A low-electromesmotic electromembrane extraction device, method and application thereof in oligonucleotide extraction

Abstract

The present invention relates to a low-electromesmotic electromembrane extraction device, method, and application thereof in oligonucleotide extraction, belonging to the technical field of sample pretreatment. The device comprises a module II and at least one module I. Module I and module II are two integrally formed hollow cylinders of different diameters. The smaller diameter end of module II is closed, and the smaller diameter end of module I is used to mount an extraction membrane. Module II is used to connect to the cathode, and module I is used to connect to the anode. The smaller diameter hollow cylinder of module I is used to be inserted and riveted into the larger diameter hollow cylinder of module II, thereby limiting the cathode solution space in module II. The present invention suppresses electroromisomy in a gel electromembrane extraction system by limiting the cathode solution space, thereby efficiently completing the extraction of oligonucleotides.

Description

Technical Field

[0001] The present invention belongs to the technical field of sample pretreatment, and more specifically, relates to a low-electro-endosmotic electromembrane extraction device and method and application thereof in oligonucleotide extraction. Background Art

[0002] Electromembrane extraction (EME) is an emerging sample pretreatment technology developed on the basis of liquid phase microextraction (LPME) (Journal of Chromatography A 2006, 1109(2), 183-190). The EME system usually consists of a sample phase, a supported liquid membrane (SLM) and a receptor phase, wherein the SLM usually consists of a porous polymer membrane and an organic solvent in the pores. The basic principle of EME is to achieve selective transmembrane migration of analytes by ionization under electric field drive. Gel electromembrane extraction (G-EME) is a variant of EME, which uses agarose gel membrane instead of organic solvent as SLM (Journal of Chromatography A 2017, 1497, 47-55). As a green extraction method, gel electroporation has been widely used in biological, environmental, pharmaceutical and food analysis (TrAC Trends in Analytical Chemistry 2023, 160, 116990; Talanta 2021, 224; Food Chemistry 2021, 358, 129857; Environmental Chemistry Letters 2020, 18(1), 187-196; Food Chemistry 2022, 382, ​​132344). However, due to the high electro-endosmotic (electro-endosmotic) phenomenon and the difficulty in preparing stable gel membranes, the development of gel electroporation faces great challenges, especially for the extraction of acidic large molecular weight analytes.

[0003] A major issue with gel electromembrane extraction (GEME) is the adverse effects of electroendosmosis, which is caused by the presence of anionic groups such as sulfate and carboxyl groups in the gel. Electroendosmosis propels liquid from the anode through the gel to the cathode. During gel electromembrane extraction of acidic analytes, electroendosmosis and electromigration driving forces coexist in opposite directions, resulting in electroendosmosis that reduces extraction efficiency and increases the sample solution volume while decreasing the receptor solution volume. Therefore, electroendosmosis is a hurdle that must be overcome in the development of gel electromembrane extraction technology. Efforts to reduce electroendosmosis have been made by researchers, including modifying the gel and changing the EME setup (TrAC Trends in Analytical Chemistry 2023, 160, 116990; Microchem. J. 2020, 153, 104520; Journal of Chromatography A 2023, 1688, 463714; Journal of Pharmaceutical and Biomedical Analysis 2020, 184, 113175). For example, adding crown ethers or dextrins to agarose membranes can reduce electro-endosmosis, thereby achieving the purpose of improving the recovery rate of target analytes (chromium and zinc ions) (Microchem.J.2020,153,104520; Talanta 2022,238,123031). In addition, some people have tried to use organic solvents instead of aqueous receptor phases, the so-called two-phase gel electro-membrane extraction, which helps to reduce electro-endosmosis (Journal of Pharmaceutical and Biomedical Analysis 2021,195,113862). However, the above methods have specific usage scenarios, for example, two-phase gel electro-membrane extraction is only suitable for extracting non-polar analytes. Therefore, finding a more general and thorough method to inhibit electro-endosmosis remains a challenging key issue.

