Use of ssb7 gene to improve yield of cellulase in filamentous fungi

By inactivating the ssb7 gene of Trichoderma reesei using CRISPR-Cas9 editing technology, the problem of hyphal entanglement and adhesion in Trichoderma reesei liquid culture was solved, enabling more efficient cellulase production and reducing production costs.

CN118813720BActive Publication Date: 2025-12-19SHANDONG UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202411021691.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-07-29
Publication Date
2025-12-19
Estimated Expiration
2044-07-29

AI Technical Summary

Technical Problem

In existing technologies, Trichoderma reesei exhibits long filaments in liquid culture, causing the mycelia to coil and stick together, which affects the transfer of nutrients and oxygen during fermentation. Furthermore, high stirring intensity can damage the mycelia, increasing production costs and not significantly improving cellulase yield.

Method used

By inactivating the ssb7 gene of Trichoderma reesei using CRISPR-Cas9 editing technology, the hyphae become shorter and more branched. By inactivating or reducing the expression level of the ssb7 gene, the efficiency of cellulase production can be improved.

Benefits of technology

Achieving higher levels of cellulase production at lower stirring speeds reduces production costs and increases cellulase yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118813720B_ABST
    Figure CN118813720B_ABST
Patent Text Reader

Abstract

The application discloses application of an ssb7 gene in improving cellulase yield of filamentous fungi and belongs to the field of genetic engineering and biotechnology. Gene editing is respectively performed on two strains of Trichoderma reesei (a strain QMP and a strain h61), a codon for aspartic acid at the 616th position in the ssb7 gene is mutated into a stop codon, two mutant strains with inactivated ssb7 genes are obtained, and it is found through experiments that cellulase yield levels of the two mutant strains under the same conditions are significantly improved compared with the strain without mutation. The mutant strain obtained by inactivation of the ssb7 gene not only has shorter mycelium length, more mycelium branches and significantly increased mycelium amount, but also can realize higher level cellulase production in a fermenter with a lower stirring speed, and has great application value.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering and biotechnology, in particular to the application of ssb7 gene in improving the yield of cellulase of filamentous fungi. BACKGROUND

[0002] Biomass is the only renewable resource on earth that can be used on a large scale, of which more than 80% is lignocellulose. Rational use of cellulose and hemicellulose in lignocellulose has immeasurable value for relieving energy crisis, environmental pollution and maintaining the sustainable development of the world economy. However, the stable structure of lignocellulose makes it difficult to be efficiently utilized by organisms. Lignocellulose-degrading enzyme system can degrade lignocellulose into oligosaccharides or monosaccharides, and then produce fuels and chemicals through biological transformation, which provides an effective way for the resource utilization of lignocellulose.

[0003] Trichoderma reesei can secrete a large amount of lignocellulose-degrading enzyme system into the extracellular space, and has attracted a lot of attention in lignocellulose bioconversion. However, due to the fact that the Trichoderma reesei without morphological modification presents filamentous shape in liquid culture, the mycelium is coiled and adhered, resulting in a highly viscous state of the culture medium, which is not conducive to the transfer of nutrients and oxygen in the fermentation process, and thus is not conducive to cellulase production. In order to improve the mixing efficiency of substances and the dissolved oxygen level in the fermenter, a higher stirring speed and aeration rate can be provided. However, high stirring force will cause shear and damage to the mycelium, affecting enzyme production, and in addition, high-power fermentation operation mode will greatly increase the cost of enzyme production. Therefore, rational genetic modification of the mycelial morphology of Trichoderma reesei can inhibit the formation of filamentous morphology without affecting cell growth, which can promote the mass transfer and oxygen supply in the liquid fermentation process and improve the yield of cellulase. In addition, increasing the branching of mycelium and the number of mycelial tips can also improve the protein secretion capacity of filamentous fungi.

[0004] Not all morphological modifications that inhibit filamentous growth and increase hyphal branching are beneficial to the improvement of extracellular protein production of filamentous fungi. For example, inactivation of the racA gene in A. niger increases hyphal branching, significantly improves glucoamylase production, but does not change the total extracellular protein production (Fiedler, et al. Microb Cell Fact 2018, 17:95). Inactivation of the homologous gene rac1 of racA in T. reesei makes the hyphae short and branched, but does not increase the production of cellulase when the fermentation is carried out under the condition of glucose and cellulose (Fitz, et al. Fungal Biol Biotechnol 2019, 6:16). In G. virens, inactivation of the gul-1 gene makes the mycelial mass smaller, the viscosity of the fermentation broth decreases, and the production of extracellular beta-glucosidase increases, but the production of endoglucanase remains unchanged (Lin, et al. Microb Cell Fact 2018, 17:96). These results all show that the change of hyphal morphology does not necessarily lead to the improvement of the production of all kinds of extracellular proteins.

[0005] Therefore, it is necessary to develop a method for improving the production of cellulase while improving the morphology of hyphae, so as to reduce the cost of ventilation, stirring and time of liquid fermentation for producing cellulase, so as to meet the demand for low-cost cellulase for lignocellulose degradation and conversion. SUMMARY

[0006] The purpose of the present application is to provide the application of ssb7 gene in improving the cellulase production rate of filamentous fungi, so as to solve the problems existing in the prior art. The mutant strain obtained by inactivating the ssb7 gene not only has shorter hyphae, more hyphal branches and significantly increased hyphal amount, but also can realize higher level of cellulase production in a fermentation tank with lower stirring speed, which has great application value.

