ultra-long DNA fragments using Assembly Method 1 (Example 3); D, Flow chart of assembling large DNA fragments into ultra-long DNA fragments using Assembly Method 2 (Example 4).
[0048] Figure 2This is the colony PCR detection in Example 3 of the present invention for the integration of contig1 on the Escherichia coli genome after excision of the pBOY vector. M, DL1000 DNA marker; Vcut, chk1-C, chk5-C, chk12, chk23, chk34, chk45 are successively the vector excision interface, the interface between segment1 and the Escherichia coli genome, the interface between segment5 and the Escherichia coli genome, and the interfaces of segment1-2, segment2-3, segment3-4, and segment4-5; GB2005 is the wild strain negative control; CK+ and CK- are both pBOY-contig1 plasmid controls.
[0049] Figure 3 This is the colony PCR detection in Example 3 of the present invention for the integration of contig1 and contig2 on the Escherichia coli genome after excision of the pBEY vector. M, DL1000 DNA marker; Vcut, chk1-C, chk12, chk23, chk34, chk45, chk5-mch-6, chk67, chk78, chk89, chk910, chk10-C are successively the vector excision interface, the interface between segment1 and the Escherichia coli genome, and the interfaces of segment1-2, segment2-3, segment3-4, segment4-5, segment5-mch-segment6, segment6-7, segment7-8, segment8-9, segment9-10, and the interface between segment10 and the Escherichia coli genome; GB2005 is the wild strain negative control.
[0050] Figure 4This is for the colony PCR detection in Example 3 of the present invention to check the integration of contig1, contig2, and contig3 into the Escherichia coli genome after the excision of the pBOY vector. M, DL1000 DNA marker; chk1-C, chk12, chk23, chk34, chk45, chk5-mch-6, chk67, chk78, chk89, chk910, chk10-mch-11, chk11-12, chk12-13, chk13-14, chk14-15, chk15-C, Vcut are respectively the interfaces of segment1 with the Escherichia coli genome, segment1-2, segment2-3, segment3-4, segment4-5, segment5-mch-segment6, segment6-7, segment7-8, segment8-9, segment9-10, segment10-mch-segment11, segment11-12, segment12-13, segment13-14, segment14-15, segment15 with the Escherichia coli genome, and the excision interface of the pBOY.
[0051] Figure 5 This is for the colony PCR detection in Example 4 of the present invention to check the continuous integration of contig1 and contig2 into the Escherichia coli genome and the excision of the pBEY vector using Method 2. M, DL1000 DNA marker; chk1-C, chk12, chk23, chk34, chk45, chk5-mch-6, chk67, chk78, chk89, chk910, chk10-C, Vcut are respectively the interface of segment1 with the Escherichia coli genome, segment1-2, segment2-3, segment3-4, segment4-5, segment5-mch-segment6, segment6-7, segment7-8, segment8-9, segment9-10, the interface of segment10 with the Escherichia coli genome, and the vector excision interface. Specific implementation manners
[0052] The following further elaborates the present invention in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention.
[0053] It should be noted that the details not elaborated in the present invention are well-known to those skilled in the art. For the experimental methods without specific conditions noted in the following examples, they are generally carried out under conventional conditions or according to the conditions recommended by the manufacturer. For the experimental procedures not detailed, reference is made to "Molecular Cloning: A Laboratory Manual" ((US) M.R. Green (Michael R. Green), (US) J. Sambrook (Joseph Sambrook), editor-in-chief, Fourth Edition), pathophysiology experiments, online databases, etc.
[0054] In the following examples, the materials, reagents, etc. used are obtained from commercial sources unless otherwise specified.
[0055] Strain: Escherichia coli GB2005, reference: Nature Biotechnology, 2012, 30: 440 - 446.
[0056] Strain: Corynebacterium glutamicum ATCC 13032 was purchased from the China Center for Industrial Culture Collection, catalog number CICC 20213.
[0057] Strain: Saccharomyces cerevisiae VL6 - 48, reference: Nucleic Acids Research, 2016, 44(14): e124.
[0058] Plasmids: pSC101 - PBAD - ccdA - PRha - gbaA - tetR, p15A - rpsL - ccdB and p15A - ccdB - amp, reference: Nucleic Acids Research, 2014, 42(5): e37.
[0059] Plasmids: pBleoBAC11 (GenBank ID: U51113.1), the sequence of pCAP01 can be found at https: / / www.addgene.org / 59981 /
[0060] Plasmid: pcrF19NM2, see https: / / www.molecularcloud.org / , catalog number MC_0101256.
[0061]
[0062] The present invention provides a method for inserting at least one exogenous DNA fragment into a host bacterium, wherein the exogenous DNA fragment is ≥30 kb, and further 30-200 kb; in the present invention, two sets of serine integrase recognition sites are set on a plasmid to construct a yeast-recipient bacterium shuttle plasmid (donor plasmid) carrying exogenous DNA, and the yeast-recipient bacterium shuttle plasmid carrying exogenous DNA is integrated into the host cell genome by inducing the two sets of serine integrases to act respectively, and the backbone sequence of the shuttle plasmid is deleted; after repeated multiple rounds, the non-target DNA fragments on the host cell genome are deleted to achieve the cascade assembly of large fragments of the host genome. The process schematic diagram is shown in Figure 1 .
