Application of rice miR5513 in rice resistance to brown planthopper

Abstract

The present application belongs to the field of botany and genetic engineering technology, and more particularly, the present application relates to the application of rice miR5513 in the resistance of rice to brown planthopper; the present application down-regulates or knocks out the expression of miR5513 or its precursor in rice susceptible to pests based on target mimicry and CRISPR / Csa9 technology, thereby enhancing the resistance of rice to brown planthopper; compared with traditional chemical control, improving the resistance of crops through genetic engineering is a more environmentally friendly and sustainable solution. It reduces the amount and frequency of pesticide use, reduces environmental pollution and damage to the ecosystem, and the research results of the present application have reference significance for the study of gene molecular function and breeding.

Description

Technical Field

[0001] This invention belongs to the fields of botany and genetic engineering technology, and more specifically, this invention relates to the application of rice miR5513 in rice resistance to brown planthopper. Background Technology

[0002] Rice is a major food crop in my country and the world, and its production is directly related to my country's food security, farmers' income, and rural stability. The brown planthopper is the most prevalent and widespread pest of rice, primarily congregating at the base of the rice leaf sheaths and sucking sap from the phloem with its needle-like mouthparts. This causes the lower part of the rice plant to turn black, become paralyzed and lodged, and large areas of rice fields to wither, resulting in reduced yields or even crop failure. Therefore, controlling the development and damage caused by the brown planthopper is a crucial requirement for ensuring the safety of rice production. Discovering and utilizing brown planthopper-resistant genes in rice, elucidating the resistance mechanism, and cultivating brown planthopper-resistant rice varieties for widespread application in production are the most economical, effective, environmentally friendly, and ecologically safe preferred measures for controlling this major agricultural pest.

[0003] MicroRNAs (miRNAs) are a class of small, non-coding RNAs, approximately 20–24 nucleotides in size, widely found in plants. They can bind to the complementary sequence of target gene mRNAs, degrade target genes, or inhibit their translation. By controlling gene expression at the posttranscriptional level, they participate in the regulation of various plant biological functions, such as regulating plant growth and development and resistance to pests and diseases. Summary of the Invention

[0004] To address the aforementioned problems, this invention discloses the application of rice miR5513 in rice resistance to brown planthopper.

[0005] The objective of this invention is achieved through the following technical solution.

[0006] In a first aspect of the invention, a method for improving the traits of rice is provided, the method comprising: downregulating the expression of miR5513 or its precursor in rice, or knocking out miR5513 or its precursor in rice.

[0007] In a preferred embodiment, the improved rice traits include:

[0008] Increase rice's resistance to brown planthopper.

[0009] In another preferred embodiment, the downregulation of miR5513 or its precursor in rice includes: downregulating the expression of miR35513 or its precursor using a miR5513 silencing agent based on target mimicry technology, or knocking out miR5513 or its precursor using an sgRNA expression cassette based on CRISPR / Cas9 technology.

[0010] In another preferred embodiment, the method for downregulating miR5513 expression using a miR5513 silencing agent based on target mimicry technology includes:

[0011] (1) The mimicry miR5513 sequence was placed into the ips gene sequence to obtain the ips-MIM5513 sequence fragment;

[0012] (2) The ips-MIM5513 sequence fragment was transferred into rice to obtain transgenic plants, which are improved rice.

[0013] In another preferred embodiment, the method for knocking out miR5513 or its precursor using a CRISPR / Cas9-based sgRNA expression cassette includes:

[0014] (1) The knockout sites were analyzed based on the miRNA precursor sequence using the online software CRISPR-P. Two target sites were selected on the positive and negative strands of the miRNA, adapter primers were designed, and the sgRNA expression cassette of miR5513 was constructed to obtain the sgRNA miR5513 sequence fragment.

[0015] (2) The sgRNA expression cassette was ligated into the CRISPR / Cas9 vector and transformed into rice to obtain miR5513 knockout plants, which are improved rice.

[0016] In another preferred embodiment, Agrobacterium tumefaciens is used to transfer the ips-MIM5513 sequence fragment or the miR5513 sgRNA expression cassette into rice.

[0017] In another aspect of the invention, there is a use for downregulating or knocking out miR5513 or its precursor for improving traits in rice, comprising:

[0018] Increase rice's resistance to brown planthopper.

[0019] In a preferred embodiment, the downregulation or knockout is a miR5513 silencing variant based on target mimicry technology that specifically downregulates miR5513 or its precursor expression, or a CRISPR / Cas9-based sgRNA expression cassette.