[0007] To achieve the above purpose, the present application provides the following scheme:

[0008] The present application provides the application of ssb7 gene or related biological materials in improving the enzyme production efficiency of Trichoderma reesei, inactivates or reduces the expression amount of the ssb7 gene, and the enzyme production efficiency of Trichoderma reesei is improved;

[0009] The nucleotide sequence of the ssb7 gene is shown in SEQ ID NO. 15, and the amino acid sequence of the protein encoded by the ssb7 gene is shown in SEQ ID NO. 16;

[0010] The related biological materials include recombinant vectors and recombinant bacteria that can inactivate or reduce the expression amount of the ssb7 gene.

[0011] The enzyme is an enzyme involved in cellulose hydrolysis.

[0012] The application also provides a method for improving the enzyme production efficiency of Trichoderma reesei, comprising the step of inactivating or reducing the expression of the ssb7 gene of the Trichoderma reesei, so that the enzyme production efficiency of the Trichoderma reesei is improved; the enzyme is an enzyme involved in cellulose hydrolysis.

[0013] Further, the method for inactivating or reducing the expression of the ssb7 gene of the Trichoderma reesei comprises knocking out the ssb7 gene by using CRISPR-Cas9 editing technology.

[0014] Further, the knockout is to mutate the codon of the aspartic acid at position 616 in the ssb7 gene coding the amino acid sequence shown in SEQ ID NO. 16 into a stop codon.

[0015] The application also provides a Trichoderma reesei with high enzyme production efficiency, which is obtained by the following preparation method:

[0016] The ssb7 gene of the Trichoderma reesei is inactivated or the expression thereof is reduced by using CRISPR-Cas9 editing technology, so that the Trichoderma reesei with high enzyme production efficiency is obtained.

[0017] The enzyme is an enzyme involved in cellulose hydrolysis.

[0018] Further, the inactivation of the ssb7 gene comprises mutating the codon of the aspartic acid at position 616 in the ssb7 gene coding the amino acid sequence shown in SEQ ID NO. 16 into a stop codon.

[0019] The application also provides a method for using the Trichoderma reesei with high enzyme production efficiency, which comprises the step of using the Trichoderma reesei with high enzyme production efficiency to ferment and produce enzymes; the enzyme is an enzyme involved in cellulose hydrolysis.

[0020] The application discloses the following technical effects:

[0021] The application edits two strains of Trichoderma reesei (strain QMP and strain h61) respectively, mutates the codon of aspartic acid at position 616 in the ssb7 gene into a stop codon, obtains two mutant strains with inactivated ssb7 genes, and finds through experiments that the average enzyme production of the two mutant strains under the same conditions is significantly improved compared with that of the strains without mutation.

[0022] The mutant strain obtained by inactivating the ssb7 gene has shorter mycelium, more mycelium branches and significantly increased mycelium amount, and can realize higher level of cellulase production in a fermentation tank with lower stirring speed, and has great application value. BRIEF DESCRIPTION OF DRAWINGS

[0023] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the accompanying drawings needed in the embodiments will be briefly introduced as follows. Obviously, the accompanying drawings in the following description only only some embodiments of the present application, and for those skilled in the art, other drawings can be obtained without creative labor based on these drawings.

[0024] Figure 1 Schematic diagram for knocking out target gene ssb7 by CRISPR-Cas9 editing technology;

[0025] Figure 2 PCR identification nucleic acid electrophoresis map for knocking out target gene ssb7 by CRISPR-Cas9 editing technology;

[0026] Figure 3 Morphology of Trichoderma reesei gene ssb7 inactivation mutant strain ssb7-616 and starting strain QMP under liquid culture condition with glucose as the only carbon source, observed under field emission scanning electron microscope;

[0027] Figure 4 Biomass of Trichoderma reesei gene ssb7 inactivation mutant strain ssb7-616 and starting strain QMP in culture system under condition with glucose as the only carbon source;

[0028] Figure 5 Filter paper enzyme activity of fermentation supernatant of Trichoderma reesei gene ssb7 inactivation mutant strain ssb7-616 and starting strain QMP under different conditions with cellulose as the only carbon source, wherein A is filter paper enzyme activity of fermentation supernatant under the condition of liquid volume 250 mL and rotation speed 200 rpm, and B is filter paper enzyme activity of fermentation supernatant under the condition of liquid volume 100 mL and rotation speed 100 rpm;

[0029] Figure 6 Fermentation performance of control strain h61-b7 (A) and Trichoderma reesei gene ssb7 inactivation mutant strain hssb7-616 (B) under fed-batch fermentation in a 3L fermenter. DETAILED DESCRIPTION

[0030] The various exemplary embodiments of the present application will now be described in detail, which should not be considered as limiting the present application, but should be understood as a more detailed description of some aspects, characteristics and embodiments of the present application.

[0031] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of, for example, concentrations, solvent amounts, and the like, there are intended to be included in the present application each and every intermediate value and sub-range of this range of values. For example, a range of "1-10" is intended to include each and every intermediate value and sub-range of this range of values, i.e. the range "1-6.9", or "2.3-4.7", or "3.0-3.5", etc. The upper and lower limits of these smaller ranges can independently be included or excluded in the ranges.

[0032] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not an admission that it is prior art with respect to the present application.

[0033] Many modifications and variations of the present application described in the specific embodiments of the application can be made by those skilled in the art without departing from the spirit or scope of the application. Other implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The specification and examples given are exemplary only.

[0034] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed material or step.