[0004] Another problem with gel electromembrane extraction is how to prepare a thin and stable gel membrane. In existing gel electromembrane extraction devices, the gel membrane is loaded at the bottom of the centrifuge tube and lacks support (Journal of Chromatography A 2017, 1497, 47-55). When the gel membrane thickness is less than 5 mm, the possibility of membrane shedding increases (Journal of Chromatography B 2020, 1159, 122401). When the membrane is as thin as 3 mm, it is difficult to obtain a constant gel membrane (Food Chemistry 2021, 358, 129857). In previous gel electromembrane extraction devices, the membrane is usually relatively thick, which is not conducive to the efficiency of gel electromembrane extraction. On the one hand, thick membranes increase the migration path of analytes and increase the chance of analytes being trapped in the gel (Food Chemistry 2021, 358, 129857). On the other hand, an overly thick membrane will cause the current to be too low, and the electromigration driving force will be weakened to a certain extent, which has a negative impact on the mass transfer of large molecular weight analytes.

[0005] Due to these two issues, EME separation of nucleic acid analytes (acidic, polar, and large molecular weight) has not yet been achieved. In summary, effectively suppressing the high electro-endosmotic pressure during gel electro-membrane extraction and improving the stability of the gel membrane during gel electro-membrane extraction are crucial to the development of this technology. Summary of the Invention

[0006] The present invention aims to create a modular electromembrane extraction device with limited cathode solution space. Based on this, it provides a gel electromembrane extraction method with low electroendosmosis and a stable film, which is then applied to oligonucleotide extraction. The device of the present invention can suppress electroendosmosis during gel electromembrane extraction and produce a stable gel film (as thin as 1 mm), enabling efficient extraction of functional oligonucleotides such as primers and microRNA within 15 minutes.

[0007] According to a first aspect of the present invention, an electromembrane extraction device is provided, comprising a module II and at least one module I, wherein each module I and module II comprises two integrally formed hollow cylinders of different diameters, wherein the two hollow cylinders of different diameters corresponding to each module I and module II are connected to a common central axis and have two ends of one larger diameter and one smaller diameter, wherein the smaller diameter end of the module II is closed, and the smaller diameter end of the module I is used to mount an extraction membrane;

[0008] The module II is used to connect to the cathode, and the module I is used to connect to the anode;

[0009] When there is only one module I, the smaller diameter hollow cylinder of the module I is inserted into and riveted into the larger diameter hollow cylinder of the module II, so as to limit the cathode solution space in the module II;

[0010] When there are multiple modules I, the smaller diameter hollow cylinder of one module I is used to be inserted into and riveted into the larger diameter hollow cylinder of module II, and the other modules I are used to be connected to the module I in sequence to achieve limited cathode solution space in module II.

[0011] Preferably, the number of modules I is 1-5.

[0012] Preferably, the end with a smaller diameter of the module I has a mesh structure.

[0013] Preferably, the extraction membrane is an organic membrane or a gel membrane.

[0014] Preferably, the module I and module II are obtained by 3D printing using polylactic acid filaments as raw materials.

[0015] According to another aspect of the present invention, a method for electromembrane extraction using any one of the devices is provided. When there is only one module I, the method comprises the following steps:

[0016] S1: Install the organic membrane to the end of the smaller diameter of module I and apply an organic solvent, or transfer the unsolidified gel liquid to the end of the smaller diameter of module I until it is completely solidified into a gel membrane; then add the receptor solution;

[0017] S2: Add the sample solution to the hollow cylinder with a smaller diameter of the module II, and fill the entire hollow cylinder with a smaller diameter of the module II with the sample solution; then insert and rivet the hollow cylinder with a smaller diameter of the module I into the hollow cylinder with a larger diameter of the module II, and make the extraction membrane contact with the sample solution; insert the anode and cathode into the receptor solution and the sample solution respectively, and connect the anode and cathode to a power supply to realize electromembrane extraction;

[0018] When there are two or more modules I, the method is the following method 1 or method 2;

[0019] Method 1 includes the following steps:

[0020] S1: Install an organic membrane to the smaller diameter end of each module I and apply an organic solvent, or transfer an unsolidified gel solution to the smaller diameter end of each module I until it is completely solidified into a gel membrane; then add a receptor solution to each module I, and fill the smaller diameter hollow cylinders of each module I except the top module I with the receptor solution, and the top module I may be filled or not filled;

