A highly efficient and stable firefly luciferase mutant and its application

Abstract

The present invention belongs to the field of genetic engineering, and specifically discloses a novel firefly luciferase variant and its application in rapid detection of microbial content and as a reporter gene. The novel firefly luciferase mutant disclosed in the present invention has significantly improved catalytic activity and thermal stability, and the luminescent wavelength is easier to pass through the cell membrane and is more sensitive to low-concentration microorganisms. Therefore, the novel firefly luciferase variant is more suitable for rapid detection of microbial content and use as a reporter gene.

Description

Technical Field

[0001] The invention relates to a firefly luciferase mutant with high activity and high thermal stability, belonging to the technical field of genetic engineering. Background Art

[0002] Bioluminescence is the phenomenon of light production and emission by organisms. It is widely found in organisms including bacteria, fungi, marine and terrestrial animals, and has a variety of biological functions. One of the most widely studied bioluminescent systems is from the North American firefly ( Photinus pyralis ) luciferase ( Photinus pyralis Firefly luciferase catalyzes the oxidation of D-luciferin in the presence of adenosine triphosphate (ATP), magnesium and oxygen to produce oxyluciferin and emit yellow-green light at a wavelength of 560 nm.

[0003] Firefly luciferase, as a reporter gene for studying gene expression and protein interactions, has been widely used in biotechnology and medical research. Its advantages include high sensitivity, low background noise, and non-invasiveness, making it a valuable tool in a variety of applications. In addition, based on the positive correlation between luminescence intensity and ATP amount, firefly luciferase is also often used for rapid quantitative detection of microorganisms.

[0004] However, there are still many limitations to the use of North American firefly luciferase. Desirable properties of luciferase in biological applications include lower Km values ​​for ATP and D-luciferin to increase the sensitivity of the luciferase reaction to the substrate; improved thermal stability to prolong the bioluminescence in vivo by extending the half-life of the enzyme; and emission of light with a longer wavelength to enhance its ability to penetrate cells and tissues.

[0005] In order to meet these needs, researchers have made great efforts to improve the properties of the enzyme. Using gene modification technologies such as site-specific mutagenesis and directed evolution, a series of key residues related to enzyme activity and thermal stability have been identified, which fundamentally promoted the optimization and practical application of luciferase. Fujii et al. and Noda et al. identified and studied the triple mutant LGR of PpyLuc containing I423L, D436G, and L530R mutations through random mutagenesis and screening techniques. Compared with the wild type, the LGR mutation significantly enhanced the enzyme activity, and the K of ATP and D-luciferin was 2.3447M, 1.322M, and 1.787M, respectively. m The value is reduced by 20 times, k cat Increased 4 times.

[0006] Finding and developing luciferases from other species has been shown to be an effective way to promote their application in bioluminescence. Photuris Pennsylvania ) isolated two luciferases, PpeLuc1 and PpeLuc2. Compared with the North American luciferase, the mutant variant of PpeLuc2, PpeLuc2 T249M (PpeT249M), showed significantly improved enzyme activity. Keith V. Wood further modified PpeT249M and used directed evolution technology to produce a series of highly heat-resistant mutant enzymes. According to the information disclosed in the corresponding patent, a series of mutant enzymes represented by Ppe146-1H2 can maintain stable enzyme activity for at least 10 hours at 50°C. In addition, this increased thermal stability did not sacrifice the activity of the enzyme, and Ppe146-1H2 showed catalytic ability comparable to that of PpeT249M. Ppe146-1H2 has excellent thermal stability and high catalytic activity, and therefore has broad application prospects.

[0007] In this study, we further modified and optimized the Pennsylvania firefly luciferase mutant Ppe146-1H2, introduced I422L, D435G, and I529R mutations in the structural region near the C-terminus of the protein, and generated the mutant Ppe146-LGR, hoping to obtain higher enzyme activity while maintaining thermal stability. At the same time, the basic enzymatic properties of the Ppe146-LGR mutant were fully characterized, providing necessary data for the application of this mutant enzyme. Summary of the invention

[0008] The technical problems to be solved by the present invention are:

[0009] (1) Wild-type North American firefly luciferase has poor thermal stability, requires strict transportation and storage conditions, and has stringent reaction temperature requirements, which severely limits its practical application.