[0035] The following specific examples illustrate the method of inactivating ssb7 gene in Trichoderma reesei to improve cellulase production. In practical applications, the starting fungus to be modified is not limited to Trichoderma reesei, but also includes Trichoderma harzianum, Trichoderma viride, Trichoderma longibrachiatum, Trichoderma guizhouense, Penicillium oxalicum, Penicillium funiculosum, Penicillium chrysogenum, Aspergillus niger, Aspergillus oryzae, Aspergillus fumigatus, Aspergillus aculeatus, Myceliopthora thermophila, and Humicola insolens, etc.

[0036] The following specific examples illustrate the method of mutating the codon of aspartate at position 616 in the ssb7 gene of Trichoderma reesei to a stop codon by gene editing to improve cellulase production. In practical applications, various conventional molecular biology means can also be used to inactivate or down-regulate the ssb7 gene by completely knocking out, partially knocking out, introducing mutations at other positions, replacing promoters, or gene silencing, etc. without relying on gene editing.

[0037] The following specific examples illustrate the method for improving the production of cellulase. Cellulase is a general term for proteins that catalyze the degradation of lignocellulose. In practical applications, this method can also be used to improve the production of enzymes involved in lignocellulose degradation, such as beta-glucanase, beta-glucosidase, or xylanase.

[0038] General description:

[0039] Culture medium and stock solution used in the examples:

[0040] Basic medium (per L): glucose 20 g, (NH4)2SO4 5 g, KH2PO4 15 g, MgSO4·7H2O 0.6 g, CaCl2 0.6 g, peptone 2 g, 10000x trace element stock solution 100 μL, add 2% (w / v) agar powder when solidifying, sterilize at 115°C for 30 min.

[0041] 10000x trace element stock solution (per L): FeSO4·7H2O 50 g, MnSO4·H2O 17 g, ZnSO4·2H2O 14 g, CoCl2·6H2O 20 g.

[0042] Sporulation medium (PDA): weigh 200 g of peeled potatoes, cut into small pieces, add no more than 1 L of water and boil for 30 min, filter through 8 layers of gauze, add 20 g of glucose to the filtrate, make up to 1 L, add 2% (w / v) agar powder, sterilize at 115°C for 30 min.

[0043] In the examples, the uracil-deficient strain was cultured, and 1 g / L of uracil was added when preparing the above culture medium.

[0044] Reagents used in the examples:

[0045] Nanjing Novozyme Company Max Super-Fidelity DNA Polymerase, 2x Taq MasterMix; Sigma cell wall lysing enzymes; OMEGA agarose gel recovery kit; Dingguochangsheng Biotechnology Co., Ltd. GoldviewTM nucleic acid dye; PAGE gel rapid preparation kit (Shanghai Yezheng Biotechnology Co., Ltd.); PrimeScript RT reagent Kit With gDNA Erase kit (Takara); SYBR Ex Taq II reagent (Takara). Other conventional biochemical reagents were purchased from National Pharmaceutical Group Chemical Reagent Co., Ltd. and other units.

[0046] The DNA fragment PCR amplification technology used in the present application is based on the high-fidelity Max Super-Fidelity DNA Polymerase of Novozyme Company. The instructions of MaxSuper-Fidelity DNA Polymerase were used to prepare the reaction system and set the amplification program; the DNA purification and recovery were performed according to the instructions of the OMEGA gel recovery kit; the method for extracting the Trichoderma reesei genomic DNA and the filter paper enzyme activity determination method are conventional technical means in the art, and are not the invention points, and are not described here.

[0047] The present application uses conventional techniques and methods in the fields of genetic engineering, molecular biology and gene editing. Those skilled in the art can use other conventional techniques, methods and reagents in the art on the basis of the embodiments provided by the present application, without being limited by the specific embodiments of the present application.

[0048] The Trichoderma reesei QMP used in the examples is a uracil auxotrophic strain obtained by knocking out the pyr4 gene in Trichoderma reesei QM9414 (American Type Culture Collection accession number ATCC 26921). This strain has been disclosed in the granted patent "CN 113528492 B A method for recycling lignocellulose hydrolysate for fermentation to produce cellulase liquid", and is preserved by the State Key Laboratory of Microbial Technology of Shandong University.

[0049] The strain h61 is a high-yield cellulase strain constructed by genetic modification of the transcriptional regulation system and cellulase composition of the QMP strain. The strain has the preservation number CGMCC NO.23207, and is disclosed in the granted patent "CN 113528492 B A method for recycling lignocellulose hydrolysate for fermentation to produce cellulase liquid".

[0050] The psgRNA-Tr plasmid and its construction method have been disclosed in the non-patent literature "CRISPR / Cas9-mediated genome editing in Penicillium oxalicum and Trichoderma reesei. DOI: 10.1007 / s10529-020-03024-7".

[0051] The content of the present application will be specifically described below in combination with examples.

[0052] Example 1 Construction of sgRNA recombinant expression vector and donor DNA of Trichoderma reesei ssb7 gene inactivation mutant strain

[0053] The construction method of the sgRNA recombinant expression vector is as follows:

[0054] The gene of interest is inactivated using CRISPR gene editing tool. A spacer sequence GATCCAATTGACGAGTCGGG (SEQ ID NO. 1) of the gene of interest is designed with CHOPCHOP software (https: / / chopchop.cbu.uib.no / ). The primer pair 5SgRNA-F1 / Spacer-ssb7-R1 and Spacer-ssb7-F2 / 5SgRNA-R2 are used to amplify the upstream promoter sequence and downstream backbone sequence of sgRNA in psgRNA-Tr plasmid respectively, and the spacer sequence is introduced as a homologous arm at the end of both fragments. The two fragments are ligated to the plasmid pFC330 (Addgene plasmid #87842) containing Cas9 coding gene expression cassette digested with PacI by one-step cloning. The ligation product is transformed into E. coli DH5α and cultured at 37°C for 16 h. The plasmid is extracted and sequenced to select the correct plasmid with sgRNA expression cassette, and the sgRNA recombinant expression vector is obtained.