[0021] S2: Add the sample solution to the hollow cylinder with a smaller diameter of the module II, and fill the entire hollow cylinder with a smaller diameter of the module II with the sample solution; then insert and rivet the hollow cylinder with a smaller diameter of one of the modules I into the hollow cylinder with a larger diameter of the module II, and make the extraction membrane contact with the sample solution; connect the remaining modules I upward to one of the modules I in sequence, insert the anode and cathode into the receptor solution of the uppermost module I and the sample solution of the module II, respectively, and connect the anode and cathode to a power supply to realize electromembrane extraction;

[0022] Method 2 includes the following steps:

[0023] S1: Install an organic membrane to the end of the smaller diameter of each module I and apply an organic solvent, or transfer an unsolidified gel liquid to the end of the smaller diameter of each module I until it is completely solidified into a gel membrane; then add a sample solution to one of the modules I, and fill the hollow cylinder of the smaller diameter of the module I with the sample solution; add a receptor solution to the remaining modules I, and fill the hollow cylinder of the smaller diameter of each module I except the top module I with the receptor solution, and the top module I may be filled or not filled;

[0024] S2: Add the receptor solution to the smaller diameter hollow cylinder of module II, and fill the entire smaller diameter hollow cylinder of module II with the receptor solution; then insert the smaller diameter hollow cylinder of module I with the sample solution added into the larger diameter hollow cylinder of module II and rivet it, and make the extraction membrane contact with the sample solution; connect the remaining modules I upwards to the module I with the sample solution added, insert the anode and cathode into the receptor solution of the top module I and the sample solution of module II respectively, and connect the anode and cathode to the power supply to realize electromembrane extraction.

[0025] Preferably, the gel solution is an agarose gel solution or a polyacrylamide gel solution.

[0026] According to another aspect of the present invention, there is provided application of the electromembrane extraction method for oligonucleotide extraction.

[0027] Preferably, the oligonucleotide is a primer or microRNA.

[0028] In general, the above technical solutions conceived by the present invention have the following technical advantages compared with the existing technology:

[0029] (1) The present invention suppresses electroendosmosis in gel electromembrane extraction systems by limiting the cathode solution space. Currently, the cathode space in existing gel electromembrane extraction devices is open or not fully filled, which leaves room for electroendosmosis to drive liquid flow. The present invention, through carefully designed modules and their assembly, forms a closed space within the module where the cathode solution is placed, and fills it with the solution. Therefore, electroendosmosis makes it difficult for the liquid to flow across the membrane toward the cathode, thereby achieving the purpose of suppressing electroendosmosis.

[0030] (2) The present invention improves the preparation method of gel SLM membranes and greatly enhances their stability. The main reason for the instability of gel membranes in previous gel electromembrane extraction systems is their lack of support. The present invention increases the stability of the gel membrane by attaching it to a mesh structure during the preparation process, thereby obtaining a stable membrane with a thickness of less than 3 mm. This helps to enhance the electric driving force and shorten the migration path, enabling the extraction of larger molecular weight analytes such as oligonucleotides.

[0031] (3) Preferably, in the present invention, when there is only one module I and one module II, the sample solution is first filled into module II during extraction, and then modules I and II are assembled together in sequence to form a closed space inside module II. Due to space limitations, it is difficult for electro-endosmosis to push the liquid toward the negative electrode during the EME process. The method for inhibiting electro-endosmosis in the present invention is simple and reliable, does not require the addition of additional chemical reagents to the extraction system, and is applicable to gel electro-membrane extraction of any target object. It is a green, thorough, and universal method for overcoming electro-endosmosis.