[0063] In the present invention, first, multiple exogenous DNA fragments of about 30 kb need to be combined with the donor plasmid by yeast. Screening marker 1-attB T -Shuttle plasmid backbone-attP T Recombination forms a donor plasmid; the donor plasmid is transformed into the constructed carrier Integrase expression cassette and its recognition site or In the recipient bacteria I, the expression of Integrase, at this time, the donor plasmid Site and recipient strain Integration or donor plasmid Site and recipient strain Integration, transfer the entire donor plasmid into the recipient strain genome. In order to remove non-target DNA, the recipient strain containing the donor plasmid is transformed with an auxiliary plasmid I that can induce the expression of TG1int integrase, and after induction of expression, attB is integrated T and attP T The sequence between the two, that is, the backbone vector part carried in the donor plasmid is deleted, and the auxiliary plasmid I is removed by non-antibody screening; the donor plasmid can also be transformed into the constructed integrase recognition site or as well as In the recipient bacteria II of the co-expression plasmid of integrase and TG1int integrase (the co-expression plasmid is the auxiliary plasmid II), the expression of Integrase and TG1int integrase, at this time, the donor plasmid Site and recipient strain Integration or donor plasmid Site and recipient strain Integration transfers all of the donor plasmid into the genome of the recipient strain, and then excises the backbone vector portion carried in the donor plasmid under the action of the TG1int integrase. To integrate more exogenous DNA fragments, the donor plasmids containing different or identical exogenous DNAs and the helper plasmids (helper plasmid I or helper plasmid II) are repeatedly transformed to form multi-fragment DNA insertions in the recipient bacteria. If it is necessary to integrate the exogenous DNA fragments inserted multiple times into a larger exogenous DNA without redundant sequences, only the recipient bacteria finally obtained need to be subjected to Red / ET homologous recombination technology and counter-selection to remove the non-target DNA introduced exogenously on the host cell genome.
[0064] In the present invention, the host cell and the recipient bacterium refer to the same thing, and both are bacterial cells that accept the insertion of exogenous DNA fragments into their genomes.
[0065] In the present invention, the recipient bacterium includes but is not limited to one or more of Escherichia coli, Bacillus subtilis, Streptococcus pyogenes, Serratia marcescens, Salmonella, Clostridium, Bifidobacterium, Proteus, Corynebacterium glutamicum, Streptomyces, Actinomyces, Vibrio, Bacteroides or Lactobacillus; the recipient bacterium includes Escherichia coli; preferably, the Escherichia coli includes one or more of GB2005, MG1655, DH5α, BL21, TOP10, JM109, HB101, SCS110, JM110 or Xl1-Blue; in a specific embodiment of the present invention, it is verified that the method of the present invention has a good large-fragment DNA insertion effect on the recipient bacterium GB2005.
[0066] In the present invention, on the recipient bacterium Integrase recognition site or The insertion position on the genome can be any non-essential gene locus; in one or more specific embodiments of the present invention, is integrated into the pseudogene yoeA (Gene ID: 4056042) locus, and this pseudogene is knocked out and replaced.
[0067] In the present invention, the exogenous DNA fragment refers to any nucleic acid sequence of interest, which is DNA derived from any species or artificially synthesized DNA, including (but not limited to) chromosomal DNA of an organism, biosynthetic gene clusters of natural or artificially modified secondary metabolites, and artificially designed and synthesized DNA; including (but not limited to): functional genes, CDS sequences, resistance gene coding sequences, antibiotic biosynthetic gene clusters, secondary metabolite biosynthetic gene clusters, promoter sequences, terminator sequences, replicon sequences, or combinations thereof.
[0068] In the present invention, the selection marker can be any resistance gene expressed in eukaryotic and prokaryotic cells, the coding gene of a fluorescent protein, or a nutritional auxotrophic selection marker; specifically, the selection marker 1 in the present invention is the coding gene of a fluorescent protein, which can achieve positive selection after the donor plasmid is introduced into the recipient bacterium and reverse selection after removing non-target DNA fragments on the genome of the recipient bacterium. It can be red fluorescent protein RFP, green fluorescent protein GFP, cherry red fluorescent protein mCherry, etc. The amino acid sequences of fluorescent proteins have been disclosed in the prior art, and codon optimization can be carried out according to the amino acid sequences and different host cells. The selection marker 2 in the present invention is a nutritional auxotrophic selection marker gene, and its purpose is to screen the donor plasmid; the donor plasmid is recombined in yeast, and when the yeast is tryptophan auxotrophic, the selection marker 2 is TRP. The selection marker 3 in the present invention is a resistance gene, which can be expressed in the host cell and screen for strains in which the donor plasmid is inserted into the host genome. The resistance gene only needs to be able to be expressed in bacteria, such as ampicillin resistance gene, kanamycin resistance gene, chloramphenicol resistance gene, gentamicin resistance gene, tetracycline resistance gene; for the convenience of screening, the selection marker 3 is different during odd-round insertion and even-round insertion; these resistance genes are all well-known in the art. The reverse selection marker 4 in the present invention is rpsL, sacB or pheS, etc. The purpose is to kill the strains carrying this gene when corresponding compounds such as streptomycin, sucrose or p-chlorophenylalanine are added to the culture medium, so as to achieve the purpose of reverse selection. The above selection markers are all well-known in the art.