[0055] The method for constructing donor DNA is as follows:

[0056] The primer pair Donor-ssb7-F1 / Donor-ssb7-R1 and Donor-ssb7-F2 / Donor-ssb7-R2 is used to amplify the upstream and downstream fragments of the gene ssb7 mutation site using the chromosomal DNA of QMP strain as template, and the upstream and downstream fragments carry a specific homologous arm of 24 bp in size containing a stop codon. The upstream and downstream fragments of the gene mutation site are connected by fusion PCR, and a 24 bp specific sequence is inserted between the connected upstream and downstream fragments. After obtaining the fusion fragment, Cs-ssb7-F / Cs-ssb7-R is used for PCR with the fusion fragment as template to obtain the donor DNA, which is purified and recovered.

[0057] The primer sequences used in the above amplification process are as follows (5' to 3'):

[0058] 5SgRNA-F1: GTTTCCGCTGAGGGTTTAATCACATACGACCATATCCATT (SEQ ID NO. 2),

[0059] Spacer-ssb7-R1: CCCGACTCGTCAATTGGATCGGTGTTTCGTCCTTTCATAC (SEQ ID NO. 3),

[0060] Spacer-ssb7-F2:GATCCAATTGACGAGTCGGGGTTTTAGAGCTAGAAATAGC (SEQ ID NO.4),

[0061] 5SgRNA-R2:CTGTCTCGGCTGAGGTCTTAATAAAAAAGCACCGACTCGG (SEQ ID NO.5),

[0062] Donor-ssb7-F1:TGGGTCCAGACGTCGCACGTCCTG (SEQ ID NO.6),

[0063] Donor-ssb7-R1:CTAGGCTCACTCGAGTCACTATCATAGCCATGAGTTTTGGATTCCTC(SEQ IDNO.7),

[0064] Donor-ssb7-F2:TGATAGTGACTCGAGTGAGCCTAGCTCAACAGCGTCGTCTGTACAC T(SEQ IDNO.8),

[0065] Donor-ssb7-R2:CCAGCACGGCATCCGCATCCAGA (SEQ ID NO.9),

[0066] Cs-ssb7-F:TGCATCTCGTCAGGCCTCAGTT (SEQ ID NO.10),

[0067] Cs-ssb7-R:AGCCACCCTTGGGATGCACAAG (SEQ ID NO. 11).

[0068] Example 2: In vivo mutation of gene ssb7 using Trichoderma reesei laboratory strain QMP as the starting strain

[0069] The sgRNA recombinant expression vector obtained in Example 1 and the donor DNA ( Figure 1 The ssb7 gene was in situ sequence edited by introducing it into the QMP strain via protoplast transformation. The specific experimental method is described in the literature "ACRISPR-Cas9 System for Genetic Engineering of Filamentous Fungi.DOI:10.1371 / journal.pone.0133085".

[0070] 1. The reagent formulation used in this embodiment

[0071] Protoplast transformation buffer:

[0072] Transformation solution S1: 1.2M sorbitol, 0.1M KH2PO4, pH adjusted to 8.0.

[0073] Transformation solution S2: 1M sorbitol, 50mM CaCl2, 10mM Tris-HCl, pH adjusted to 7.5.

[0074] Transformation solution S3: 25% (w / v) PEG6000, 50mM CaCl2, 10mM Tris-HCl, pH adjusted to 7.5.

[0075] The above transformation buffers need to be sterilized for standby use.

[0076] Transformation upper medium ( / L): sorbitol 182g, glucose 10g, trisodium citrate dihydrate 3g, (NH4)2SO46g, MgSO4·7H2O 1g, KH2PO410g, agarose 0.6%, 10000x trace element stock solution 100μL. Sterilized at 115°C for 30min.

[0077] Transformation lower medium ( / L): glucose 10g, trisodium citrate dihydrate 3g, (NH4)2SO46g, MgSO4·7H2O 1g, 1.2% (w / v) agar powder, 10000x trace element stock solution 100μL. Sterilized at 115°C for 30min.

[0078] 2. Preparation of protoplasts

[0079] (1) Pour PDA plate, and after it solidifies, lay a layer of glass paper (sterilized) on it, then take 100μL of fresh spore suspension (about 10 7 spores) and add to the glass paper, evenly spread, and then incubate at 30°C for 12-15h. When mycelium grows on the glass paper, the glass paper changes from transparent to translucent.

[0080] (2) Preparation of mycelium lysis solution. In a clean bench, weigh an appropriate amount of lysis enzyme and add to transformation solution S1, dissolve thoroughly to obtain 5‰ (w / v) mycelium lysis solution.

[0081] (3) Mycelium lysis. Take 2.5mL mycelium lysis solution and add to a sterile plate, then place the glass paper with mycelium into the plate containing the lysis solution, with the mycelium side facing up, and add 2.5mL mycelium lysis solution between the glass papers, and finally place the glass paper with mycelium facing down, then seal the plate with sealing film, and place the plate at 30°C for 1h.

[0082] (4) Obtain protoplasts. Take out the plate containing the mycelium after lysis, use forceps to scrape the mycelium from the glass paper into the lysis solution, and then rinse the residual mycelium on the glass paper with the transformation solution S1.