[0032] (4) Preferably, in the present invention, when there are multiple modules I and only one module II, extraction is performed in two situations. In the first situation, the sample phase is located in the bottom module II, and all modules I above module II are receptor solutions. Since the electromigration rates of oligonucleotides of different lengths are different, gradient extraction can be achieved by controlling the concentration and thickness of the gel membranes on different modules I, extraction time, voltage and other parameters. For example, the gel membrane on a module I adjacent to module II adopts a low-concentration, low-thickness membrane so that oligonucleotides of all lengths can pass through quickly, and the gel membranes on the remaining modules I above it adopt a high-concentration, high-thickness membrane so that only short oligonucleotides can pass through quickly. However, long oligonucleotides are difficult to pass through quickly, and oligonucleotides of different lengths can eventually be extracted into the receptor solutions of different modules I; the second situation is that the bottom module II contains the receptor solution, the first module I above module II contains the sample solution, and the remaining modules I all contain the receptor solution. A cathode is inserted into module II, and an anode is inserted into the top module I. At this time, the anionic target (oligonucleotide) and cationic target (such as metal ions) in the sample solution can migrate upward (towards the anode) and downward (towards the cathode) respectively, thereby realizing bidirectional extraction; among them, the oligonucleotides migrating upward can refer to situation one to realize gradient extraction when passing through multiple modules I.

[0033] (5) The technical solution used in the present invention can be applied to the extraction of oligonucleotides including primers and microRNA, and the extraction is completed within 15 minutes. It is a green, fast, and highly capable molecular biology sample pretreatment method. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 It is a structural schematic diagram of the electromembrane extraction device in the present invention: (a) is a 3D schematic diagram of module I and module II in this device, wherein the A end of module I is open, the A end of module II is closed, and the B ends of both are open; (b) is a physical picture of module I and module II; (c) is a module of different volumes; (d) is a rendering of the gel membrane encapsulated at the A end of module I; (e) is a rendering of the polypropylene membrane encapsulated at the A end of module I; (f) is a three-phase electromembrane extraction device assembled from a module I and a module II; (g) is a five-phase electromembrane extraction device assembled from two modules I and a module II; wherein: 1-module I, 2-module II.

[0035] Figure 2 This is a flow chart of the low electroosmotic gel membrane extraction process of the present invention.

[0036] Figure 3 The present invention is applied to the effect diagram of primer recovery: (a) is the GAPDH gene amplification curve based on the recovery primer pair of the present invention; (b) is the C of the initial primer and the recovery primer for qPCR reaction respectively. T value.

[0037] Figure 4 : This is a comparison between the low electroosmotic gel electromembrane extraction method of the present invention and the existing method: (a) is a schematic diagram and a physical picture of the electromembrane extraction method of the present invention, in which the sample is located in a closed space; (b) is the existing gel electromembrane extraction form, in which the sample is located in the open space of a beaker; (c) is the residual volume of the receptor solution after extraction; (d) is a comparison of the recovery rates of the two groups of oligonucleotides.

[0038] Figure 5 Schematic diagram of the present invention applied to microRNA extraction: (a) the sample pretreatment method of the present invention combined with RT-qPCR is used to detect the level of miR-181b in the blood of schizophrenia patients and healthy controls; (b) ROC curve of miR-181b as a diagnostic indicator for schizophrenia. DETAILED DESCRIPTION

[0039] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely for the purpose of explaining the present invention and are not intended to limit the present invention. In addition, the technical features involved in the various embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

[0040] The technical solutions involved in the present invention are:

[0041] (1) Design and manufacture of electromembrane extraction modules ( Figure 1 ). Preferably, polylactic acid filaments with a diameter of 1.75 mm are used as raw materials to print two EME modules (module I and module II) in a 3D printer. Figure 1 As shown, preferably, the EME module is cylindrical, and different modules can be assembled vertically and securely riveted together. Preferably, the A-end of EME module I has a mesh structure, while the A-end of EME module II is closed, and the B-ends of both are open. Preferably, the diameter of the A-end of the EME module is equivalent to that of a 2ml centrifuge tube, allowing it to be placed on a universal mixer. Preferably, the main printing parameters are: layer height 0.2mm; density 30%; printing speed: 40mm / s; nozzle temperature: 210°C; bed temperature: 70°C.