[0069] In the present invention, the term "expression cassette" refers to a polynucleotide sequence containing a gene to be expressed and a sequence component of elements required for expression. For example, in the present invention, the term " integrase expression cassette" refers to a polynucleotide sequence containing a sequence encoding integrase and a sequence component of elements required for expression. The components required for expression include a promoter and a polyadenylation signal sequence. In addition, the integrase expression cassette may or may not contain other sequences, including (but not limited to): enhancer, secretion signal peptide sequence, etc.
[0070] In the present invention, the The promoter of integrase or TG1int integrase is any suitable promoter capable of driving the expression of these proteins, which can be constitutive or inducible; the specific types of the inducible promoters are different to prevent incorrect recombination; the inducible promoters, such as the arabinose-inducible promoter (PBAD) or the rhamnose-inducible promoter (PRha). These promoters are well-known in the art.
[0071] In the present invention, The recognition sites attP or attB of integrase can be wild-type or mutant-type. The mutant-type sequences can be found in the articles: PNAS, 2000, 97(11):5995–6000; Nucleic Acids Res., 2007, 35(10):3407-3419; Appl Microbiol Biotechnol. 2014, 98(10):4557-4570; Biotechnol.J., 2023, 18:2200411.; In the specific embodiments of the present invention, wild-type sequences are adopted. Specifically, The sequence is: GTAGTGCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGGCGTAG, The sequence is GGGTGCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTA.
[0072] In the present invention, the recognition sites attP or attB of TG1int integrase can be wild-type or mutant-type. The mutant-type sequences can be found in the article: Biotechnol.J., 2023, 18:2200411; In the specific embodiments of the present invention, wild-type sequences are adopted. Specifically, attP T The sequence is: CCAGCCCAACAGTGTTAGTCTTTGCTCTTACCCAGTTGGGCGGG, attB T The sequence is: GATCAGCTCCGCGGGCAAGACCTTCTCCTTCACGGGGTGGAAGGTC.
[0073] In the present invention, the applications include constructing gene recombinant bacteria with large fragment insertions, genomic cloning and genomic library construction, studying gene functions, studying genomic structures and dynamics, constructing organisms containing hybrid genomes, constructing expression strains of metabolic pathways, increasing gene copies to improve the yields of proteins and metabolites, biological information storage, etc.
[0074] The following combines specific embodiments to further elaborate on the present invention. It should be noted that the specific embodiments are explanations rather than limitations of the present invention.
[0075] Example 1: Construction of a Multifunctional Large-Fragment DNA Cascade Integration Vector
[0076] Construct odd-fragment integration vectors (i.e., pBOY) and even-fragment integration vectors (i.e., pBEY) (see Figure 1 -A). The two vectors only differ in the resistance gene. Amplify the pBAC vector fragment from plasmid pBleoBAC11 using the primer pair Homolog-BAC-F / BAC-trp-R, amplify ampR from plasmid pUC19 using the primer pair ampR-F / attP-ampR-R, and anneal and extend the primer pair amp-attP-F / BAC-attB-R to obtain a fragment The linear pBAC vector, ampR, and are subjected to Gibson assembly to obtain a plasmid Amplify the YAC ori fragment from plasmid pCAP01 using the primer pair AvrII-YAC-F / HindIII-TG1P-YAC-R, amplify the p15A-kmR fragment from plasmid p15A-Tn5-kmR-vio (Angewandt Chemie International Edition, 2018, 57(28): 8754 - 8759) using the primer pair YAC-p15A-F / BamHI-km-R. Perform fusion PCR on the two fragments to obtain the product YAC-p15A-kmR, and ligate it with the linearized vector by enzymatic digestion to obtain vector; Amplify the auxotrophic selection marker gene TRP from plasmid pCAP01 using the primer pair NotI-TG1Btrp-F / EcoRI-trp-R, and attB T and attP T sites are added to the primers respectively. Digest the TRP fragment and vector with EcoR I and Not I respectively, and ligate them with T4 DNA ligase to obtain Linearize with Avr II, and perform Gibson assembly with the streptomycin reverse selection marker gene rpsL amplified from plasmid p15A-rpsL-ccdB using the primers amp-rpsl-F and YAC-rpsl-R to obtain vector. Amplify the red fluorescent protein mCherry gene mch from plasmid pcrF19NM2 using NotI-mCherry-F and NotI-mCherry-R, and digest The vector and mch were ligated with T4 DNA ligase to obtain the odd-round fragment integration vector pBOY. The chloramphenicol resistance gene cmR was amplified with the primer pair BAC-cm-F / rpsl-cm-R, and underwent linear-circular recombination with the pBOY vector by the Red / ET method to obtain the even-round fragment integration vector pBEY.