[0083] (5) Filter the lysis solution with a sterilized funnel containing 5 layers of lens paper, and move the obtained filtrate into a 50 mL centrifuge tube. Centrifuge at 4°C and 2500 rpm for 10 min.

[0084] (6) After centrifugation, discard the supernatant, and slowly blow the precipitate with 5 mL of pre-cooled transformation solution S2 to resuspend it. Centrifuge at 4°C and 2500 rpm for 10 min.

[0085] (7) Reserve 200 μL of the supernatant system, slowly blow the precipitate to resuspend it, and place it on ice for standby, which is the protoplast.

[0086] (8) Take samples for microscopic examination under a microscope, and round, translucent protoplasts can be seen.

[0087] 3. Protoplast transformation

[0088] (1) Add 200 μL of protoplasts, 6 μL of sgRNA recombinant expression vector, 6 μL of donor DNA, and 25 μL of transformation solution S3 in sequence, slowly mix the above components with a pipette, and place them on ice for reaction for 20 min.

[0089] (2) Pour the heated lower medium into the plate, and cool and solidify.

[0090] (3) After the ice reaction is completed, add 2 mL of transformation solution S3 to the reaction system, gently shake the centrifuge tube to fully mix the solution, and stand at room temperature for 5 min. Add 2 mL of transformation solution S2 and mix thoroughly to terminate the reaction.

[0091] (4) Microwave oven to melt the transformation upper medium, and when it cools to about 50°C, transfer the transformation system to the upper medium and mix, and pour it into the plate prepared in advance with the lower medium. After the transformation upper layer solidifies, seal the plate with a sealing film, and incubate at 30°C for 5 to 7 days to obtain the transformants.

[0092] 4. Screening and verification of Trichoderma reesei transformants

[0093] Pick the transformants of the gene inactivation mutant strain, and culture spores in the basic medium without uracil (replace glucose with sucrose as the sole carbon source). When the recombinant plasmid enters the protoplast prepared by QMP, the mycelium can grow. Culture for 4-7 days and pick the spores with good growth on the screening plate, and place them in a 1.5 mL centrifuge tube containing 200 μL of physiological saline, and shake to mix to prepare a bacterial solution.

[0094] Take 50 μL of bacterial solution and inoculate in a 1.5 mL centrifuge tube containing 800 μL of glucose basic medium, and incubate in a constant temperature shaker at 30°C, 1000 rpm for 24 to 36 h. Extract DNA and perform PCR verification.

[0095] The primers Yz-ssb7-F / Yz-ssb7-R1 and Yz-ssb7-F / Yz-ssb7-R2 were used for verification, respectively. The fragment between the upstream homologous arm outside and the mutation site was amplified. Yz-ssb7-F was a sequence of bases outside the upstream homologous arm. Yz-ssb7-R1 was the same as the original base sequence of the mutation site, and the primer size was 46 nt. Yz-ssb7-R2 was the same as the base sequence (containing a stop codon and a BamHI enzyme cutting site) after the mutation of the mutation site, and the primer size was 24 nt. If the gene is successfully inactivated, the target fragment can be obtained by amplification of Yz-ssb7-F / Yz-ssb7-R2 in the transformant, and no band can be obtained by amplification of Yz-ssb7-F / Yz-ssb7-R1. The band amplification results of the negative control QMP strain and the transformant are opposite.

[0096] The primer sequences used for the identification of the transformant are as follows:

[0097] Yz-ssb7-F: AGTAAGATTGGCCGGAAGAGGCGACCAT (SEQ ID NO. 12),

[0098] Yz-ssb7-R1: CAGACGACGCTGTTGAGCCTCCCGACTCGTCAATTGGATCTAGCCA (SEQ ID NO. 13),

[0099] Yz-ssb7-R2: CTAGGCTCACTCGAGTCACTATCA (SEQ ID NO. 14).

[0100] Through Examples 1 and 2, the donor DNA for replacing the 616th codon of the ssb7 gene with a stop codon was successfully obtained, and the transformant was verified. The PCR verification results show that the transformant (obtained by amplification of Yz-ssb7-F / Yz-ssb7-R2) has obtained the target fragment and no band is obtained by amplification of Yz-ssb7-F / Yz-ssb7-R1, indicating that the Trichoderma reesei ssb7 gene inactivation strain (ssb7-616) has been successfully constructed. Figure 2

[0101] Example 3 Mycelium observation of Trichoderma reesei strain under field emission scanning electron microscope

[0102] ​The Trichoderma reesei mutant strain ssb7-616 obtained in Example 2 was inoculated with spores of the starting strain QMP into 100 mL of basic medium to a final concentration of 10 6

[0103] (1) Centrifugation: 5 mL of the sample was centrifuged at 4000 rpm for 10 min at 4°C, the supernatant was removed, 2 mL of 1xPBS solution with pH 7.4 was added, and the sample was centrifuged at 4000 rpm for 15 min at 4°C, and the supernatant was discarded. During the washing, the clumped sample should not be resuspended.

[0104] (2) Fixation: 2 mL of 2.5% glutaraldehyde (1xPBS) was added, and the sample was fixed in a 4°C refrigerator for 3 h (the time can be adjusted according to the sample size), and then centrifuged at 4000 rpm for 15 min at 4°C, the supernatant was discarded, and then 2 mL of 1xPBS was added, and the sample was centrifuged at 4000 rpm for 15 min at 4°C, and the supernatant was discarded. Repeat three times.