[0042] (2) Assembly and application of modular gel electromembrane extraction system ( Figure 2 ). Preferably, the gel solution that has not yet solidified is quickly transferred to the bottom (end A) of module I and naturally cooled for 1 hour until it is completely solidified into a gel to obtain an agarose gel film of a certain thickness. Preferably, 500 μL of receptor solution is added to module I and 1 mL of sample solution is added to module II. Then the A end of module I is inserted into the B end of module II, and the A end of module II is placed on a mixer. Preferably, platinum wires are inserted into the receptor solution and the sample solution as anode and cathode electrodes, respectively. Connect the two electrodes to a power supply, turn on the power supply and agitator to start extraction. After a period of time, the receptor solution is aspirated from module I with a pipette for testing.

[0043] When there are two or more modules I, the extraction method is the following method 1 or method 2;

[0044] Method 1 includes the following steps:

[0045] S1: Install the organic membrane to the end of the hollow cylinder with a smaller diameter of each module I that is farther from the hollow cylinder with a larger diameter, or transfer the unsolidified gel liquid to the end of the hollow cylinder with a smaller diameter of each module I that is farther from the hollow cylinder with a larger diameter, until it is completely solidified into a gel membrane; then add the receptor solution to each module I, and make the receptor solution fill the hollow cylinder with a smaller diameter of each module I except the top module I, and the top module I may be filled or not filled;

[0046] S2: Add the sample solution to the hollow cylinder with a smaller diameter of the module II, and fill the entire hollow cylinder with a smaller diameter of the module II with the sample solution; then insert and rivet the hollow cylinder with a smaller diameter of one of the modules I into the hollow cylinder with a larger diameter of the module II, and make the extraction membrane contact with the sample solution; connect the remaining modules I upward to one of the modules I in sequence, insert the anode and cathode into the receptor solution of the uppermost module I and the sample solution of the module II, respectively, and connect the anode and cathode to a power supply to realize electromembrane extraction;

[0047] Method 2 includes the following steps:

[0048] S1: Install the organic membrane to the end of the hollow cylinder with a smaller diameter of each module I that is farther from the hollow cylinder with a larger diameter, or transfer the unsolidified gel liquid to the end of the hollow cylinder with a smaller diameter of each module I that is farther from the hollow cylinder with a larger diameter, until it is completely solidified into a gel membrane; then add the sample solution to one of the modules I, and make the sample solution fill the hollow cylinder with a smaller diameter of the module I; add the receptor solution to the remaining modules I, and make the receptor solution fill the hollow cylinder with a smaller diameter of each module I (1) except the top module I (1), and the top module I (1) may be filled or not;

[0049] S2: Add the receptor solution to the smaller diameter hollow cylinder of module II, and fill the entire smaller diameter hollow cylinder of module II with the receptor solution; then insert the smaller diameter hollow cylinder of module I with the sample solution added into the larger diameter hollow cylinder of module II and rivet it, and make the extraction membrane contact with the sample solution; connect the remaining modules I upwards to the module I with the sample solution added, insert the anode and cathode into the receptor solution of the top module I and the sample solution of module II respectively, and connect the anode and cathode to the power supply to realize electromembrane extraction.

[0050] Preferably, the gel can be agarose gel or polyacrylamide gel, etc. This type of gel has adjustable pore size and the pores are filled with water, which is suitable for the separation and purification of polar analytes such as oligonucleotides.

[0051] The following are specific embodiments

[0052] Example 1

[0053] The present invention is used to extract a PCR amplification primer pair for GAPDH gene under optimized extraction conditions. The sequences of the primer pair are GAPDH-F primer: ATGGGGAAGGTGAAGGTCG; and GAPDH-R primer: GGGGTCATTGATGGCAACAATA.

[0054] Two EME modules (Module I and Module II) were printed in a 3D printer using 1.75 mm diameter polylactic acid filament as the raw material. The specific dimensions of the modules are as follows: Figure 1 The printing parameters are as follows: layer height 0.2 mm, infill 30%, printing speed 40 mm / s, nozzle temperature 210°C, and bed temperature 70°C.