[0077] Example 2: Cloning of large fragment DNA
[0078] This embodiment provides a method for assembling small DNA fragments into large DNA fragments. The starting DNA fragments can be PCR products, synthetic DNA, or DNA fragments from any other source. The steps of assembling PCR products into medium-length DNA of about 30 kb and then into large DNA fragments of about 160 kb are described here. Taking the assembly of Corynebacterium glutamicum ATCC 13032 genomic DNA as an example, contig1 includes the following genes (locus_tag: CYL77_RS00005 to CYL77_RS00795), contig2 includes the following genes (locus_tag: CYL77_RS00795 to CYL77_RS01625), and contig3 includes the following genes (locus_tag: CYL77_RS01625 to CYL77_RS02360). Using primer pairs seg1-frag1-F / seg1-frag1-R, seg1-frag2-F / seg1-frag2-R, seg1-frag3-F / seg1-frag3-R, seg1-frag4 / seg1-frag4-R, seg1-frag5-F / seg1-frag5-R, seg1-frag6-F / seg1-frag6-R, DNA fragments of about 5.5 kb in length of segment1 were amplified from Corynebacterium glutamicum genomic DNA respectively. The p15A-kmR linear vector was amplified using the primer pair Hseg1-p15A-F and Hseg1-km-R. Pac I or Pme I restriction enzyme sites were respectively introduced on both sides of the vector to facilitate subsequent digestion and release of DNA. Six DNA fragments were assembled onto the p15A-kmR vector by the ExoCET method (Nucleic Acids Research, 2018, 46(5): e28) to obtain p15A-kmR-segment1. Similarly, using primer pairs seg2-frag1-F / seg2-frag1-R, seg2-frag2-F / seg2-frag2-R, seg2-frag3-F / seg2-frag3-R, seg2-frag4 / seg2-frag4-R, seg2-frag5-F / seg2-frag5-R, seg2-frag6-F / seg2-frag6-R, DNA fragments of about 5.5 kb in length of segment2 were amplified from Corynebacterium glutamicum genomic DNA respectively. The p15A-kmR linear vector was amplified using the primer pair Hseg2-p15A-F and Hseg2-km-R. Six DNA fragments were assembled onto the p15A-kmR vector by the ExoCET method to obtain p15A-kmR-segment2.In the same way, DNA fragments with a length of about 5.5 kb can be amplified using primers of the corresponding segment (primers starting with seg x amplify segment x, x = 1, 2, 3, 4... n). The p15A-kmR linear vector can be amplified using primers with homologous arms of the corresponding segment. According to requirements, more DNA fragments of about 33 kb can be assembled. In this example, segment 3 - segment 15 are successively assembled onto the p15A-kmR vector to obtain p15A-kmR-segment3, p15A-kmR-segment4,... p15A-kmR-segment15. The constructed plasmid is digested with Pac I or Pme I to release a DNA fragment with a size of about 33 kb.
[0079] In the tryptophan auxotrophic Saccharomyces cerevisiae VL6-48, the above-mentioned DNA fragments of each 5 - 33 kb are assembled into large DNA fragments of about 160 kb and cloned into the cascade integration vector ( Figure 1 -B). Using the odd-fragment integration vector pBOY as a template, two vector fragments contig1-receiver1 and contig1-receiver2 are amplified using the primer pairs seg5H-BAC-F / BAC-trp-R and Amp-YAC-F / seg1H-BAC-R. They are introduced into Saccharomyces cerevisiae VL6-48 together with the enzymatically digested and recovered segment1 - segment5, and the 5 DNA fragments of about 33 kb are assembled into large DNA fragments of about 160 kb to obtain the cascade assembly plasmid pBOY-contig-1 with a size of about 170 kb.
[0080] Using the even-fragment integration vector pBEY as a template, the vector fragments contig2-receiver1 and contig2-receiver2 are amplified using the primer pairs seg10H-BAC-F / cm-BAC-R and cm-YAC-F / seg6H-BAC-R. They are introduced into Saccharomyces cerevisiae VL6-48 together with the enzymatically digested and recovered segment6 - segment10 for assembly to obtain the cascade assembly plasmid pBEY-contig-2.
[0081] Using the odd-fragment integration vector pBOY as a template, two vector fragments contig3-receiver1 and contig3-receiver2 are amplified using seg15H-BAC-F / BAC-trp-R and Amp-YAC-F / seg11H-BAC-R. They are introduced into Saccharomyces cerevisiae VL6-48 together with the enzymatically digested and recovered segment11 - segment15 for assembly to obtain the cascade assembly plasmid pBOY-contig-3.
[0082] According to this method, more DNA fragments of ~33 kb can be assembled into large DNA fragments of ~160 kb according to requirements and cloned onto a cascade integration vector to construct more cascade assembly plasmids pBOY - contig - N (N is odd) and pBEY - contig - M (M is even).
[0083] Example 3: Cascade assembly of large DNA fragments
[0084] This example provides a method for the cascade assembly of large DNA fragments, demonstrating a method for assembling ~160 kb large DNA fragments in three cascade assembly plasmids into ultra - long chromosomal DNA fragments. However, it is not limited to three large DNA fragments, and more large DNA fragments can be assembled into longer chromosomal fragments or even the entire chromosome ( Figure 1 -C). Using this method, ~160 kb large DNA fragments can be successively assembled onto plasmids capable of carrying ultra - long DNA or bacterial chromosomes. In this example, we demonstrate the cascade assembly of the above - mentioned ~160 kb large DNA fragments into ~485 kb ultra - long DNA fragments on the Escherichia coli chromosome.
