A diagnostic kit for detecting DLBCL based on plasma exosome miRNAs

Abstract

This invention relates to the field of molecular diagnostics, specifically providing a diagnostic kit for the combined detection of DLBCL based on plasma exosomal miRNAs. This invention provides two or more peripheral blood exosomes used as diagnostic biomarkers for diffuse large B-cell lymphoma (DLBCL). Based on these DLBCL diagnostic biomarkers, this invention also provides a non-invasive, highly reproducible, and highly specific plasma exosomal miRNA diagnostic kit for the early diagnosis and follow-up monitoring of DLBCL. The plasma exosomal miRNA diagnostic kit provided by this invention is of great significance in the early diagnosis, genotyping, relapse monitoring, and efficacy evaluation of DLBCL.

Description

Technical Field

[0001] This invention relates to the field of molecular diagnostics technology, specifically providing a diagnostic kit for the combined detection of DLBCL based on plasma exosome miRNAs. Background Technology

[0002] Diffuse large B-cell lymphoma (DLBCL) is the most common malignant lymphoma in adults, accounting for 30-40% of adult non-Hodgkin lymphomas. The "gold standard" for DLBCL diagnosis is invasive lymph node biopsy, but this method has limitations in repeatability and cannot dynamically monitor tumor changes. Currently, the International Prognostic Index (IPI) is commonly used clinically to predict patient prognosis. The IPI classifies patients based on parameters such as age, lactate dehydrogenase (LDH) level, ECOG score, pathological stage, and the number of extranodal sites involved. However, some patients with a good IPI still experience a poor prognosis. Approximately 75-80% of patients achieve complete remission with the R-CHOP regimen (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone), but about 40% experience relapse or primary refractory disease. Therefore, there is an urgent clinical need for a simple and highly specific molecule to detect diseases in advance and characterize their progression and prognosis.

[0003] Exosomes are vesicle structures with an average diameter of 100 nm (30-150 nm) enclosed by a lipid bimembrane. Exosomes are present in almost all body fluids. They can carry various macromolecules from different tissues and cells, including mRNA, microRNA (miRNA), DNA, and proteins, participating in processes such as antigen presentation, cell differentiation and growth, tumor immune response, tumor cell migration and invasion, and are closely related to the occurrence and development of diseases.

[0004] miRNAs are a class of single-stranded non-coding RNAs, 19-24 nucleotides in length. miRNAs exert their effects on post-transcriptional gene expression regulation by binding to the 3'-UTR of target mRNAs. Through this mechanism, miRNAs can regulate more than 50% of known human genes, including 10 major pathways involved in cancer. Furthermore, miRNAs are involved in many biological processes, including cell proliferation and apoptosis.

[0005] Currently, there are no studies on the correlation between combining multiple miRNAs and early diagnosis or relapse monitoring of diffuse large B-cell lymphoma. Summary of the Invention

[0006] To address the shortcomings of existing technologies, this invention collects peripheral blood from patients and healthy individuals, screens and verifies differentially expressed plasma exosomal miRNAs as diagnostic markers for diffuse large B-cell lymphoma (DLBCL), and develops a DLBCL diagnostic kit with advantages such as non-invasiveness, high reproducibility, and real-time monitoring. The diagnostic markers provided by this invention can be used in the early diagnosis, genotyping, relapse monitoring, and efficacy evaluation of DLBCL.

[0007] Specifically, the first aspect of the present invention provides diagnostic markers for diffuse large B-cell lymphoma, wherein the diagnostic markers are peripheral blood exosomal miRNAs, wherein the peripheral blood exosomal miRNAs are has-let-7c-5p and has-miR-7704; or the peripheral blood exosomal miRNAs are has-miR-451a, has-let-7c-5p and has-miR-7704; or the peripheral blood exosomal miRNAs are has-let-7c-5p, has-miR-7704 and has-miR-30c-5p; or the peripheral blood exosomal miRNAs are has-miR-451a, has-let-7c-5p, has-miR-7704 and has-miR-30c-5p.