[0055] Add agarose powder to 1×TAE solution (agarose mass concentration 3%) and heat in a microwave for 90 seconds to completely dissolve the agarose. Then quickly transfer 125 μL to the bottom of module I (end A) and cool naturally for 1 hour until it is completely solidified to obtain an agarose gel membrane with a thickness of 3 mm. Add 500 μL of 1×TAE solution to module I and 1 mL of sample solution containing 0.5 μM primer pair to module II. Then insert the A end of module I into the B end of module II ( Figure 2 ), place the A end of Module II on a mixer. Insert platinum wires as the anode and cathode electrodes in the receptor solution and sample solution, respectively, and connect both electrodes to a power source. Turn on the power and mixer to begin extraction. After 15 minutes, remove the receptor solution from Module I with a pipette. Use fluorescent quantitative PCR to test primer recovery.

[0056] Finally, the GAPDH gene primer pair was successfully recovered, and the recovered primers obtained a good amplification curve when they were further used for GAPDH gene amplification ( Figure 3 Compared with the initial primer at 0.5 μM, the recovery primer provided a slightly larger cycle threshold ( Figure 3 b) The results show that the multiple oligonucleotide extraction based on the present invention is feasible, and more importantly, the function of the extracted DNA remains intact.

[0057] Example 2

[0058] The residual volume and recovery rate of the receptor solution after electromembrane extraction of the sample solution in a closed space (module in the present invention) and an open space (such as a beaker) were compared, as shown in FIG. Figure 4 a and Figure 4As shown in b. The experiment used 1 ml of GAPDH-F primer (0.5 μM) in 1×TAE buffer as the sample solution and 0.5 mL of 1×TAE buffer as the receptor solution. To simulate high electro-endosmotic conditions, a 3 mm thick 1% agarose gel membrane was used and extraction was performed at 50 V for 15 min. Figure 4 c and Figure 4 As shown in d in FIG, the gel electromembrane extraction device of the present invention significantly reduces the adverse effects of electro-endosmosis and improves the recovery rate.

[0059] Example 3

[0060] The present invention is used to extract miR-181b from plasma under optimized extraction conditions. The microRNA sequence is AACAUUCAUUGCUGUCGGUGGGU

[0061] Two EME modules (Module I and Module II) were printed in a 3D printer using 1.75 mm diameter polylactic acid filament as the raw material. The specific dimensions of the modules are as follows: Figure 1 The printing parameters are as follows: layer height 0.2 mm, infill 30%, printing speed 40 mm / s, nozzle temperature 210°C, and bed temperature 70°C.

[0062] Add agarose powder to 1×TAE solution (agarose mass concentration 3%) and heat in a microwave for 90 seconds to completely dissolve the agarose. Then quickly transfer 125 μL to the bottom of module I (end A) and cool naturally for 1 hour until it is completely solidified to obtain an agarose gel film with a thickness of 3 mm. Add 500 μL of 1×TAE solution to module I and add 1 mL of plasma sample to module II. Then insert the A end of module I into the B end of module II ( Figure 2 ), place the A end of module II on a mixer. Insert platinum wires as the anode and cathode electrodes in the receptor solution and sample solution, respectively, and connect both electrodes to a power source. Turn on the power and mixer to begin extraction. After 15 minutes, aspirate the receptor solution from module I with a pipette. Determine the concentration of miR-181b using fluorescent quantitative PCR (stem-loop primer method).

[0063] Finally, the plasma miR-181b levels in 25 patients diagnosed with schizophrenia and 17 healthy controls were determined. Figure 5 As shown in a, ΔC T The value was significantly lower than that of the healthy control group. The area under the receiver operating characteristic curve analysis was 0.865 ( Figure 5b). Although the selectivity of the extraction method of the present invention is limited compared to traditional EME due to the absence of an organic solvent in the membrane, it can effectively separate and measure microRNA in plasma when combined with highly specific detection methods such as RT-qPCR.

