SNP sites, site combinations and their applications related to grass carp TLR8b gene and resistance to hemorrhagic disease

Abstract

The present invention belongs to the field of aquatic biological breeding, and specifically relates to grass carp TLR8b The present invention successfully screened grass carp for SNP sites related to resistance to hemorrhagic disease by PCR amplification sequencing and PCR-RFLP technology. TLR8b The SNP sites associated with grass carp hemorrhagic disease resistance are located at bases 45380442 and 45385596 on chromosome 10. TLR8b Detection of gene SNP site combinations can screen for grass carp individuals resistant to hemorrhagic disease. Therefore, the SNP molecular markers provided by the present invention can be used in molecular marker-assisted breeding of grass carp, accelerating the selection of disease-resistant grass carp varieties and providing a reference basis for disease-resistant grass carp breeding.

Description

Technical Field

[0001] The present invention belongs to the field of aquatic biological breeding, and in particular relates to SNP sites, site combinations and applications of grass carp TLR8b genes related to grass carp hemorrhagic disease resistance. Background Art

[0002] Grass carp (Ctenopharyngodon idella) belongs to the order Cypriniformes, family Cyprinidae, subfamily Leucopinae, genus Ctenopharyngodon, also known as grass carp.

[0003] Grass carp hemorrhagic disease, caused by grass carp reovirus, poses a serious threat to grass carp aquaculture. In the early stages, the fish's food intake decreases and their body color darkens. As the disease progresses, bleeding of varying degrees occurs in various body parts, including the mouth, upper and lower jaws, around the eyes, and on the gill covers. In severe cases, autopsy reveals muscle hemorrhage, intestinal congestion with no contents, and hemorrhagic spots in multiple organs, including the swim bladder, liver, gallbladder, spleen, kidneys, and mesentery. Histopathological examination reveals damaged capillary endothelial cells, resulting in hyaline lesions, increased vascular wall permeability, widespread hemorrhage in capillaries and small vessels, and intravascular thrombosis. Systemic bleeding is a key characteristic of grass carp hemorrhagic disease. Grass carp hemorrhagic disease outbreaks are highly seasonal, with the highest incidence and mortality rates occurring in summer when water temperatures are between 25-30°C. When water temperatures are below 20°C, viral proliferation in the host is significantly reduced, and infectivity is even lost. However, once water temperatures rise above 24°C, viral proliferation accelerates, causing fish mortality. Up to now, grass carp hemorrhagic disease can be divided into red fin and red gill cover type, enteritis type and red muscle type.

[0004] There is currently no effective treatment for grass carp hemorrhagic disease. Therefore, breeding disease-resistant grass carp varieties is a more economical and effective approach.

[0005] SNP refers to the variation of a single nucleotide in the genome and is one of the most common forms of genetic variation. The study of SNP sites can reveal genetic differences between different individuals and provide an important basis for the study of genetic traits. In grass carp, studying the correlation between SNP sites and grass carp hemorrhagic disease resistance can provide an important theoretical basis for disease-resistant grass carp breeding. Therefore, the discovery of SNP sites related to grass carp hemorrhagic disease resistance is of great significance for grass carp breeding and disease prevention and control. At present, researchers have identified some SNP sites related to grass carp hemorrhagic disease resistance.

[0006] However, the SNP sites related to the grass carp immune gene TLR8b have not been reported. Summary of the Invention

[0007] The present invention aims to provide a reagent for detecting base 45380442 of chromosome 10 of grass carp and its application in breeding grass carp resistant to grass carp hemorrhagic disease.

[0008] Another object of the present invention is to provide a reagent for detecting bases 45380442 and 45385596 of chromosome 10 of grass carp for use in breeding grass carp resistant to grass carp hemorrhagic disease.

[0009] In order to achieve the above object, the present invention adopts the following technical measures:

[0010] The applicant collected 240 grass carp (12-15 cm in length) from ponds at a grass carp breeding base in Chongqing that had not been injected with inactivated vaccines. Forty-seven individuals that had been artificially infected with grass carp reovirus and were near death due to an outbreak of grass carp hemorrhagic disease were used as a susceptible group. After the onset of the disease, 52 surviving individuals were collected as a disease-resistant group. A total of 99 grass carp samples were amplified for TLR8b gene and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. DNAstar software was used for sequencing and splicing, and snapgene was used to analyze the sequencing results. Different phenotypes were recorded, and combined with the sequencing results, Graphpad software was used to combine SNP genotype and phenotypic data for genome-wide association analysis. Finally, two SNPs related to the grass carp TLR8b gene and grass carp hemorrhagic disease resistance were screened out. The SNP site Chr10-45380442 is located at the 548th position of the corresponding sequence in Table 1, where the base Y at the 548th position is C (cytosine) or G (guanine); the SNP site Chr10-45385596 is located at the 390th position of the corresponding sequence in Table 1, where the base W at the 390th position is G (guanine) or A (adenine).