[0008] Secondly, the present invention provides a primer combination, wherein the primer combination is a primer for detecting the above-mentioned diagnostic markers.

[0009] The primer combinations provided by this invention include the sequences of SEQ ID NO.1-4 and SEQ ID NO.8, wherein SEQ ID NO.8 is a universal reverse primer.

[0010] The RT-PCR forward primer for detecting the expression level of has-miR-451a was: TCGGCAGGAAACCGTTACCATTAC;

[0011] The RT-PCR forward primers used to detect plasma exosome has-let-7c-5p expression levels are:

[0012] GCCGAGTGAGGTAGTAGGTTGT;

[0013] The RT-PCR forward primer used to detect the expression level of plasma exosome has-miR-7704 is: GCCGAGCGGGGTCGGCGGC;

[0014] The RT-PCR forward primers used to detect the expression level of plasma exosomal has-miR-30c-5p are:

[0015] GCCGAGTGTAAACATCCTACACT.

[0016] The RT-PCR forward primer used to detect the expression level of the plasma exosome reference gene Cel-miR-39 is: AGCCCGTCACCTGGTGTAAATC;

[0017] The universal reverse primer is: CAGTGCAGGGTCCGAGGTAT.

[0018] Preferably, the primer combination provided by the present invention has the following sequences: SEQ ID NO.2-3 and SEQ ID NO.8; or SEQ ID NO.1-3 and SEQ ID NO.8; or SEQ ID NO.2-4 and SEQ ID NO.8; or SEQ ID NO.1-4 and SEQ ID NO.8.

[0019] According to those skilled in the art, in a third aspect, the present invention also provides the application of the above-mentioned diagnostic biomarkers or primer combinations in the preparation of diagnostic products for diffuse large B-cell lymphoma.

[0020] In the applications provided by this invention, the diffuse large B-cell lymphoma diagnostic product includes: a diffuse large B-cell lymphoma diagnostic chip, a diffuse large B-cell lymphoma diagnostic reagent, and a diffuse large B-cell lymphoma diagnostic kit.

[0021] Fourthly, the present invention provides a diagnostic product for diffuse large B-cell lymphoma, wherein the diagnostic product for diffuse large B-cell lymphoma contains primer pairs for detecting the expression levels of has-miR-451a, has-let-7c-5p, has-miR-7704 and / or has-miR-30c-5p in peripheral blood exosomes.

[0022] Preferably, the present invention provides a diagnostic product for diffuse large B-cell lymphoma, wherein the diagnostic product for diffuse large B-cell lymphoma contains a primer pair for detecting the expression levels of has-let-7c-5p and has-miR-7704 in peripheral blood exosomes.

[0023] Or it may contain primer pairs that detect the expression levels of has-miR-451a, has-let-7c-5p, and has-miR-7704 in peripheral blood exosomes.

[0024] Or it may contain primer pairs that detect the expression levels of has-let-7c-5p, has-miR-7704, and has-miR-30c-5p in peripheral blood exosomes.

[0025] The diagnostic product for diffuse large B-cell lymphoma provided by this invention is a blood test kit, which contains the sequence shown in the primer combination above.

[0026] When the diagnostic product for diffuse large B-cell lymphoma provided by the present invention is a blood test kit, the blood test kit also contains the sequence shown in SEQ ID NO. 9-12.

[0027] Fifthly, the present invention provides the application of the above-mentioned diagnostic markers or primer combinations or the above-mentioned diffuse large B-cell lymphoma diagnostic products in the genotyping, relapse monitoring or efficacy evaluation of diffuse large B-cell lymphoma, wherein the application is for non-disease diagnosis and diagnostic purposes.

[0028] The beneficial effects of this invention are as follows:

[0029] The inventors analyzed the differentially expressed plasma exosomal miRNAs between DLBCL patients and healthy controls (HC) through transcriptome sequencing. After quantifying and validating the plasma exosomal miRNAs using real-time quantitative PCR (RT-qPCR), they obtained novel non-invasive diagnostic biomarkers for DLBCL patients.