[0085] This method will integrase and or be simultaneously integrated into the chromosome. After introducing the donor plasmid, the plasmid is first integrated into the chromosome, then the auxiliary plasmid I expressing TG1int integrase is introduced into the bacterium to excise the shuttle plasmid backbone, and then the auxiliary plasmid I is eliminated through antibiotic - free screening, with an efficiency of up to 100%.
[0086] To assemble large DNA fragments on the Escherichia coli chromosome, it is necessary to first introduce the integration site attP. To save subsequent operation time and improve the assembly efficiency, the phage integrase gene controlled by the rhamnose - inducible promoter PRha is simultaneously integrated into the chromosome, and the deoR gene (Gene ID: 945453) is knocked out to improve the efficiency of importing large DNA fragments into Escherichia coli. Using the CcdB counter - selection technology, the rhamnose - inducible integrase gene and Integration site. First, the temperature-sensitive plasmid pSC101-ccdA-gbaA (Nucleic Acids Res. 2014; 42(5): e37) was transferred into Escherichia coli GB2005 to obtain the strain GB2005::pSC101-ccdA-gbaA, in which the Red / ET recombinase system and the ccdA antitoxin gene were induced by rhamnose and arabinose inducible promoters, respectively. The ampR-ccdB fragment was amplified from the plasmid p15A-ccdB-amp using the primer pair Hamp-F / HccdB-R. The upstream and downstream homologous arms of the 60 bp yoeA gene (Gene ID: 4056042) to be inserted were carried at both ends of the fragment. This linear fragment was electrotransformed into GB2005::pSC101-ccdA-gbaA in which the Red recombination system and the CcdA antitoxin protein were induced. Through ampicillin screening, the recombinants with ampR-ccdB integrated into the genome were detected by PCR using the primer pairs chk-amp-F / chk-amp-R and chk-ccdB-F / chk-ccdB-R. The rhamnose operon gene was amplified using the primer pair HPRha-F / Int-PRha-R, and The rhamnose operon gene and the integration site were fused by PCR using the primer pair HPRha-F / HattP-int-R2. The linear fragment was electrotransformed into GB2005::ampR-ccdB + pSC101-ccdA-gbaA in which only the Red / ET recombination system was induced. The plate was cultured in an incubator at 37 °C without antibiotic screening to eliminate ampR-ccdB and the plasmid pSC101-ccdA-gbaA, obtaining the strain GB2005::
[0087] pSC101-ccdA-gbaA was introduced into the strain GB2005:: by electroporation The gentamicin resistance gene gentR was amplified using the primer pair KOdeoR-genta-F / KOdeoR-genta-R. The homologous arms on both sides of the 60 bp deoR gene were carried on both sides of the fragment. This linear fragment was electrotransformed into the strain GB2005:: in which the Red recombination system was induced. The plate was spread with gentamicin resistant plates to obtain the strain GB2005:: in which the deoR gene was knocked out
[0088] Construction of the plasmid pUC57-kmR-PBAD-TG1int of TG1 phage integrase: The plasmid pUC57-kmR-synTG1int was digested and linearized with Nde I and EcoR I. The araC-PBAD and the 5'-end of TG1int were amplified from pSC101-ccdA-gbaA and pUC57-kmR-synTG1int respectively using the primer pairs HPBAD-F / TG1-PBAD-R and PBAD-TG1-F / HTG1-R. The two fragments were fused by overlapping PCR. After purifying the PCR product, it was assembled with the linearized vector pUC57-kmR-synTG1int by Gibson assembly to obtain pUC57-kmR-PBAD-synTG1int.
[0089] Electroporate pBOY-contig-1 into GB2005:: Add 0.2% rhamnose to induce the expression of integrase, enabling the plasmid to be completely integrated into the locus of GB2005, and spread on an LB plate containing 50 μg / mL ampicillin. The plasmid pUC57-kmR-PBAD-synTG1int was introduced into the strain in which pBOY-contig-1 was completely integrated. The expression of TG1int integrase (with its promoter being PBAD) was induced with 0.2% arabinose, and the vector was excised by circularization, and then spread on an LB plate containing 50 μg / mL kanamycin. Colony PCR was used to detect the interfaces on both sides of the integration with the primer pairs AttInt-chk-F / Integration-chk-R and chk-5V-F / AttInt-chk-R, and PCR was used to detect the integrity of the large fragment DNA integration with the primer pairs chk-V1-F / chk-V1-R, chk12-F / chk12-R, chk23-F / chk23-R, chk34-F / chk34-R, chk45-F / chk45-R, chk5V-F / chk5V-R. The primer pair cut-chk-F / Integration-chk-R was used to detect whether the vector was excised by circularization. The detection results showed that the contig was complete and the pBOY vector fragment was excised, which was consistent with the expectation ( Figure 2 ). The clone integrating contig1 lost the plasmid pUC57-kmR-PBAD-synTG1int during subculture in antibiotic-free LB, and the strain GB2005::