[0010] (2) The optimal temperature for wild-type firefly luciferase is 23°C. After being introduced into cells as a reporter gene, its environment is basically around 37°C, and it takes 24 hours of culture to show fluorescence intensity. This results in low overall luminescence intensity and rapid light intensity decay, which seriously affects the accuracy of the experiment.

[0011] (3) The wild-type firefly luciferase has a low substrate affinity. When used as a reporter gene, the concentration of D-luciferin penetrating into cells is low, resulting in low luminescence intensity. When used for rapid determination of microbial content, low concentrations of microorganisms produce low ATP content, thus affecting the sensitivity of the detection.

[0012] (4) Although the mutant Pennsylvania firefly luciferase Ppe146-1H2 has good thermal stability, its optimum temperature is as high as 55°C. When used as an intracellular reporter gene (37°C), it still cannot exert excellent catalytic ability. At the same time, there is still a lot of room for improvement in the catalytic activity of Ppe146-1H2.

[0013] The I422L, D435G, and I529R are mutations of isoleucine, aspartic acid, and isoleucine at positions 422, 435, and 529 to leucine, glycine, and arginine, respectively.

[0014] The amino acid sequence of the mutated Pennsylvania firefly luciferase Ppe146-LGR is:

[0015] SEQ ID No. 1=

[0016] Met Ala Asp Lys Asn Ile Leu Tyr Gly Pro Glu Pro Phe Tyr Pro Leu GluAsp Gly Thr 20

[0017] Ala Gly Glu Gln Met Phe Asp Ala Leu Ser Arg Tyr Ala Ala Ile Pro GlyCys Ile Ala 40

[0018] Leu Thr Asn Ala His Thr Lys Glu Asn Val Leu Tyr Glu Glu Phe Leu LysLeu Ser Cys 60

[0019] Arg Leu Ala Glu Ser Phe Lys Lys Tyr Gly Leu Lys Gln Asn Asp Thr IleAla Val Cys 80

[0020] Ser Glu Asn Ser Leu Gln Phe Phe Leu Pro Val Ile Ala Ser Leu Tyr LeuGly Ile Ile 100

[0021] Val Ala Pro Val Asn Asp Lys Tyr Ile Glu Arg Glu Leu Ile His Ser LeuGly Ile Val 120

[0022] Lys Pro Arg Ile Val Phe Cys Ser Lys Asn Thr Phe Gln Lys Val Leu AsnVal Lys Ser 140

[0023] Lys Leu Lys Ser Ile Glu Thr Ile Ile Ile Leu Asp Leu Asn Glu Asp LeuGly Gly Tyr 160

[0024] Gln Cys Leu Asn Asn Phe Ile Ser Gln Asn Ser Asp Ser Asn Leu Asp ValLys Lys Phe 180

[0025] Lys Pro Tyr Ser Phe Asn Arg Asp Asp Gln Val Ala Ser Ile Met Phe SerSer Gly Thr 200

[0026] Thr Gly Leu Pro Lys Gly Val Met Leu Thr His Lys Asn Ile Val Ala ArgPhe Ser Leu

[0027] Ala Lys Asp Pro Thr Phe Gly Asn Ala Ile Asn Pro Thr Ser Ala Ile LeuThr Val Ile

[0028] Pro Phe His His Gly Phe Gly Met Met Thr Thr Leu Gly Tyr Phe Thr CysGly Phe Arg 260

[0029] Val Val Leu Met His Thr Phe Glu Glu Lys Leu Phe Leu Gln Ser Leu GlnAsp Tyr Lys 280