[0030] The four sets of combined diagnostic markers provided in this invention (has-let-7c-5p and has-miR-7704; or has-miR-451a, has-let-7c-5p and has-miR-7704; or has-let-7c-5p, has-miR-7704 and has-miR-30c-5p; or has-miR-451a, has-let-7c-5p, has-miR-7704 and has-miR-30c-5p) are of great significance in the early diagnosis, genotyping, relapse monitoring and efficacy evaluation of DLBCL. Furthermore, compared to other non-invasive biomarkers, exosomal miRNAs are encapsulated in a lipid bilayer, making them more stable. Attached Figure Description

[0031] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0032] Figure 1 This is the identification of exosomes in this invention.

[0033] Figure 2 This is the RT-qPCR verification of the differential plasma exosomal miRNAs of this invention.

[0034] Figure 3This is the ROC analysis of four differentially expressed plasma exosomal miRNAs in this invention.

[0035] Figure 4 It is a ROC analysis for the combined diagnosis of any two or three miRNAs. Detailed Implementation

[0036] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0037] Example 1: Screening for differentially expressed plasma exosomal miRNAs

[0038] This embodiment collected data from 20 newly diagnosed DLBCL patients who visited the Department of Hematology at Shanxi Provincial People's Hospital, and 10 healthy controls (HC) were collected concurrently according to age and gender.

[0039] In this embodiment, 5 mL of peripheral blood was drawn from the participant, centrifuged at 1500 rpm for 10 min to obtain plasma, and plasma exosomes were separated by ultracentrifugation: 2000 g of plasma was centrifuged at 4°C for 30 min; the supernatant was collected and centrifuged at 10000 g at 4°C for 45 min; the supernatant was collected, filtered through a 0.45 μm filter membrane, and the filtrate was collected; centrifuged at 100000 g at 4°C for 70 min, and the supernatant was discarded; the precipitate was resuspended in 10 mL of pre-chilled 1×PBS, centrifuged at 100000 g at 4°C for 70 min, and the supernatant was discarded. Plasma exosomes were obtained by resuspending the precipitate in 200 μL of pre-chilled 1×PBS.

[0040] In this embodiment, the obtained plasma exosomes were identified, and the specific results are as follows.

[0041] Exosomes were identified as having a saucer-like morphology by transmission electron microscopy. Figure 1 (AB); Nanoparticle tracking analysis identified the exosome particle size as 73.50 nm-83.50 nm ( ). Figure 1 Flow cytometry was used to identify exosome-specific marker proteins (CD9 / CD63 / CD81), showing that plasma exosome-specific marker protein CD9 (CD9 / CD63 / CD81) was present. Figure 1 E), CD63 ( Figure 1 F), CD81 ( Figure 1 All H were positive.

[0042] This embodiment performed sequencing analysis of plasma exosomal miRNAs and screening of differentially expressed miRNAs. The results are as follows:

[0043] Transcriptome sequencing analysis of plasma exosomes from 6 newly diagnosed DLBCL patients and 6 HC patients yielded 64 differentially expressed plasma exosomal miRNAs (differential miRNA screening criteria: q value < 0.01 & | log2(fold change)| > 1). Compared with HC, 18 plasma exosomal miRNAs were upregulated and 46 were downregulated.

[0044] Six differentially expressed plasma exosomal miRNAs were selected, among which has-miR-451a, has-let-7c-5p, has-miR-7704, and has-miR-30c-5p were the top four downregulated miRNAs, and has-miR-126-5p and has-miR-139-3p were the top two upregulated miRNAs.

[0045] Example 2: RT-qPCR Validation of Differential Plasma Exosomal miRNAs

[0046] This embodiment validates the six differentially expressed plasma exosomal miRNAs obtained from Example 1 using RT-qPCR. The validation steps are as follows:

[0047] (1) Extraction and reverse transcription of exosomal RNA from plasma

[0048] Plasma exosomes were extracted from all samples and added to 700 μL of lysis buffer. RNA was extracted according to the miRNeasy Mini kit (Qiagen, Germany) instructions. The reverse transcription primer sequences are shown in Table 1. The total reaction volume was 40 μL. The reaction program was: 37 °C for 10 min, 55 °C for 15 min, and 95 °C for 3 min. The cDNA was then stored at -20 °C for long-term preservation.