[0090] Similarly, electroporate pBEY-contig-2 into GB2005:: Add 0.2% rhamnose to induce Integrase expression enables the plasmid to integrate into the site newly introduced in the previous round of integration. Spread the cells on an LB plate containing 20 μg / mL chloramphenicol. Transfer the pUC57-kmR-PBAD-synTG1int plasmid into the strain with complete integration of pBEY-contig-2. Induce the expression of TG1 integrase with 0.2% arabinose, excise the vector by circularization, and spread the cells on an LB plate containing 50 μg / mL kanamycin. Use the primer pairs AttInt-chk-F / Integration-chk-R and chk-10V-F / AttInt-chk-R to perform PCR detection on the interfaces on both sides of the integration, and use the primer pairs chk12-F / chk12-R, chk23-F / chk23-R, chk34-F / chk34-R, chk45-F / chk45-R, chk67-F / chk67-R, chk78-F / chk78-R, chk89-F / chk89-R, chk910-F / chk910-R, chk10V-F / chk10V-R to perform PCR detection on the integrity of the large fragment DNA integration. Use the primer pair cut-chk-F / Integration-chk-R to detect whether the vector has been circularly excised. At the same time, use the primer pair chk-5V-F / chk-V6-R to detect the integration at the junction of contig1 and contig2. The detection results show that contig1 and contig2 are complete and the pBEY vector fragment has been excised, which is consistent with the expectation ( Figure 3 ). The successfully integrated clones were passaged in antibiotic-free LB to lose the pUC57-kmR-PBAD-synTG1int plasmid, and the strain GB2005::
[0091] Similarly, electrotransform pBOY-contig-3 into GB2005:: Add rhamnose to induce integrase expression, enabling the plasmid to integrate into the site newly introduced in the previous round of integration. Loci, spread on LB plates containing 50 μg / mL ampicillin. Transfer the pUC57-kmR-PBAD-synTG1int plasmid into the strain with complete integration of pBOY-contig-3, induce the expression of TG1int integrase with arabinose, excise the vector, and spread on LB plates containing 50 μg / mL kanamycin. Use primer pairs AttInt-chk-F / Integration-chk-R and chk-15V-F / AttInt-chk-R to perform PCR detection on the interfaces on both sides of the integration, and use primer pairs chk12-F / chk12-R, chk23-F / chk23-R, chk34-F / chk34-R, chk45-F / chk45-R, chk5V-F / chk-V6-R, chk67-F / chk67-R, chk78-F / chk78-R, chk89-F / chk89-R, chk910-F / chk910-R, chk1112-F / chk1112-R, chk1213-F / chk1213-R, chk1314-F / chk1314-R, chk1415-F / chk1415-R, chk15V-F / chk15V-R to perform PCR detection on the integrity of the large fragment DNA integration. Use primer pair cut-chk-F / Integration-chk-R to detect whether the vector has been excised, and at the same time use primer pair chk-10V-F / chk-V11-R to detect the integrity of the junction between seg10 and seg11. The detection results show that contig1, contig2, and contig3 are complete and the pBOY vector fragment has been excised, which is consistent with the expectation( Figure 4 ). The successfully integrated clones lost the pUC57-kmR-PBAD-synTG1int plasmid during subculture in antibiotic-free LB to obtain the strain GB2005::
[0092] Through the above three-step continuous integration, a ~485 kb ultra-long chromosomal DNA fragment was assembled and integrated onto the genome of Escherichia coli GB2005, and the assembly efficiency was close to 100%. One disadvantage of this method is that each round of integration will leave a redundant This redundant sequence can be removed using the Red / ET multiple homologous recombination technology and the counter-selection technology (Nucleic Acids Research, 2020, 48(22): e130).
[0093] Example 4: Cascade assembly of large fragment DNA
[0094] This example also provides a second assembly method, that is, The recognition site of the integrase or integrated into the chromosome of the recipient bacterium, and the integrase and TG1int integrase were simultaneously constructed on a plasmid for co-expression. After introducing the donor plasmid, the plasmid was first integrated and then the plasmid backbone was excised ( Figure 1 -D). This method does not require the elimination of the helper plasmid. The donor plasmid for the next round of integration can be directly introduced to achieve cascade assembly, which can save time, but the overall efficiency is only about 30%.
[0095] An integration site was first introduced into the Escherichia coli chromosome and the deoR gene (Gene ID: 945453) was knocked out to improve the efficiency of large fragment DNA introduction into Escherichia coli. The CcdB counter-selection technology was used to insert an integration site into the Escherichia coli GB2005 genome. First, the temperature-sensitive plasmid pSC101-ccdA-gbaA was transferred into Escherichia coli GB2005 to obtain the strain GB2005::pSC101-ccdA-gbaA, in which the Red / ET recombinase system and the ccdA antitoxin gene were induced to express by rhamnose and arabinose inducible promoters respectively. The ampR-ccdB fragment was amplified from the plasmid p15A-ccdB-amp using the primer pair Hamp-F / HccdB-R. Each end of the fragment carried 60 bp upstream and downstream homologous arms of the yoeA gene (Gene ID: 4056042) at the insertion site. This linear fragment was electrotransformed into GB2005::pSC101-ccdA-gbaA in which the Red recombination system and the CcdA antitoxin protein were induced to express. Through ampicillin screening, the recombinants with ampR-ccdB integrated into the genome were detected by PCR using the primer pairs chk-amp-F / chk-amp-R and chk-ccdB-F / chk-ccdB-R. The linear fragment with homologous arms was amplified using the primer pair HattP-F / HattP-R and electrotransformed into GB2005::ampR-ccdB + pSC101-ccdA-gbaA- in which only the Red / ET recombination system was induced. No antibiotics were added to the plate and it was cultured in an incubator at 37 °C to eliminate ampR-ccdB and the plasmid pSC101-ccdA-gbaA, obtaining the strain GB2005:: The gentamicin resistance gene gentR was amplified using the primer pair KOdeoR-genta-F / KOdeoR-genta-R. 60 bp homologous arms on both sides of the deoR gene were respectively carried on both sides of the fragment. This linear fragment was electrotransformed into the strain GB2005:: Among them, a gentamicin-resistant plate was coated to obtain the strain GB2005:: in which the deoR gene was knocked out.