[0030] Val Glu Ser Thr Leu Leu Val Pro Thr Leu Met Ala Phe Leu Ala Lys SerAla Leu Val

[0031] Glu Lys Tyr Asp Leu Ser His Leu Lys Glu Ile Ala Ser Gly Gly Ala ProLeu Ser Lys 320

[0032] Glu Ile Gly Glu Met Val Lys Lys Arg Phe Lys Leu Asn Phe Val Arg GlnGly Tyr Gly 340

[0033] Leu Thr Glu Thr Thr Ser Ala Val Leu Ile Thr Pro Lys Gly Asp Ala LysPro Gly Ser 360

[0034] Thr Gly Lys Ile Val Pro Phe His Ala Val Lys Val Val Asp Pro Thr ThrGly Lys Ile 380

[0035] Leu Gly Pro Asn Glu Pro Gly Glu Leu Tyr Phe Lys Gly Pro Met Ile MetLys Gly Tyr 400

[0036] Tyr Asn Asn Glu Glu Ala Thr Lys Ala Ile Ile Asp Asn Asp Gly Trp LeuArg Ser Gly 420

[0037] Asp Leu Ala Tyr Tyr Asp Asn Asp Gly His Phe Tyr Ile Val Gly Arg LeuLys Ser Leu 440

[0038] Ile Lys Tyr Lys Gly Tyr Gln Val Ala Pro Ala Glu Ile Glu Gly Ile LeuLeu Gln His 460

[0039] Pro Tyr Ile Val Asp Ala Gly Val Thr Gly Ile Pro Asp Glu Ala Ala GlyGlu Leu Pro 480

[0040] Ala Ala Gly Val Val Val Gln Thr Gly Lys Tyr Leu Asn Glu Gln Ile ValGln Asp Tyr 500

[0041] Val Ala Ser Gln Val Ser Thr Ala Lys Trp Leu Arg Gly Gly Val Lys PheLeu Asp Glu 520

[0042] Ile Pro Lys Gly Ser Thr Gly Lys Arg Asp Arg Lys Val Leu Arg Gln MetLeu Glu Lys 540

[0043] His Thr Asn Gly 544

[0044] The present invention also provides a recombinant prokaryotic vector and a recombinant bacterium containing a gene encoding the amino acid sequence shown in SEQ ID No. 1.

[0045] The recombinant vector is constructed by connecting the gene encoding the amino acid sequence shown in SEQ ID No. 1 to the pET28a expression vector to construct the recombinant vector pET28a-Ppe146-LGR.

[0046] The recombinant bacteria are obtained by transforming the above recombinant prokaryotic vector into Escherichia coli BL21 (DE3).

[0047] The present invention also provides a recombinant eukaryotic plasmid pmirGLO-Ppe146-LGR containing a gene encoding an amino acid sequence shown in SEQ ID No. 1 as a reporter gene.

[0048] The recombinant eukaryotic plasmid replaces the firefly luciferase reporter gene in the pmirGLO plasmid with a gene expressing the amino acid sequence shown in SEQ ID No. 1.

[0049] The present invention also provides the use of the above-mentioned recombinant eukaryotic plasmid as a reporter gene in HEK293 cells.

[0050] Compared with the prior art, the present invention has the following beneficial effects:

[0051] (1) The present invention starts with rationally designing and modifying the molecular structure of Pennsylvania firefly luciferase, and the optimal catalytic temperature of the obtained luciferase mutant Ppe146-LGR is around 40 °C. Under the reaction conditions of 37 °C, its affinity and conversion rate for ATP are 25 times and 4.4 times that of PpyLuc, and 2.3 times and 1.6 times that of Ppe146-1H2 respectively; its affinity and conversion rate for D-luciferin are 19.8 times and 4.3 times that of PpyLuc, and 2.3 times and 1.7 times that of Ppe146-1H2 respectively. Therefore, the catalytic activity of Ppe146-LGR under 37 °C conditions is significantly improved compared with both PpyLuc and Ppe146-1H2, reflecting its great advantages as a reporter gene and for rapid detection of microbial content.