[0011] The protection scope of the present invention includes:

[0012] Application of a reagent for detecting base 45380442 of grass carp chromosome 10 in breeding grass carp resistant to grass carp hemorrhagic disease.

[0013] Application of a reagent for detecting base 45385596 on chromosome 10 of grass carp in breeding of grass carp resistant to grass carp hemorrhagic disease.

[0014] In the above-mentioned application, the preferred reagent is a primer. In the present application, the SNP can be detected by conventional PCR primers, so those skilled in the art can detect the SNP site by conventional primers.

[0015] Preferred primers are:

[0016] Chr10-45380442: upstream primer F: 5'TAGCGCAAATTGATCAAGTAATG 3', downstream primer R: 5'AGTCCACAAAAGGCACTGA 3;

[0017] Chr10-45385596: upstream primer F: 5'CCTGCTCAGCACTGCTTACA 3', downstream primer R: 5'CCTTGGGCTTGGTTGAG 3'.

[0018] Compared with the prior art, the present invention has the following advantages:

[0019] The present invention screened out two SNP molecular markers significantly associated with grass carp hemorrhagic disease resistance from the grass carp TLR8b gene. The related SNP molecular markers can be used for molecular marker-assisted breeding of grass carp, accelerate the selection of disease-resistant grass carp varieties, and provide a reference basis for disease-resistant breeding of grass carp or other farmed fish. DETAILED DESCRIPTION

[0020] To help those skilled in the art better understand the technical content of the present invention, the present invention is further described below with reference to specific examples and the accompanying tables. The technical solutions described in this invention, unless otherwise specified, are conventional solutions in the art; the reagents and materials described, unless otherwise specified, are commercially available. The grass carp reference genome used in this invention is the NCBI public version (https: / / ftp.ncbi.nlm.nih.gov / genomes / all / GCF / 019 / 924 / 925 / GCF_019924925.1_HZGC01 / GCF_019924925.1_HZGC01_genomic.fna.gz).

[0021] Example 1:

[0022] Mining of SNPs associated with resistance to hemorrhagic disease in grass carp

[0023] 1) The applicant collected 47 dying individuals from ponds of grass carp breeding base in Chongqing that were artificially infected with grass carp reovirus and had an outbreak of grass carp hemorrhagic disease as the susceptible group. After the disease period, 52 surviving individuals were collected as the disease-resistant group, totaling 99 grass carp samples. After TLR8b was amplified, they were sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing was spliced ​​using DNAstar software, and the sequencing results were analyzed using snapgene.

[0024] 2) Different phenotypes were recorded and, combined with sequencing results, SNP genotype and phenotype data were combined for genome-wide association analysis using GraphPad software.

[0025] The results showed that there were 12 SNP sites in the entire grass carp TLR8b gene. After secondary infection verification, two SNPs that may be associated with grass carp hemorrhagic disease resistance were finally identified. Their physical locations and sequence information are shown in Table 1. The SNP site Chr10-45380442 in Table 1 is located at position 45380442 of grass carp chromosome 10, which is the 548th position of the corresponding sequence in Table 1, where the base Y at position 548 is C (cytosine) or G (guanine); the SNP site Chr10-45385596 is located at position 45385596 of grass carp chromosome 10, which is the 390th position of the corresponding sequence in Table 1, where the base W at position 390 is G (guanine) or A (adenine);

[0026] These two SNP sites are associated with grass carp hemorrhagic disease resistance and can be used for the breeding of grass carp disease resistance traits. These sites were analyzed, and the results are shown in Table 2.

[0027] Table 1 SNP information related to grass carp hemorrhagic disease resistance

[0028]

[0029]

[0030] Table 2 Statistical analysis of SNP genotypes in susceptible and resistant populations

[0031]

[0032] As shown in Table 2, the genotypes of the two SNPs were significantly different between the resistant and susceptible groups (P < 0.05). The genotypes significantly associated with disease resistance at these two SNPs were: Chr10-45380442: GG, and Chr10-45385596: AA. The genotypes significantly associated with susceptibility were: Chr10-45380442: CC, and Chr10-45385596: GG. Therefore, the SNP markers of this invention can be used for breeding grass carp for hemorrhagic disease resistance.