[0020] In another preferred embodiment, the rice is a cereal crop belonging to the Poaceae family.

[0021] In another aspect of the invention, a miR5513 silencing agent for improving rice traits is provided, the miR5513 silencing agent being constructed based on target mimicry technology, comprising the mimicry miR5513 sequence located in the ips gene sequence.

[0022] In another aspect of the invention, an expression vector comprising the miR5513 silencing agent is provided.

[0023] In another aspect of the invention, a host cell comprising the miR5513 silencing agent is provided.

[0024] Compared with existing technologies, the present invention has the following advantages and beneficial effects:

[0025] 1. Enhancing Rice Resistance to Brown Planthopper: This invention significantly enhances rice's resistance to the brown planthopper pest by downregulating or knocking out miR5513 or its precursor in rice. This is of great significance for reducing pesticide use, protecting the ecological environment, and ensuring food security.

[0026] 2. Reducing weight gain and honeydew secretion after feeding by brown planthoppers: Experimental results showed that the improved rice exhibited significantly reduced leaf sheath weight gain and honeydew secretion after being fed by brown planthoppers. This indicates that downregulation or knockout of miR5513 affects the growth and metabolism of brown planthoppers, thereby further weakening their ability to damage rice.

[0027] 3. Providing multiple technical means to achieve target gene regulation: This invention not only proposes a method for constructing miR5513 silencing agents using target mimicry technology, but also introduces a strategy for knocking out miR5513 or its precursors using sgRNA expression cassettes based on CRISPR / Cas9 technology.

[0028] 4. Promoting the Development of Agricultural Biotechnology: The implementation and application of this invention will promote the progress and development of the agricultural biotechnology field, especially in providing new ideas and methods for crop insect-resistant breeding. Both methods have their advantages, offering researchers more choices and flexibility. This will help cultivate more rice varieties with superior traits to meet the needs of modern agricultural production.

[0029] 5. Environmentally Friendly Solutions: Compared to traditional chemical control, improving crop resistance through genetic engineering is a more environmentally friendly and sustainable solution. It reduces the amount and frequency of pesticide use, thus lowering environmental pollution and ecosystem damage. Attached Figure Description

[0030] Figure 1 Spectra of the pBSK (pBluescript II SK(+)) vector;

[0031] Figure 2 A schematic diagram of the construction of the MIM5513 plasmid;

[0032] Figure 3 Spectrum of the pCXUN vector;

[0033] Figure 4 A) Map of CRISPR / sgRNA vectors; B) Overall structure of 8 basic sgRNA intermediate vectors; C) BsaI restriction site sequences in 12 sgRNA vectors; D) Representative regular and irregular target sites and their OsU6a promoter target linkers and post-transcriptional 5′ sequences.

[0034] Figure 5 A map of the CRISPR / Cas9 binary vector;

[0035] Figure 6 A. Schematic diagram of the miR5513 silencing body; B. miR5513 knockout site (marked in red) in the miR5513 knockout plant (KO5513); C. miR5513 expression level in the miR5513 mimicry transgenic plant and the knockout plant.

[0036] Figure 7 A) Resistance phenotypes of MIM5513 and KO5513 plants to brown planthopper; B) Leaf sheaths of both MIM5513 and KO5513 plants showed resistance to brown planthopper; C) Statistical graph of resistance values ​​of MIM5513 and KO5513 plants; D) Statistical graph of brown planthopper weight gain after feeding on MIM5513 and KO5513 plants; E) Statistical graph of honeydew secretion by brown planthoppers after feeding on MIM5513 and KO5513 plants. Detailed Implementation

[0037] Through in-depth research, the inventors discovered that miR5513 is closely related to seed traits and disease resistance in rice. Downregulating or knocking out miR5513 can increase seed length and width, increase the thousand-grain weight and yield per plant, and promote plant disease resistance. Therefore, miR5513, or substances and methods for regulating miR5513, can be applied to improve plant varieties.

[0038] As used herein, "plant" refers to a plant that expresses miR5513 or its precursor. This includes rice.

[0039] As used herein, "miR5513" refers to miR5513 of the genus *Oryza*. Those skilled in the art will understand that, given the high sequence similarity between miRNAs (or their precursors), downregulating subsequently discovered miR5513-like sequences can regulate seed traits and disease resistance in rice, achieving the same technical effect as the miR5513 downregulation verified in the embodiments of this invention.

[0040] The miR5513 sequence involved in this invention has significant application value in theoretical research and plant improvement. This sequence can be applied to studies on disease resistance and yield in specific plants such as rice.