[0052] (2) The luciferase mutant Ppe146-LGR obtained by the present invention has good thermal stability. PpyLuc completely lost its activity after 5 min at 40°C. After 16 h at 40°C and 55°C, the catalytic activity of the luciferase mutant Ppe146-LGR was retained by 91% and 82%, respectively, which was not significantly reduced compared with Ppe146-1H2. Therefore, the storage and reaction conditions of Ppe146-LGR are more relaxed, and it is more suitable as a reporter gene and for rapid microbial detection.

[0053] (3) The strongest luminescence wavelength of the luciferase mutant Ppe146-LGR catalyzed reaction obtained by the present invention is 580nm, which is longer than that of PpyLuc and Ppe146-1H2. Longer wavelengths are easier to pass through the cell membrane and be collected by the instrument. Therefore, Ppe146-LGR is more suitable as a reporter gene for intracellular and animal living imaging.

[0054] (4) The luciferase mutant Ppe146-LGR obtained by the present invention has a stronger affinity for D-luciferin. When used as a reporter gene, it can catalyze the emission of stronger light intensity when the intracellular D-luciferin concentration is low, and is more suitable as a reporter gene for intracellular and animal living imaging. The luciferase mutant Ppe146-LGR obtained by the present invention has a stronger affinity for ATP and is more sensitive to low concentrations of microorganisms, and is therefore more suitable for rapid detection of microorganisms. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1: Sequence alignment of PpeT249M, Ppe146-1H2 and Ppe146-LGR. The residues highlighted in rectangles are the LGR mutated residues of Ppe146-LGR.

[0056] Figure 2: SDS-PAGE electrophoresis of firefly luciferase and its mutants.

[0057] Figure 3: Optimal reaction pH and temperature of firefly luciferase and its mutants.

[0058] Figure 4: Comparison of thermal stability of firefly luciferase and its mutants.

[0059] Figure 5: Comparison of luminescence spectra of firefly luciferase and its mutants.

[0060] Figure 6: Plasmid map of pmirGLO constructed by Ppe146-LGR replacement.

[0061] Figure 7: Improved performance of Ppe146-LGR for detecting microbial content.

[0062] Figure 8: Improved performance of Ppe146-LGR as a reporter gene for intracellular imaging. DETAILED DESCRIPTION

[0063] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. It should be noted that the described embodiments only represent some embodiments of the present invention, not all embodiments. According to the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work also belong to the protection scope of the present invention. The dosage mentioned in the present invention is determined according to national technical specifications and actual production conditions. Unless otherwise specified, the raw materials used in the present invention are all purchased commercially.

[0064] Example 1

[0065] Mutation, expression, and purification of Pennsylvania firefly luciferase.

[0066] a. The amino acid sequence of the mutant firefly luciferase Ppe146-1H2 was mutated from isoleucine, aspartic acid and isoleucine to leucine, glycine and arginine at positions 422, 435 and 529, respectively (Figure 1), and its amino acid sequence is shown in SEQ ID NO. 1. According to the codon preference of Escherichia coli, the gene coding region sequence of the luciferase mutant was optimized to obtain the firefly luciferase variant gene sequence.

[0067] b. Add a restriction endonuclease Nde I site at the 5' end of the firefly luciferase variant gene sequence, add a restriction endonuclease Hind III site at the 3' end of the optimized sequence, perform full gene synthesis (Hefei Youkang Gene Technology Co., Ltd.), and connect it into the prokaryotic expression vector pET28a (purchased from Novagen) between the Nde I site and the Hind III site to obtain the recombinant prokaryotic expression plasmid pET28a-Ppe146-LGR.

[0068] c. The obtained recombinant prokaryotic expression plasmid pET28a-Ppe146-LGR was transformed into Escherichia coli BL21 (DE3) by heat shock method, cultured on LB plates containing kanamycin at a final concentration of 30 μg / ml, and single colonies were picked for sequencing identification.