[0096] Construction of the co-expression plasmid of integrase and TG1int integrase: The p15A-kmR linear vector was amplified with the primer pair TG1-p15A-F / BAD-km-R, araC-PBAD was amplified with the primer pair km-BAD-F / int-BAD-R, and was amplified with the primer pair BAD-int-F / HTG1-phiC31int-R. TG1int was amplified from the plasmid pUC57-kmR-PBAD-synTG1int with the primer pair HphiC31-TG1int-F / p15A-TG1-R. The PCR products were recovered and assembled using the ExoCET method to obtain which is the auxiliary plasmid II. The auxiliary plasmid II was introduced into the strain GB2005:: Among them, an LB plate containing 50 μg / mL kanamycin was coated to obtain the strain GB2005::
[0097] pBOY-contig-1 was electrotransformed into GB2005:: Among them, an LB plate containing 0.2% arabinose, 50 μg / mL ampicillin, and 50 μg / mL kanamycin was coated. Arabinose in the plate would induce the sequential expression of integrase and TG1int integrase, integrate the plasmid pBOY-contig-1 into the genome of the donor bacterium, and then excise the shuttle plasmid backbone to obtain the strain GB2005:: Similarly, pBEY-contig-2 was electrotransformed into GB2005:: Among them, an LB plate containing 0.2% arabinose, 50 μg / mL ampicillin, and 50 μg / mL kanamycin was coated to obtain the strain GB2005:: The interfaces on both sides of the integration were detected by PCR using the primer pairs AttInt-chk-F / Integration-chk-R and chk-10V-F / AttInt-chk-R. The integrity of the large fragment DNA integration was detected by PCR using the primer pairs chk12-F / chk12-R, chk23-F / chk23-R, chk34-F / chk34-R, chk45-F / chk45-R, chk5V-F / chk-V6-R, chk67-F / chk67-R, chk78-F / chk78-R, chk89-F / chk89-R, chk910-F / chk910-R. Whether the vector was circularly excised was detected by the primer pair cut-chk-F / Integration-chk-R. The detection results showed that contig1 and contig2 were complete and the vector backbone was excised, which was consistent with the expectation. Figure 5 ) Each round of integration leaves a redundant segment on the genome. This redundant sequence can be removed using the Red / ET multiple homologous recombination technology and the counter-selection technology (Nucleic Acids Research, 2020, 48(22): e130). However, if the TG1int integrase first circularly excises the vector backbone, the large fragment DNA will not be able to integrate into the genome. Therefore, although the operation process of this method is more convenient than the first assembly method, the efficiency of the simultaneous circular excision of the large fragment DNA integration and the vector is only about 30%. Therefore, only two rounds of integration were attempted in this example.
[0098] The primers used in the present invention and their polynucleotide sequences are shown in Table 1 below:
[0099] Table 1
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art can still modify the technical solutions described in the foregoing embodiments or perform equivalent replacements for some of the technical features. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.
Claims
1. A method for inserting a large DNA fragment into a bacterial genome, characterized in that: include: S1: Construct a recipient bacterium containing the φC31int integrase expression cassette and its recognition site attPφ or attBφ. S2: Transform the donor plasmid containing the recognition site of φC31int integrase, the recognition site of TG1int integrase, and the exogenous DNA fragment into the recipient bacteria in S1 to induce recombination, thereby integrating the exogenous DNA fragment into the genome of the host cell; S3: Inducing expression of the auxiliary plasmid I containing TG1int integrase in the host cell in which the exogenous DNA fragment obtained in S2 is integrated into the genome, thereby obtaining a host cell in which the shuttle plasmid skeleton is removed; S4: Repeat steps S2-S3 for multiple rounds to obtain host cells with multiple fragments inserted; or, S1': construct a recipient bacterium containing the φC31int integrase recognition site attPφ or attBφ, S2': Introduce the auxiliary plasmid II containing φC31int integrase and TG1int integrase genes into the recipient bacteria obtained in S1'; Among them, attPφ and attBφ are the recognition sites of φC31int integrase, attB T and attP T It is the TG1int integrase recognition site; The donor plasmid includes a series of attPφ, attBφ, a screening marker 1, attB T , shuttle plasmid backbone, attP T , foreign DNA fragments; S3': transforming the recipient bacteria obtained in S2' with a donor plasmid containing the recognition site of φC31int integrase, the recognition site of TG1int integrase, and the exogenous DNA fragment, inducing recombination, thereby integrating the exogenous DNA fragment into the genome of the host cell and removing the shuttle plasmid backbone; S4': Repeat steps S2'-S3' for multiple rounds to obtain host cells with multiple fragments inserted; The screening marker 1 is a fluorescent protein encoding gene; In step S4 or S4', the multiple rounds of repetition are divided into odd-numbered rounds and even-numbered rounds, wherein the donor plasmids used in the odd-numbered rounds and the even-numbered rounds have different screening resistance in the host cells, and the sequences of the exogenous DNA fragments are the same or different; The odd-numbered round fragment integration vector is pBAC-attPφ-attBφ-mch-attBT-ampR-rpsL-YAC-attPT-p15A-kmR; The even-numbered round fragment integration vector is pBAC-attPφ-attBφ-mch-attBT-cmR-rpsL-YAC-attPT-p15A-kmR; The fragment attPφ-attBφ was obtained by annealing and extending with the primer pair amp-attP-F / BAC-attB-R; The amp-attP-F nucleotide sequence is CCTAGGGGATCCAACCCAGCCCGCCTAATGAGCGTAGTGCCCCAACTGGGGTAACCTTTG AGTTCTCTCAGTTGGGGGCG TAGGCATGCG; The BAC-attB-R nucleotide sequence is TTCATTAGGTTGTTCTGTCCGAATTCGCGGCCGCTACGCGCCCGGGGAGCCCAAGGGCACG CCCTGGCACCCGCATGCCTACGCCCCCAAC; The exogenous DNA fragment is ≥30kb.