[0041] A method for improving traits of rice, the method comprising: downregulating the expression of miR5513 or its precursor in rice, or knocking out miR5513 in rice.

[0042] After understanding the purpose of miR5513, various methods well-known to those skilled in the art can be used to downregulate or knock out the expression of miR5513, and these methods can all be included in this invention. For example, various methods well-known to those skilled in the art can be used to interfere with or cause the expression of miR5513 to be absent.

[0043] As one embodiment of the present invention, a method for reducing or knocking out the expression of miR5513 in plants is provided, the method comprising:

[0044] (1) Construct a miR5513 silencing agent based on target mimicry technology, which includes the mimicry miR5513 sequence in the ips gene sequence and located in the ips gene sequence, or construct a miR5513 sg RNA expression cassette based on CRISPR / Cas9 technology.

[0045] (2) Transform the miR5513 silencer or sgRNA expression cassette obtained in (1) into plant cells, tissues, organs or seeds to obtain plant cells, tissues, organs or seeds transformed with the interference molecule;

[0046] (3) Regenerate plants from plant cells, tissues, organs or seeds that have been transfected with the miR5513 silencing agent or sgRNA expression cassette obtained in step (2).

[0047] This invention also provides substances for downregulating or knocking out miR5513 or its precursor, which improve plant traits by downregulating miR5513 or its precursor. These substances can be nucleic acid inhibitors, antagonists, downregulators, retardants, blockers, etc., as long as they can downregulate or knock out the expression level of miR5513 or its precursor. The biomolecules can be at the nucleic acid level (including DNA and RNA) or at the protein level.

[0048] The substance used to downregulate or knock out miR5513 or its precursor can be any substance that can prevent miR5513 (especially its key binding sites) or its precursor from binding to its target sequence, reduce the activity of miR5513 or its precursor, reduce the stability of miR5513 or its precursor, downregulate or knock out the expression of miR5513 or its precursor, or reduce the effective duration of miR5513 or its precursor. Such substances can be used in this invention as useful for downregulating or knocking out miR5513. For example, the inhibitors are: nucleic acid inhibitors, protein inhibitors, antibodies, ligands, nucleases, nucleic acid binding molecules, as long as they can downregulate or knock out the expression of miR5513.

[0049] In a preferred embodiment of the present invention, the substance comprises an interfering molecule that specifically downregulates or knocks out miR5513 or its precursor, a miR5513 silencing agent based on target mimicry technology, or a miR5513 sgRNA expression cassette based on CRISPR / Cas9 technology. More preferably, the mimicry miR5513 sequence is placed in the ips gene sequence to obtain the ips-MIM5513 sequence fragment; or the miR5513 sgRNA expression cassette is designed, the fragment is placed in a suitable vector, and plants are transformed to obtain transgenic plants with improved traits.

[0050] This invention also provides expression vectors containing the ips-MIM5513 sequence or miR5513 sgRNA expression cassette, preferably plant expression vectors; more preferably expression vectors suitable for subsequent transgenic operations (such as transgenic operations using Agrobacterium). Methods well known to those skilled in the art can be used to construct expression vectors containing the promoter and / or target gene sequence described in this invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0051] This invention also provides genetically engineered host cells containing an ips-MIM5513 sequence or an sgRNA expression cassette of miR5513, or a vector containing an ips-MIM5513 sequence or an sgRNA expression cassette. The host cells are typically plant cells. Transformation of plants can generally be performed using methods such as Agrobacterium-mediated transformation or gene gun transformation, for example, leaf disc transformation or rice embryo transformation; Agrobacterium-mediated transformation is preferred. Transformed plant cells, tissues, or organs can be regenerated into plants using conventional methods, thereby obtaining plants with altered traits compared to the wild type.

[0052] In a preferred embodiment of the present invention, “miR5513” is an RNA having the sequence SEQ ID NO.1.

[0053] In a specific embodiment of this invention, the inventors cloned the rice miR5513 gene and constructed a transgenic plant with competitive downregulation of miR5513 (MIM5513) using target mimicry technology, and a transgenic plant with miR5513 knocked out (KO5513) using CRISPR / Cas9 technology. Analysis showed that both MIM5513 and KO5513 plants exhibited significant resistance to brown planthoppers. MIM5513 and KO5513 plants have application value in improving the resistance of rice to brown planthoppers.

[0054] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the manufacturer's recommendations.

[0055] In this invention, the miR5513 sequence is as shown in SEQ NO.1 = 5'-UAACAAAGGA CAACAGACUG A-3'.