[0069] d. Take a single colony containing the recombinant positive plasmid and inoculate it into LB liquid culture medium containing a final concentration of 30μg / ml kanamycin. Incubate it at 37°C and 200rpm for 12 to 16 hours with shaking. Inoculate the cultured bacterial liquid into fresh LB liquid culture medium containing 30μg / ml kanamycin at a volume ratio of 1%. Incubate it at 37°C and 200rpm with shaking until the bacterial liquid concentration OD600 is 0.4 to 0.8. Add inducer IPTG to a working concentration of 1mM. Continue to culture at 18°C ​​for 24 hours. Collect the bacteria by centrifugation at 4°C and 8000rpm for 10 minutes.

[0070] e. Wash the collected bacteria by centrifugation twice with PBS, add PBS with a volume of 1 / 10 of the LB medium to fully suspend the bacteria, add PMSF to a working concentration of 1 mM, mix well, and ultrasonically disrupt on ice at a power of 200 W, 5 seconds for 5 seconds, 10 minutes at intervals, then centrifuge at 4°C, 8000 rpm for 30 minutes, and take the supernatant containing soluble total protein.

[0071] f. Using Ni-NTA agarose chromatography column, first use 5 times column volume of equilibration buffer (20mM phosphate, 500mMNaCl, 5mM imidazole, pH 7.8) to equilibrate the column, and load the supernatant containing soluble total protein at a rate of 1mL / min. When all the supernatant in the column flows out of the medium, add elution buffer (20mM phosphate, 500mMNaCl, 500mM imidazole, pH 7.8) for elution, collect in separate tubes, identify the purity of the target protein in each tube by SDS-PAGE, collect the components with a purity greater than 95%, and store in glycerol. The luciferase mutant Ppe146-LGR was detected by SDS-PAGE electrophoresis, and the electrophoresis results are shown in Figure 2.

[0072] Example 2

[0073] Detection of enzymatic properties of the luciferase mutant Ppe146-LGR.

[0074] Prepare the reaction buffer according to the formula of 10 mM DTT, 1 mM MgSO4, 0.5 mM EDTA, and 20 mM Tris.

[0075] Dissolve ATP and D-luciferin in the prepared reaction buffer to obtain a 6 mM ATP solution and a 600 μM D-luciferin solution.

[0076] The purified firefly luciferase solution was diluted with binding buffer to a final concentration of 1 mg / ml.

[0077] The total volume of the firefly luciferase reaction system is 450 μl, and the specific components are 435 μl of reaction buffer, 5 μl of ATP solution, 5 μl of D-luciferin solution, and 5 μl of enzyme solution.

[0078] After the firefly luciferase reaction system was prepared, it was mixed and allowed to stand for 2 min, and the luminescence intensity was detected using a bioluminescence detector.

[0079] Reaction buffers with pH values ​​of 5.0, 6.0, 7.0, 7.5, 8.0, and 8.5 were prepared, and the luminescence intensity of Ppe146-LGR, Ppe146-1H2, and PpyLuc in the buffers was detected at 25°C, and the reaction was repeated three times.

[0080] As shown in Figure 3 , the optimal reaction pH of Ppe146-LGR was 7.5, and the optimal reaction pH of PpyLuc and Ppe146-1H2 was 8.0.

[0081] Reaction buffers with pH values ​​of 7.5 and 8.0 were prepared and placed in a thermostatic metal bath at 20°C, 25°C, 35°C, 40°C, 45°C, 55°C, 65°C, 75°C and 85°C, respectively. The luminescence intensities of Ppe146-LGR (pH=7.5), PpyLuc (pH=8.0) and Ppe146-1H2 (pH=8.0) at the above temperatures were measured.

[0082] As shown in Figure 3 , the optimal reaction temperature of Ppe146-LGR was 40 °C, the optimal reaction temperature of PpyLuc was 25 °C, and the optimal reaction temperature of Ppe146-1H2 was 55 °C.