[0105] (3) Dehydration: The sample was dehydrated with 2 mL of ethanol solution at concentrations of 30%, 50%, 70%, 80%, and 90%, and centrifuged at 4000 rpm for 15 min at 4°C, and the supernatant was discarded, and then the sample was dehydrated twice in 100% ethanol.

[0106] (4) Drying: The sample was dried using a critical point drying instrument. The sample was resuspended and dropped onto a coverslip, and the coverslip with the sample was placed in the critical point drying instrument for drying.

[0107] (5) Gold spraying: After the sample was dried, the coverslip was attached to the sample stage with conductive tape, and gold was plated.

[0108] (6) Observation: The sample was placed under the electron microscope, and different magnifications were adjusted for observation and photography.

[0109] It was found that under 1000x electron microscopy, the QMP mycelium was long and slender, with few branches, and the mycelium was intertwined to form a mycelial mass. The ssb7 inactivated mutant strain showed a coral-like mycelial morphology, with thick and short mycelia and many branches that were intertwined with each other. Under 5000x electron microscopy, the ssb7 inactivated mutant strain had more obvious septa, and the septal spacing was significantly smaller than that of the starting strain QMP. Figure 3

[0110] Example 4: Measurement of liquid culture biomass of Trichoderma reesei strains

[0111] ​​The ssb7 gene inactivation mutant strain constructed in Example 2 and the starting strain QMP were liquid cultured in a medium with 2% (w / v) glucose as the sole carbon source, and the mycelium dry weight was measured every 24 h.

[0112] The mycelium dry weight was measured by drying filter paper to constant weight in advance, and recording the filter paper weight. Fresh spores were inoculated in 50 mL basic medium to a final concentration of 10 6 The mycelium dry weight was measured by drying filter paper to constant weight in advance, and recording the filter paper weight. Fresh spores were inoculated in 50 mL basic medium to a final concentration of 10

[0113] The experimental results show that the mycelium dry weight of the ssb7 gene inactivation mutant strain is significantly higher than that of the starting strain throughout the culture process. The measured mycelium dry weight at 48 h reached 7.3 g / L, which is 64.8% higher than the measured mycelium dry weight of 4.43 g / L of the starting strain at this time point Figure 4

[0114] Example 5 Trichoderma reesei strain QMP and mutant strain ssb7-616 enzyme production ability determination in a shake flask

[0115] The ssb7 gene inactivation mutant strain constructed in Example 2 and the starting strain QMP were fermented for enzyme production under low oxygen supply (high shake flask liquid loading amount, low rotation speed) in a fermentation medium with 2% (w / v) cellulose as the sole carbon source. The cellulase activity of the two strains after 96 h of fermentation was measured, and it was found that the enzyme production level of the ssb7 gene inactivation mutant strain was significantly higher than that of the starting strain QMP. Under the conditions of 250 mL liquid loading amount in a 500 mL flask and 200 rpm rotation speed, the extracellular filter paper enzyme activity of ssb7-616 was increased by 50.9% compared with QMP, and under the conditions of 100 mL liquid loading amount and 100 rpm rotation speed, its filter paper enzyme activity was increased by 31.5% Figure 5

[0116] Example 6 In vivo mutation of the ssb7 gene using Trichoderma reesei high-yield cellulase strain h61 as the starting strain

[0117] ​​The chromosomal DNA of h61 strain was used as a template, and the upstream and downstream fragments of the mutation site of gene ssb7 were amplified by PCR using the primer pair Donor-ssb7-F1 / Donor-ssb7-R1 and Donor-ssb7-F2 / Donor-ssb7-R2 in Example 1, respectively. The upstream and downstream fragments were connected by fusion PCR. After obtaining the fusion fragment, the donor DNA was obtained by PCR using Cs-ssb7-F / Cs-ssb7-R as a template, and was purified and recovered. The donor fragment was co-transferred into strain h61 with a plasmid (obtained by construction in Example 1) carrying an sgRNA expression cassette and a Cas9 coding gene expression cassette by the PEG-CaCl2-mediated Trichoderma reesei protoplast transformation method. After screening and PCR verification of the transformants, the correct transformants were obtained, and the ssb7 gene inactivation strain (hssb7-616) was successfully constructed using the Trichoderma reesei high-yield cellulase strain h61 as the starting strain. The primers used in this example, the transformation and transformant screening and verification methods are the same as those in Example 2.

[0118] Example 7 Fermentation tank enzyme production capacity determination of Trichoderma reesei high-yield cellulase strain h61-b7 and mutant strain hssb-616

[0119] The mutant strain hssb7-616 and the control strain h61-b7 (a prototrophic strain obtained by back-supplementing Aspergillus nidulans-derived pyrG to h61, and the pyrG gene expression cassette sequence is the 1061509-1062906 segment of the sequence with GenBank accession number BN001301.1) were subjected to fed-batch fermentation experiments in a 3L fermentation tank under the conditions of 3.5% (w / v) microcrystalline cellulose as the initial carbon source, 30°C, 1vvm initial aeration rate, and 300rpm initial rotation speed. After 24h of fermentation, the rotation speed of the fermentation tank with h61-b7 was adjusted to 500rpm, and the rotation speed of the fermentation tank with hssb7-616 was adjusted to 450rpm, and the initial feeding rate of glucose and ammonium sulfate was 1.5g / L / h. The glucose concentration in the fermentation broth was measured every 12h, and the glucose feeding rate was adjusted according to the measured sugar concentration. The fermentation lasted for 7 days in total.