[0049] Table 1. miRNAs and reverse transcription primer sequences for external reference cel-miR-39

[0050]

[0051] The reaction system is as follows:

[0052]

[0053] (2) RT-qPCR reaction

[0054] The cDNA obtained from reverse transcription was diluted 4-fold and stored on ice for later use. The primers used are shown in Table 2. The total reaction volume was 20 µL, as follows:

[0055]

[0056] Table 2. miRNAs and upstream and downstream primer sequences of the external reference cel-miR-39

[0057]

[0058] The PCR reaction program was as follows: 95 ℃, 10 min; 95 ℃, 15 sec, 60 ℃, 20 sec, 72 ℃, 25 sec, 40 cycles; final 72 ℃, 5 min. The final results are presented in 2... -ΔΔCt (ΔCt=Ct) （miRNA） -Ct （cel-miR-39） and ΔΔCt = ΔCt - average Ct (HC) () indicates the relative differences in the expression of plasma exosomal miRNAs.

[0059] RT-qPCR validation of six differentially expressed plasma exosomal miRNAs in 20 cases of DLBCL and 10 cases of HC revealed a significant decrease in the expression of the downregulated plasma exosomal miRNAs has-miR-451a (P=0.01), has-let-7c-5p (P=0.001), has-miR-7704 (P=0.02), and has-miR-30c-5p (P=0.004) in DLBCL. However, the upregulated expression of has-miR-126-5p (P=0.20) and has-miR-139-3p (P=0.16) did not show a significant increase. Figure 2 ).

[0060] Example 3: Diagnostic value of differentially expressed plasma exosomal miRNAs

[0061] In this embodiment, ROC analysis was performed on four differentially expressed plasma exosomal miRNAs (has-miR-451a, has-let-7c-5p, has-miR-7704, and has-miR-30c-5p) that were validated by RT-qPCR in Example 2 to evaluate their diagnostic value. The results are as follows.

[0062] has-miR-451a (AUC=0.79; 95% CI:0.62-0.96; sensitivity:0.70; specificity: 0.80), has-let-7c-5p (AUC=0.88; 95% CI:0.73-1.00; sensitivity:0.85; specificity: 0.90), has-miR-7704 (AUC=0.77; 95% CI:0.56-0.97; sensitivity:0.90; specificity: 0.70), has-miR-30c-5p (AUC=0.80; 95% CI:0.61-0.98; sensitivity:0.80; specificity: 0.70).

[0063] Subsequently, ROC analysis was performed on random combinations of the above four differentially expressed plasma exosomal miRNAs, and the results are shown in [Figure 1]. Figure 3 and Figure 4 .

[0064] The results for any two differentially expressed plasma exosomal miRNA combinations were as follows: the combined diagnostic AUC of has-miR-451a and has-let-7c-5p was 0.885 (95% CI: 0.74-1.00; sensitivity: 0.90; specificity: 0.90); the combined diagnostic AUC of has-miR-451a and has-miR-7704 was 0.82 (95% CI: 0.65-0.99; sensitivity: 0.85; specificity: 0.80); the combined diagnostic AUC of has-miR-451a and has-miR-30c-5p was 0.855 (95% CI: 0.70-1.00; sensitivity: 0.85; specificity: 0.80); and the combined diagnostic AUC of has-let-7c-5p and has-miR-7704 was 0.912 (95% CI: 0. ... CI: 0.81-1.00; sensitivity: 0.85; specificity: 0.80); the combined diagnostic AUC of has-let-7c-5p and has-miR-30c-5p was 0.86 (95% CI: 0.71-1.00; sensitivity: 0.85; specificity: 0.90); the combined diagnostic AUC of has-miR-7704 and has-miR-30c-5p was 0.79 (95% CI: 0.60-0.99; sensitivity: 0.85; specificity: 0.70).