[0083] Therefore, the optimal reaction temperature of Ppe146-LGR is closest to the optimal temperature of cell culture (37°C), making it more suitable for use as a reporter gene in cultured cells.

[0084] Luciferase activity was measured at 37°C using the above reaction system at different ATP concentrations ranging from 0.6 to 240 μM and different D-luciferin concentrations ranging from 1.2 to 110 μM. Each reaction was repeated 3 times. The Michaelis-Menten equation was fitted using GraphPad Prism 6 software to calculate the apparent K m and k cat value.

[0085] Apparent K of Ppe146-LGR, Ppe146-1H2, and PpyLuc m and k cat The values ​​are shown in Table 1.

[0086] Table 1 Enzymatic parameters of Ppe146-LGR, Ppe146-1H2, and PpyLuc.

[0087] Enzyme <![CDATA[ K m for ATP]]> <![CDATA[ K m for D-luciferin(μM)]]> <![CDATA[ k cat (RLU / nM)]]> <![CDATA[ k cat / K m for ATP]]> <![CDATA[ k cat / K m for D-luciferin]]> Luc 51.8 ± 5.2 37.6 ± 3.4 <![CDATA[3.2 × 10 3 ]]> <![CDATA[0.6 × 10 2 ]]> <![CDATA[0.8 × 10 2 ]]> 146-1H2 5.1 ± 0.6 4.4 ± 0.3 <![CDATA[8.5 × 10 3 ]]> <![CDATA[1.7 × 10 3 ]]> <![CDATA[1.9 × 10 3 ]]> 146-LGR 2.2 ± 0.2 1.9 ± 0.1 <![CDATA[1.4 × 10 4 ]]> <![CDATA[6.3 × 10 3 ]]> <![CDATA[7.3 × 10 3 ]]>

[0088] As shown in Table 1 , under reaction conditions at 37°C, the affinity and conversion rate of Ppe146-LGR for ATP were 25 times and 4.4 times that of PpyLuc, and 2.3 times and 1.6 times that of pe146-1H2, respectively; its affinity and conversion rate for D-luciferin were 19.8 times and 4.3 times that of PpyLuc, and 2.3 times and 1.7 times that of Ppe146-1H2, respectively.

[0089] Therefore, the catalytic activity of Ppe146-LGR at 37°C was significantly improved compared with that of PpyLuc and Ppe146-1H2, reflecting its great advantages as a reporter gene and for rapid detection of microbial content.

[0090] The enzyme solution was incubated three times in a thermostatic metal bath at 25°C, 45°C and 55°C, respectively. The enzyme solution was taken out of the thermostatic metal bath at appropriate time intervals and stored on ice until the luminescent reaction was detected.

[0091] As shown in Figure 4, PpyLuc completely lost its activity after 5 minutes at 40 °C. The catalytic activity of the luciferase mutant Ppe146-LGR was retained by 91% and 82% after 16 hours at 40 °C and 55 °C, respectively, which was not significantly reduced compared with Ppe146-1H2.

[0092] Therefore, Ppe146-LGR has looser requirements for storage and reaction conditions and is more suitable as a reporter gene and for rapid microbial detection.

[0093] 100 μl of the prepared pe146-LGR, PpyLuc and Ppe146-1H2 reaction systems were added to a 96-well black board. Each firefly luciferase was repeated 3 times and the luminescence spectrum was scanned in the range of 450 nm-740 nm using a multifunctional microplate reader (MD).

[0094] As shown in Figure 5, the strongest emission wavelength of pe146-LGR is 580 nm, the strongest emission wavelength of PpyLuc is 560 nm, and the strongest emission wavelengths of Ppe146-1H2 are 550 nm and 570 nm. The strongest emission wavelength of pe146-LGR is longer, and it is easier to penetrate the cell membrane and be collected by the instrument, which improves the accuracy of detection.

[0095] Therefore, Ppe146-LGR is more suitable as a reporter gene for in vivo animal imaging.