[0120] The medium used in the fermentation tank enzyme production experiment was as follows:

[0121] 3L Fermentation tank cellulase fermentation medium (per L): bran 20g, microcrystalline cellulose 35g, soybean meal 20g, CaCl21g, MgSO4·7H2O 0.6g, KH2PO45g, (NH4)2SO45g, corn syrup 20g.

[0122] Glucose feed medium ( / L): glucose 500 g, (NH4)2SO4 50 g.

[0123] The specific steps of the enzyme production experiment in the fermenter are as follows:

[0124] (1) Seed culture:

[0125] Put 300 mL of basic medium into a 2L flask, sterilize at 115°C for 30 min. Inoculate 1.8 mL of fresh spores into the basic medium, cultivate at 30°C, 200 rpm for about 24-36 h, and observe whether it is contaminated under a microscope.

[0126] (2) Preparation of fermentation medium:

[0127] Put 2L of fermentation medium into a 3L beaker, seal with four layers of gauze, and sterilize at 121°C for 1h.

[0128] (3) Preparation of feed medium:

[0129] Put 1000 g of anhydrous glucose into a 2L reagent bottle, make up to 1.6L, heat to complete dissolution in a 80°C water bath (stirring can be assisted by a magnetic stirrer), sterilize at 115°C for 30 min; put 100 g of ammonium sulfate into a 500 mL reagent bottle, make up to 400 mL, dissolve thoroughly, sterilize at 115°C for 30 min, and then mix the two solutions in a clean bench.

[0130] (4) Fermentation in the fermenter:

[0131] Connection device: Put the sterilized fermentation medium into a 3L fermenter (the solid content will stick to the wall of the beaker, rinse with water until the solid content is completely transferred to the fermenter), and make up to 2.7L. Put the mixed feed medium into the feed bottle, and put the ammonia water into the alkali bottle. Connect the defoaming device, temperature electrode, dissolved oxygen electrode, pH electrode, etc.

[0132] Sterilization: sterilize at 121°C for 1h, and cool to the inoculation temperature.

[0133] Inoculation: after the fermentation parameters reach the control value, inoculate 300 mL of the cultivated seed culture into the 3L fermenter for fermentation culture.

[0134] Feed: start the feed according to the residual sugar amount and the sugar consumption rate. The feed speed is determined according to the pump speed measured by the device composed of a beaker, a graduated cylinder, and a soft tube with the same thickness as the feed pipe (initial feed time: start feeding when the dissolved oxygen in the fermenter is lower than 15% (about 24h after cultivation); initial feed rate: 1.5 g / L / h; adjustment of feed rate: calculate the sugar consumption rate according to the difference in residual sugar at two time points, determine the required pump speed according to the sugar consumption rate and the target sugar concentration, and adjust it. Continue to measure the residual sugar concentration at the next sampling time, and further adjust the pump speed).

[0135] Sampling: 50 mL sterile syringe was used for sampling. The syringe was connected to the sampling tube before the clamp was released. The first 10 mL was discarded and 80 mL was collected. The sampling tube was clamped and the syringe was removed.

[0136] Recording: pH and dissolved oxygen were recorded by software.

[0137] Measurement: After sampling, the sample was centrifuged at 12000 rpm for 10 min. The supernatant was collected and used for determination of glucose concentration, filter paper enzyme activity and viscosity of fermentation broth.

[0138] During the first 24 h of fermentation, the dissolved oxygen concentration in the fermentation tank of h61-b7 and hssb7-616 rapidly decreased, indicating that the first 24 h of fermentation was the rapid growth stage of the strains. The dissolved oxygen concentration in the two fermentation tanks decreased to below 20% after 24 h. The stirring speed was increased to 500 rpm and 450 rpm, respectively. The dissolved oxygen concentration in the tank fluctuated in a relatively stable range after a short rise, and hssb7-616 could maintain a higher dissolved oxygen level in the tank at a lower stirring speed. The viscosity and filter paper enzyme activity of the fermentation broth of hssb7-616 and h61-b7 were measured every 24 h. It was found that there was no significant difference in the measured viscosity of the fermentation broth of h61-b7 and hssb7-616 at 24 h (when the strains were in the rapid growth stage), but the measured viscosity of the fermentation broth of hssb7-616 was significantly lower than that of h61-b7 after 24 h. The measured viscosity of the fermentation broth of hssb7-616 was 1380 mpa·s at 144 h, which was 37.8% of the measured viscosity of the fermentation broth of h61-b7 (3650 mpa·s).

[0139] The cellulase activity was measured, and it was found that the measured filter paper enzyme activity of the fermentation broth of the two strains reached the highest value at 7 days. The highest value of the measured filter paper enzyme activity of hssb7-616 was 49 U / mL, which was 25.6% higher than the highest value of h61-b7 (39 U / mL). Figure 6 The experimental results showed that hssb7-616 achieved higher level of cellulase production in the fermentation tank with lower stirring speed.