[0056] The miR5513 precursor sequence is shown in SEQ NO.2=5'-GTCATTATTC TTCAGTCCGT TGTCCTTTGTGATAACATAT CTGTACTTAT ACGTTTGTTC ATTTAGGATA GACAAGGCTC AAAGCCACGCTAGCTGACATTAGCCGGAT ATGTTATAAC AAAGGACAAC AGACTGAAGA ATAATGA-3'.

[0057] Example 1

[0058] Construction of MIM5513 transgenic plants.

[0059] The Arabidopsis thaliana IPS1 gene is induced to express under phosphorus deficiency stress. Arabidopsis thaliana was cultured under phosphorus-deficient conditions, and total RNA was extracted and converted to cDNA. Based on the full-length cDNA sequence of IPS1, amplification primers ipsF and ipsR were designed at both ends of the CDS region. PCR amplification was performed using Arabidopsis thaliana cDNA, followed by digestion with BamHI and SacI, and ligation into the intermediate vector pBSK. Figure 1 ).

[0060] ipsF (BamHI) sequence: 5'-gtggatccAAGAAAAATGGCCATCCCCTAGC-3' (SEQ ID NO. 25);

[0061] ipsR (SacI) sequence: 5'-ctggagctcGAGGAATTCACTATAAAGAGAATCG-3' (SEQ ID NO. 26).

[0062] The mimicry miR5513 sequence is designed as follows:

[0063] 5'-TAACAAAGGACtagaAACAGACTGA-3' (SEQ ID NO. 3).

[0064] The addition of "taga" in the sequence greatly enhances the ability of MIM5513 to bind to the target gene, thereby making normal miR5513 uncompetitive when binding to the target gene, thus achieving the goal of downregulating normal miR5513.

[0065] Based on the mimicry miR5513 and related sequences in the IPS1 gene (SEQ ID NO.4 = ...

[0066] aaaacacccac aaaaacaaaa gaaaaatggc catcccctag ctaggtgaagaagaatgaaaacctctaatt

[0067] tatctagagg ttattcatct tttaggggat ggcctaaata caaaatgaaaactctctaattaagtggttt

[0068] tgtgttcatg taaggaaagc gttttaagat atggagcaatgaagactgca gaaggctgattcagactgcg

[0069] agttttgttt atctccctct agaaattggg caacttctat cctttggcaa gcttcggttcccctcggaat

[0070] cagcagatta tgtatcttta attttgtaat actctctctc ttctctatgc tttgtttttcttcattatgt

[0071] ttgggttgtacccactcccg cgcgttgtgt gttctttgtg tgaggaataa aaaaatattc

[0072] ggatttgagaactaaaacta gagtagtttt attgatattc ttgtttttca tttagtatctaataagtttggagaatagtc

[0073] agaccagtgc atgtaaattt gcttccgatt ctctttatag tgaattcctctt)

[0074] Design the following MIM5513-I and MIM5513-II sequences:

[0075] MIM5513-I sequence:

[0076] 5'-cgaagctTAACAAAGGACtagaAACAGACTGAtttctagaggggagataa-3' (SEQ ID NO: 5);

[0077] MIM5513-II sequence:

[0078] 5'-cctctagaaaAGTCTGTTTCTAGTCCTTTGTTAagcttcggttcccctcg-3' (SEQ ID NO: 6)

[0079] Using the obtained intermediate vector as a template, fragments were amplified using ipsF and MIM5513-I, and ipsR and MIM5513-II as paired primers, respectively. Then, using the two cloned fragments from the above sources as templates, overlapping PCR was performed using ipsF and ipsR primers (Higuchi, R., Krummel, B., and Saiki, RK (1988). Nucleic Acids Res 16, 7351-7367), replacing mimicry miR5513 at the incomplete target site of miR399 in the IPS1 gene. Figure 2 (Bases within the dashed box) yield the corresponding ips-MIMR5513 fragment.

[0080] The final amplified fragment was subjected to an A-addition reaction and ligated into the pCXUN vector. Figure 3In this study, wild-type rice Nipponbare was transformed using Agrobacterium tumefaciens, and the ips-MIM5513 fragment was overexpressed to construct a miR5513 target mimicry (abbreviated as MIM5513) transgenic plant.

[0081] The complete sequence of the ips-MIM5513 fragment is (SEQ ID NO.7).