[0096] Example 3

[0097] The luciferase mutant Ppe146-LGR was used to rapidly detect microbial concentrations.

[0098] Take the concentration as 10 9 The E. coli solution with a concentration of 10 CFU / ml was diluted 10-fold to obtain a concentration of 10 5 , 10 3 and 10 2 CFU / ml of Escherichia coli solution.

[0099] Take 20 μl of the above bacterial solution and mix it with 100 μl of bacterial lysis buffer (Biyuntian), and lyse it at room temperature for 15 min.

[0100] The enzyme solutions used in the detection were PpyLuc and Ppe146-LGR enzyme solutions with a concentration of 1 mg / ml.

[0101] The luminescence reaction detection system of firefly luciferase is: 485 μl reaction buffer, 5 μl enzyme solution, and 10 μl lysed bacterial solution.

[0102] The reaction buffer formula is 10 mM DTT, 1 mM MgSO4, 0.5 mM EDTA, 20 mM Tris, 100 μM fluorescein. The pH of the reaction buffer is 8.0 when detecting PpyLuc, and the pH of the reaction buffer is 7.5 when detecting Ppe146-LGR.

[0103] After mixing the components in the above luminescent reaction system, let it stand at 25°C for 2 min, and use a bioluminescence detector produced by Hygiena to detect the luminescence intensity.

[0104] As shown in Figure 6, compared with PpyLuc, Ppe146-LGR 5 CFU / ml and 10 3 CFU / ml bacterial solution, the luminescence intensity increased by 12.99 times and 13.91 times, respectively, improving the accuracy of the detection; 2 When the luminescence intensity was 0.1447× that of PpyLuc, the detection sensitivity was improved.

[0105] Therefore, when Ppe146-LGR is used to rapidly detect microbial concentrations, it can significantly improve the accuracy and sensitivity of detection.

[0106] Example 4

[0107] The luciferase mutant Ppe146-LGR was used as a reporter gene.

[0108] The synthesized Ppe146-LGR gene sequence was used as a template for PCR amplification. The PCR amplification conditions were 94°C, pre-denaturation for 5 min; 94°C for 50 s, 52°C for 1 min, 72°C for 1 min30 s, 35 cycles; 72°C for 10 min. The PCR product was recovered using a gel recovery kit after electrophoresis. The primers used in PCR were FW: GTTGGTAAAGCCACCATGGCAGACAAAAATATTC; RV: CGTTTAAACAACTAGAATCATCAGCCGTTGGTATG.

[0109] The recovered PCR products were recovered using the Tiangen Gum Recovery Kit, and then the Ppe146-LGR gene was homologously recombined with the pmirGLO plasmid (a commonly used dual reporter gene plasmid containing the PpyLuc gene and the Renilla luciferase gene) using the Homologous Recombination Seamless Cloning Kit (Quanshijin), so that the Ppe146-LGR gene replaced the original PpyLuc gene on the pmirGLO plasmid. The resulting recombinant expression vector was named pmirGLO-Ppe146-LGR (Figure 7).

[0110] Add 1 g PEI40000 powder (Yisheng) into 900 mL Mi-Q" ultrapure water and stir evenly on a magnetic stirrer.

[0111] After PEI40000 is completely dissolved, adjust the pH to 6.80-6.90 with hydrochloric acid (12 mol / L) or sodium hydroxide (1 mol / L) solution.

[0112] Transfer the solution into a measuring cylinder and add water to make up to 1 L.

[0113] Sterilize by filtration using a disposable 0.22 μm PES vacuum filter to obtain a 1 mg / ml stock solution.

[0114] Inoculation of cells: To improve transfection efficiency, it is recommended to inoculate cells into a 6-well plate one day before transfection, so that the cell density is preferably 70%~80% during transfection.

[0115] Prepare DNA-PEI complex: Prepare DNA-PEI nucleic acid-transfection reagent complex according to the following system: For each well of cells, dilute 2 μg pmirGLO-Ppe146-LGR plasmid with 100 μl serum-free medium and mix thoroughly to make DNA dilution solution.