[0065] The results for any three differentially expressed plasma exosomal miRNA combinations were as follows: the AUC for diagnosis by the combination of has-miR-451a, has-let-7c-5p, and has-miR-7704 was 0.905 (95% CI: 0.80-1.00; sensitivity: 0.95; specificity: 0.70); the AUC for diagnosis by the combination of has-miR-451a, has-let-7c-5p, and has-miR-30c-5p was 0.875 (95% CI: 0.73-1.00; sensitivity: 0.90; specificity: 0.90); and the AUC for diagnosis by diagnosis by the combination of has-miR-451a, has-miR-7704, and has-miR-30c-5p was 0.875 (95% CI: 0.74-1.00; sensitivity: 0.85; specificity: 0.90). The AUC for the combined diagnosis of has-let-7c-5p, has-miR-7704 and has-miR-30c-5p was 0.915 (95% CI: 0.81-1.00; sensitivity: 0.80; specificity: 0.90).

[0066] The combined diagnostic efficacy of four differentially expressed plasma exosomal miRNAs was 0.91 (95% CI: 0.80–1.00; sensitivity: 0.75; specificity: 0.90).

[0067] The results show that the combined diagnostic system has higher diagnostic performance than single miRNAs. An AUC greater than 0.9 is considered a high-diagnostic-value marker. Specifically, the AUC for the combined diagnosis of has-let-7c-5p and has-miR-7704 is 0.912; the AUC for the combined diagnosis of has-miR-451a, has-let-7c-5p, and has-miR-7704 is 0.905; the AUC for the combined diagnosis of has-let-7c-5p, has-miR-7704, and has-miR-30c-5p is 0.915; and the AUC for the combined diagnosis of has-miR-451a, has-let-7c-5p, has-miR-7704, and has-miR-30c-5p is 0.91.

[0068] Specifically, the combination of has-let-7c-5p and has-miR-7704, the combination of has-miR-451a, has-let-7c-5p and has-miR-7704, the combination of has-let-7c-5p, has-miR-7704 and has-miR-30c-5p, and the combination of has-miR-451a, has-let-7c-5p, has-miR-7704 and has-miR-30c-5p are suitable as diagnostic markers for diffuse large B-cell lymphoma.

[0069] Furthermore, the AUC of the combined diagnosis of has-let-7c-5p and has-miR-7704, as well as the combined diagnosis of has-let-7c-5p, has-miR-7704 and has-miR-30c-5p, was higher than the combined diagnostic value of the four differentially expressed plasma exosomal miRNAs.

[0070] Therefore, the combined diagnosis of has-let-7c-5p and has-miR-7704, as well as the combination of has-let-7c-5p, has-miR-7704 and has-miR-30c-5p, are suitable as diagnostic markers for diffuse large B-cell lymphoma.

[0071] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The application of reagents for detecting diagnostic markers in the preparation of diagnostic products for diffuse large B-cell lymphoma, characterized in that, The diagnostic markers are peripheral blood exosomal miRNAs, specifically has-let-7c-5p and has-miR-7704; or has-miR-451a, has-let-7c-5p and has-miR-7704; or has-let-7c-5p, has-miR-7704 and has-miR-30c-5p; or has-miR-451a, has-let-7c-5p, has-miR-7704 and has-miR-30c-5p.

2. The application according to claim 1, characterized in that, The reagent is a primer combination.

3. The application according to claim 2, characterized in that, The primer combination comprises the sequences of SEQ ID NO.1-4 and SEQ ID NO.8, wherein SEQ ID NO.8 is a universal reverse primer.

4. The application according to claim 3, characterized in that, The primer combination sequence is SEQ ID NO.2-3 and SEQ ID NO.8; or SEQ ID NO.1-3 and SEQ ID NO.8; or SEQ ID NO.2-4 and SEQ ID NO.8; or SEQ ID NO.1-4 and SEQ ID NO.8.

Images