2. A method for inserting a large DNA fragment into a bacterial genome as claimed in claim 1, characterized in that: The method further comprises: S5: Red / ET homologous recombination technology and reverse screening are used in the host cells obtained in S4 to remove non-target DNA introduced exogenously on the host cell genome and achieve large fragment insertion.
3. A method for inserting a large DNA fragment into a bacterial genome as claimed in claim 1, characterized in that: The recipient bacteria include Escherichia coli; The Escherichia coli includes GB2005, MG1655, DH5α, BL21, TOP10, JM109, HB101, SCS110, JM110 or Xl1-Blue.
4. A method for inserting a large DNA fragment into a bacterial genome as claimed in claim 1, characterized in that: The exogenous DNA fragment is ≥60kb.
5. A method for inserting a large DNA fragment into a bacterial genome as claimed in claim 1, characterized in that: The exogenous DNA fragment is ≥90kb.
6. A method for inserting a large DNA fragment into a bacterial genome as claimed in claim 1, characterized in that: The exogenous DNA fragment is ≥130kb.
7. A method for inserting a large DNA fragment into a bacterial genome as claimed in claim 1, characterized in that: The exogenous DNA fragment is ≥150kb.
8. A method for inserting a large DNA fragment into a bacterial genome as claimed in claim 1, characterized in that: The exogenous DNA fragment is ≥300kb.
9. A method for inserting a large DNA fragment into a bacterial genome as claimed in claim 1, characterized in that: The exogenous DNA fragment is ≥450kb.
10. A method for inserting a large DNA fragment into a bacterial genome as claimed in claim 1, characterized in that: The exogenous DNA fragment is ≥700kb.
11. A method for inserting a large DNA fragment into a bacterial genome as claimed in claim 1, characterized in that: The exogenous DNA fragment is ≥1000kb.
12. A method for inserting a large DNA fragment into a bacterial genome as claimed in claim 1, characterized in that: The exogenous DNA fragments are derived from DNA of any species or artificially synthesized DNA, and the exogenous DNA fragments include chromosomal DNA of organisms, biosynthetic gene clusters of natural or artificially modified secondary metabolites, or artificially designed and synthesized DNA.
13. A system for inserting large DNA fragments into bacterial genomes, characterized in that The system comprises a donor plasmid, a helper plasmid I and a recipient bacterium I, or the system comprises a donor plasmid, a helper plasmid II and a recipient bacterium II; The donor plasmid comprises attPφ, attBφ, screening marker 1, attB T , shuttle plasmid backbone, attP T , foreign DNA fragments; The attPφ is directly connected to attBφ; Among them, attPφ and attBφ are the recognition sites of φC31int integrase, attB T and attP T It is the TG1int integrase recognition site; The shuttle plasmid skeleton includes a yeast replication start site and a screening marker 2, a recipient bacteria replication start site and a screening marker 3, and a reverse screening marker 4; The auxiliary plasmid I includes an expression cassette of TG1int integrase; The auxiliary plasmid II includes expression cassettes of φC31int integrase and TG1int integrase; The recipient bacteria I contains a φC31int integrase expression cassette and its recognition site attPφ or attBφ; The receptor bacteria II contains φC31int integrase recognition site attPφ or attBφ.
14. A kit, characterized in that: Includes the system of claim 13.
15. Use of the method according to any one of claims 1 to 12, the system according to claim 13 or the kit according to claim 14, characterized in that: The applications include any one or more of constructing gene-recombinant bacteria with large-fragment insertions, genome cloning and constructing genome libraries, studying gene functions, studying genome structure and dynamics, constructing organisms containing hybrid genomes, constructing expression strains of metabolic pathways, constructing recombinant bacteria with increased gene copy numbers to increase the production of proteins and metabolites, and constructing biological information storage bodies.
Citation Information
Patent Citations
Escherichia coli strain for recombined engineering
CN101633901A
In-vitro gene stacking technology compatible with recombinase-mediated in-vivo gene stacking and application of in-vitro gene stacking technology
CN105112440A
Method for the introduction of genetic information in cell by site-specific integration system
US20220025406A1