[0116] Immediately add 4 μl of PEI40000 transfection reagent to 100 μl of DNA dilution buffer and mix gently.

[0117] Incubate at room temperature for 10-15 min to allow the DNA-PEI cationic nucleic acid transfection reagent complex to form.

[0118] During the complex formation process, remove the cell growth medium and add 2 mL of fresh pre-warmed complete medium (90% DMEM + 10% fetal bovine serum) to each well.

[0119] Directly add 100 μl of DNA-PEI nucleic acid-PEI complex to the cells and shake the culture plate to mix gently.

[0120] The cells were cultured in a 37°C, 5% CO2 incubator, and the enzyme activity was detected by using Firefly Luciferase Activity Assay Kit (Biyuntian) and Renilla Luciferase Activity Assay Kit (Biyuntian) after 12 h, 24 h, and 36 h, respectively.

[0121] The Renilla luciferase reporter gene was used as an internal reference gene to calibrate the results of the reporter gene, thereby effectively reducing experimental errors caused by uneven cell numbers and inconsistent transfection efficiency. First, trypsin was used to digest the cells on the well plate, and then the cells were resuspended with 400 μL PBS to obtain a cell suspension. Take 200 μL of the cell suspension and centrifuge at 1000 rpm for 5 min to obtain a cell pellet. Add 100 μL of cell lysis buffer to the pellet, store it at room temperature for 5 min, centrifuge it at 13,000×g for 4 min, and take the supernatant for determination. Add 100 μL of Renilla luciferase detection reagent to the supernatant, and measure the luminescence intensity of the mixture with a multifunctional microplate reader (MD). Take the remaining 200 μL of cell suspension, centrifuge it at 1000 rpm for 5 min, and obtain a cell pellet. Resuspend the cells with 200 μL of firefly luciferase detection reagent and shake slowly for 10 min at room temperature in the dark. Use a multifunctional microplate reader (MD) to detect the luminescence intensity of the mixture.

[0122] As shown in Figure 8, 24 h after infection, the catalytic luminescence intensity of Ppe146-LGR in the cells was 3.58 times higher than that of PpyLuc; 48 h after infection, the catalytic luminescence intensity of Ppe146-LGR in the cells was 8.39 times higher than that of PpyLuc.

[0123] Therefore, the catalytic luminescence intensity and enzyme activity stability of Ppe146-LGR as a reporter gene in cells are significantly improved, which can effectively improve the accuracy of the experiment.

Claims

1. A novel firefly luciferase variant, characterized in that: Containing the amino acid sequence as described in any one of 1) to 2): 1) the amino acid sequence shown in SEQ ID No.1; 2) The amino acid sequence of the fusion protein obtained by connecting a signal peptide and / or a tag to the N-terminus and / or C-terminus of the amino acid sequence shown in SEQ ID No.

1.

2. A biomaterial, characterized in that: A biological material comprising any one of a) to c), a) containing a nucleic acid molecule encoding the amino acid sequence shown in SEQ ID NO.1; b) a recombinant vector containing the nucleic acid molecule described in a); c) A recombinant cell containing the nucleic acid molecule described in a) or the recombinant vector described in b).

3. The biomaterial according to claim 2, characterized in that The recombinant vector is a prokaryotic system expression vector or a eukaryotic system expression vector; the prokaryotic system expression vector is an Escherichia coli expression vector; the eukaryotic system expression vector is a yeast expression vector, an insect cell expression vector, or a mammalian cell expression vector; and as claimed in claim 2a), the sequence of the nucleic acid molecule is a plasmid vector of a reporter gene.

4. The biomaterial according to claim 2, characterized in that The recombinant cell is a prokaryotic cell or a eukaryotic cell. The prokaryotic cell is Escherichia coli; the eukaryotic cell is a yeast cell, an insect cell, or a mammalian cell.

Images