[0140] Nucleotide sequence of ssb7 gene (SEQ ID NO. 15):

[0141] GAT

[0142] Amino acid sequence of the protein encoded by the ssb7 gene (SEQ ID NO. 16):

[0143] MQQPPSLVGDRSITGLGDAASRPNLSSSSPTVTSAPSAPTSPPPRPPISLNPPSREPPGVEPVLRITPVPRSVFASVHQPRKSSLVQTSHVLPSPRTAAAAHHHHPVSHSASGSSGSNGSGSGSGSGSGNLLRQTHRDTVHPPVKRPSTPSSHPTRGASTGASPQQGASSRNRSSTSPVSSPASRTPPYASRQASVSHSRQQHNHHHQHQHQHYHSHTSSTTSRASIEAVVGAVPDPSGHRAPPKPRRPDRNHFGASDRSATPTLSHFMRAESSMSMRHYESGPLRSMSPNPYGTPAATTTSSTARMPHEQSHDPYAPRGHSRDHSGKSSRDMGKPRAQKNPSQKAMLSRALQKANTAVQLDNAQNFEGAREAYAEACDLLQQVLDRTPGDEDKRKLEAIHQTYTSRIDELDQLGPWQVETVKALPARPESEEYSASIFIPQDYDMGDEAPRIETARVVSYIAGDNASPFAAAPNQWQQSGGHTASERLQPNRGLEPGLLQSSFSRAPRSPRRLQSTDDLRAQHQEGQYAPPPLSPRSQSPVKTHDHDDDMFAELPPHEPYQYQQEHDHQDHHQDYHQHHRHHNHHHHERQPSETVLSSYELQGHVDGGIQNSWL DPIDESGGSTASSVHSRTSSLGYRRRHIRAVSGNTEAEFDTALDAAIEAAYDDGYEPMDSVDYGTIDAGGDNSMAGVLHKVEMARERARQTEQEAYDELANLRQAHSQNPQHQQEEDRYTAEGFYEDDSSEEEERLLDEITRDFAIEDFTMENPNGTQVSARQQDAWNEDETRPDFISGVRSFSALSQRPPIPQAYAANASQPAAPPPTSALPDLPPGRPGQNPKQLKIETANIVQTQKSVYDDDEISPSTQEPPPETLVRTASAQPVRPPIPTESFPSELSAPASPTAKKRLLEGENVLNASPSIHRLRKNFSSSSLRSMKNRNMSVSHLDDSSDASPGTPLNDPFNKAPAVPVPALPTPLLASFKDHMEAAAGVGFHLFDDEFHAAAAAGPQSPQSPRSPVVVSMDVPVPLEPCPNDFMLRPFWLMRCLYQTLVHPKGGYISTKLFVPRDVWRVKGVKIKNVEDKIANCDFLTAALLKLSKVDTLDADAVLEEMQALEGILEQIQPVLARKLGNEVGVQGSGLLFKDASMMEGDPGSAVPRSGSVSGKASAFSWRRLRPKTSGVGLGGSYSSRNASAETKEASTLATVPMTPKPTSRSAKRDVSQVQFIGPNASYMGSLARLFDAAQAVDQIARQVDDPGLRLADKTQVGLELCTRHAAEFFGFYICRFVLADLGLLLDKFLKRGSEWVMT*.

[0144] The above-described embodiments are merely intended to describe the preferred modes of the present application, and are not intended to limit the scope of the present application. Various modifications and improvements of the present application made by those skilled in the art based on the above-described embodiments should fall within the scope of the present application defined by the claims.

Claims

1. Use of the ssb7 gene or related biological material for improving the mycelial morphology of Trichoderma reesei while increasing its efficiency in producing enzymes, characterized in that, The ssb7 gene is inactivated, the Trichoderma reesei hypha morphology is improved, and the enzyme production efficiency is improved; The nucleotide sequence of the ssb7 gene is shown as SEQ ID NO. 15, and the amino acid sequence of the protein encoded by the ssb7 gene is shown as SEQ ID NO.

16. The related biological materials include a recombinant vector and a recombinant bacteria capable of inactivating the ssb7 gene; The enzyme is cellulase; The improved hypha morphology is shorter hypha length, more hypha branches, and increased hypha amount.

2. A method for improving the mycelial morphology of Trichoderma reesei while increasing its efficiency in producing enzymes, characterized by, The method comprises the step of inactivating the ssb7 gene of the Trichoderma reesei to improve the hypha morphology of the Trichoderma reesei, and improve the enzyme production efficiency of the Trichoderma reesei. The nucleotide sequence of the ssb7 gene is shown as SEQ ID NO. 15, and the amino acid sequence of the protein encoded by the ssb7 gene is shown as SEQ ID NO.

16. The enzyme is cellulase; The improved hypha morphology is shorter hypha length, more hypha branches, and increased hypha amount.

3. The method of claim 2, wherein, The method for inactivating the ssb7 gene of the Trichoderma reesei comprises knocking out the ssb7 gene by using a CRISPR-Cas9 editing technology.

4. The method of claim 3, wherein, The inactivation is to mutate the codon of aspartic acid at the 616th position in the ssb7 gene coding the amino acid sequence shown as SEQ ID NO. 16 into a stop codon.

5. A method for producing enzymes with Trichoderma reesei, characterized by, The method comprises the step of using the Trichoderma reesei to perform fermentation and produce enzymes; the enzyme is cellulase; The ssb7 gene of the Trichoderma reesei is inactivated, the hypha morphology is improved, and the enzyme production efficiency is improved; The nucleotide sequence of the ssb7 gene is shown as SEQ ID NO. 15, and the amino acid sequence of the protein encoded by the ssb7 gene is shown as SEQ ID NO. 16.

Citation Information

Patent Citations

  • A method for recycling lignocellulose hydrolysate for fermentation to produce cellulase solution

    CN113528492B

  • Filamentous fungal strains comprising reduced viscosity phenotypes

    CN112074530A

  • Mutant and genetically modified filamentous fungal strains comprising enhanced protein productivity phenotypes and methods thereof

    CN112654704A

  • Recombinant trichoderma reesei as well as preparation method and application thereof

    CN119530028A