[0064] It will be easily understood by those skilled in the art that the above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An electromembrane extraction device, characterized in that: The invention comprises a module II (2) and at least one module I (1), wherein the module I (1) and the module II (2) each comprise two integrally formed hollow cylinders of different diameters, wherein the two hollow cylinders of different diameters corresponding to each module I (1) and module II (2) are connected to a common central axis and have two ends of one larger diameter and one smaller diameter, wherein the end of the module II (2) with a smaller diameter is closed, and the end of the module I (1) with a smaller diameter is used for installing an extraction membrane; the extraction membrane is a gel membrane; and the end of the module I (1) with a smaller diameter has a mesh structure; The module II (2) is used to connect to the cathode, and the module I (1) is used to connect to the anode; When there is only one module I (1), the smaller diameter hollow cylinder of the module I (1) is inserted into and riveted into the larger diameter hollow cylinder of the module II (2) to achieve a restricted cathode solution space in the module II (2); When there are multiple modules I (1), the smaller diameter hollow cylinder of one module I (1) is used to be inserted into and riveted into the larger diameter hollow cylinder of module II (2), and the other modules I (1) are used to be connected in sequence with the one module I (1) to achieve the limitation of the cathode solution space in module II (2).

2. The electromembrane extraction device according to claim 1, characterized in that: The number of modules I (1) is 1-5.

3. The electromembrane extraction device according to any one of claims 1 to 2, characterized in that: The module I (1) and the module II (2) are obtained by 3D printing using polylactic acid filaments as raw materials.

4. A method for electromembrane extraction using the device according to any one of claims 1 to 3, characterized in that: When the module I (1) is one, the method comprises the following steps: S1: Transfer the unsolidified gel solution to the smaller diameter end of module I (1) until it is completely solidified into a gel film; then add the receptor solution; S2: Add the sample solution into the hollow cylinder with a smaller diameter of the module II (2), and allow the sample solution to fill the entire hollow cylinder with a smaller diameter of the module II (2); then insert the hollow cylinder with a smaller diameter of the module I (1) into the hollow cylinder with a larger diameter of the module II (2) and rivet it, and allow the gel membrane to contact the sample solution; insert an anode and a cathode into the receptor solution and the sample solution respectively, and connect the anode and cathode to a power supply to realize electromembrane extraction; When there are two or more modules I (1), the method is the following method 1 or method 2; Method 1 includes the following steps: S1: Transfer the unsolidified gel solution to the smaller diameter end of each module I (1) until it is completely solidified into a gel film; then add the receptor solution to each module I (1) and fill the smaller diameter hollow cylinders of each module I (1) except the top module I (1) with the receptor solution. The top module I (1) may be filled or not filled; S2: Add the sample solution to the hollow cylinder with a smaller diameter of the module II (2), and fill the entire hollow cylinder with a smaller diameter of the module II (2); then insert and rivet the hollow cylinder with a smaller diameter of one of the modules I (1) into the hollow cylinder with a larger diameter of the module II (2), and make the gel membrane contact with the sample solution; connect the remaining modules I (1) upward to one of the modules I (1) in turn, insert the anode and cathode into the receptor solution of the top module I (1) and the sample solution of the module II (2), respectively, and connect the anode and cathode to a power supply to realize electromembrane extraction; Method 2 includes the following steps: S1: Transfer the unsolidified gel solution to the end of the smaller diameter of each module I (1) until it is completely solidified into a gel film; then add the sample solution to one of the modules I (1) and fill the hollow cylinder with the smaller diameter of the module I (1) with the sample solution; add the receptor solution to the remaining modules I (1) and fill the hollow cylinder with the smaller diameter of each module I (1) except the top module I (1) with the receptor solution, and the top module I (1) may be filled or not filled; S2: Add the receptor solution to the hollow cylinder with a smaller diameter of the module II (2), and fill the entire hollow cylinder with a smaller diameter of the module II (2); then insert the hollow cylinder with a smaller diameter of the module I (1) to which the sample solution has been added and rivet it into the hollow cylinder with a larger diameter of the module II (2), and make the gel membrane contact with the receptor solution; connect the remaining modules I (1) upwards to the module I (1) to which the sample solution has been added, insert an anode and a cathode into the receptor solution of the top module I (1) and the receptor solution of the module II (2), respectively, and connect the anode and cathode to a power supply to realize electromembrane extraction.

5. The method of electromembrane extraction according to claim 4, characterized in that: The gel solution is agarose gel solution or polyacrylamide gel solution.

6. the method for electromembrane extraction as claimed in claim 5 is used for the application of oligonucleotide extraction.

7. The use according to claim 6, characterized in that The oligonucleotide is a primer or microRNA.

Images