[0033] Example 2:

[0034] Application of SNP loci associated with grass carp hemorrhagic disease resistance in grass carp breeding

[0035] Based on the two single nucleotide polymorphisms located in Example 1 of the present invention, corresponding primers were developed for molecular marker-assisted selection breeding of disease-resistant grass carp to obtain grass carp varieties resistant to grass carp hemorrhagic disease. The primer information is shown in Table 3.

[0036] Table 3 Nucleotide sequences of primers for amplifying SNPs associated with grass carp hemorrhagic disease resistance

[0037]

[0038] Example 3:

[0039] Application of SNP loci associated with grass carp hemorrhagic disease resistance in grass carp breeding

[0040] Healthy grass carp (12-15 cm in length) were collected from ponds at a grass carp breeding base in Chongqing in March and April 2024. After artificial infection with grass carp reovirus, 200 diseased individuals were collected. The genotypes of the two SNP sites located in Example 1 were detected in the dead individuals to verify the correlation between genotype and resistance to grass carp hemorrhagic disease. The specific steps included:

[0041] 1) DNA extraction and PCR amplification

[0042] DNA from 200 caudal fin rays of the validation population was extracted using the isopropanol / ammonium acetate method and diluted to 100 ng / μL. PCR amplification was performed using grass carp genomic DNA as a template using the primers listed in Table 3.

[0043] PCR reaction conditions: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, Tm annealing for 30 s, extension at 72°C for 15 s, 34 cycles; extension at 72°C for 10 min, and storage at 4°C.

[0044] The PCR system was as follows: 0.25 μL each of upstream and downstream primers, 0.5 μL DNA template, 5 μL SuperLong Taq MasterMix (Mei5bio, Beijing, China), and ddH2O to 10 μL.

[0045] 2) Genotype statistics

[0046] After PCR was completed, Sanger sequencing was used to obtain the sequence of the corresponding sample, and the genotype of the SNP site described in the present invention was read according to the sequencing peak diagram of each sample, and the survival rate and mortality rate were calculated. The statistical results are shown in Tables 4 and 5.

[0047] Table 4 Detection of genotypes of two disease-resistant SNPs in 100 diseased and deceased individuals

[0048] name genotype Number of dead individuals detected Detection rate of deceased individuals Chr10-45380442 GG 10 10.5％ Chr10-45385596 AA 7 7％

[0049] Table 5 Detection of genotypes of two disease-resistant SNP loci in 100 disease-resistant surviving individuals

[0050] name genotype Number of surviving individuals detected Survival individual detection rate Chr10-45380442 GG 78 78％ Chr10-45385596 AA 69 69％

[0051] As can be seen from Tables 4 and 5, molecular marker Chr10-45380442 has a higher accuracy rate for disease resistance detection. Both markers can also be used simultaneously. That is, when the genotype of the individual's SNP site Chr10-45380442 and the genotype of the Chr10-45385596 site are GG and AA, respectively, the survival rate is significantly higher than the mortality rate, indicating that the individual is grass carp resistant to hemorrhagic disease.

[0052] The above embodiments are only used to illustrate the present invention, and the scope of protection of the present invention is not limited to the above embodiments. Those skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention. Any improvements and modifications based on the concept of the present invention fall within the scope of protection of the present invention, and the specific scope of protection shall be subject to the claims.

Claims

1. Application of a reagent for detecting base 45380442 of grass carp chromosome 10 in breeding for grass carp hemorrhagic disease resistance, wherein the reagent is a primer, and the reference genome of the grass carp is GCF_019924925.1_HZGC01 in the NCBI public version.

2. The use of a reagent for detecting bases 45380442 and 45385596 on chromosome 10 of grass carp in breeding for resistance to hemorrhagic disease of grass carp, wherein the reagent is a primer, and the reference genome of the grass carp is GCF_019924925.1_HZGC01 in the NCBI public version.

3. The use according to claim 1, wherein the reagent is a primer, which is: Chr10-45380442: Upstream primer F: 5' TAGCGCAAATTGATCAAGTAATG 3', downstream primer R: 5' AGTCCACAAAAGGCACTGA 3'.

4. The use according to claim 2, wherein the reagent is a primer, which is: Chr10-45380442: upstream primer F: 5'TAGCGCAAATTGATCAAGTAATG 3', downstream primer R: 5'AGTCCACAAAAGGCACTGA 3' and Chr10-45385596: upstream primer F: 5'CCTGCTCAGCACTGCTTACA 3', downstream primer R: 5' CCTTGGGCTTGGTTGAG 3'.

Images