[0082] aaaacaccacaaaaacaaaagaaaaatggccatcccctagctaggtgaagaagaatgaaaacctctaatttatctagaggttattcatcttttaggggatggcctaaatacaaaatg aaaactctctaattaagtggttttgtgttcatgtaaggaaagcgttttaagatatggagcaatgaagactgcagaaggctgattcagactgcgagttttgtttatctccctctagaaa TAACAAAGGACtagaAACAGACTGA agcttcggttcccctcggaatcagcagattatgtatctttaattttgtaatactctctctctctctcttgctttgttttcttcattatgtttgggttgtacccactcccgcgcgttgtgtgttctttgtgtgaggaataa aaaaatattcggatttgagaactaaaactagagtagttttattgatattcttgtttttcatttagtatctaataagtttggagaatagtcagaccagtgcatgtaaatttgcttccgattctctttatagtgaattcctctt

[0083] Example 2

[0084] Construction of KO5513 transgenic plants.

[0085] Based on the pre-miR5513 sequence, the online software CRISPR-P was used.

[0086] (http: / / cbi.hzau.edu.cn / crispr) was used for knockout site analysis. Two targets were ultimately selected: the mature miR5513 and its complementary strand. Based on the target sequence and the vector sequence of the sgRNA expression cassette, miR5513 sgRNA primers were designed. An sgRNA expression cassette driven by the U6a promoter was constructed using overlapping PCR. The plasmid pYLgRNA-OsU6a ( Figure 4 Using UF as a template and UF as primers paired with 5513-U6a1 and 5513-U6a2 respectively, the U6a promoter fragment was amplified. Using gR-R as primers paired with 5513-gRT1 and 5513-gRT2 respectively, the miR5513 sgRNA fragment was amplified. Using the first-round PCR product (U6a promoter and miR5513 sgRNA) diluted 10-fold as a template, a second round of overlapping PCR was performed using universal primers Pps-GGL and Pgs-GG2, and Pps-GG2 and Pgs-GGR. Finally, the PCR product was subjected to enzyme digestion and ligation reactions using variable-temperature cycling (enzyme digestion system shown in Table 1), and the sgRNA expression cassette was assembled into the pYLCRISPR / Cas9 vector. Figure 5 The specific reaction system is shown in the table below. Wild-type rice Nipponbare was transformed using Agrobacterium tumefaciens to construct a CRISPR / Cas9 transgenic plant with the miR5513 gene (abbreviated as KO5513).

[0087] The sgRNA expression cassette sequence is shown in SEQ ID NO.8: gttttagagc tagaaatagc aagttaaaataaggctagtc cgttatcaac ttgaaaaagtggcaccgagt cggtgctttt ttt.

[0088] Target sequence:

[0089] 5'-TATGTTATAACAAAGGACAA-3'(SEQ ID NO.9),

[0090] 5'-AGCCGGATATGTTATAACAAAG-3' (SEQ ID NO. 10);

[0091] 5513-gRT1 sequence:

[0092] 5'-GCCGTATGTTATCACAAAGGACAAgttttagagctagaaat-3' (SEQ ID NO. 11);

[0093] 5513-gRT2 sequence:

[0094] 5'-GCCGTACAGATATGTTATCACAAgttttagagctagaaat-3' (SEQ ID NO. 12);

[0095] Justice-stranded sgRNA expression cassette:

[0096] tatgttataa caaaggacaa gttttagagc tagaaatagc aagttaaaataaggctagtccgttatcaac ttgaaaaagt ggcaccgagt cggtgctttt ttt (SEQ ID NO. 13);

[0097] antisense sgRNA expression cassette

[0098] agccggatat gttataacaa aggttttaga gctagaaata gcaagttaaa ataaggctag tctccgttatca acttgaaaaa gtggcaccga gtcggtgctt ttttt (SEQ ID NO. 14);

[0099] 5513-U6a1 sequence:

[0100] 5'-AAACTTGTCCTTTTGTGATAACATACggcagccaagccagca-3' (SEQ ID NO. 15);

[0101] 5513-U6a2 sequence:

[0102] 5'-AAACTTGTGATAACATATCTGTACggcagccaagccagca-3' (SEQ ID NO. 16);

[0103] UF sequence:

[0104] 5'-CTCCGTTTTACCTGTGGAATCG-3' (SEQ ID NO. 17);

[0105] gR-R sequence:

[0106] 5'-CGGAGGAAAATTCCATCCAC-3' (SEQ ID NO. 18);

[0107] Pps-GGL sequence:

[0108] 5'-TTCAGAGGTCTCTCTCGACTAGTATGGAATCGGGCAGCAAAGG-3'

[0109] (SEQ ID NO.19);

[0110] Pgs-GG2 sequence:

[0111] 5'-AGCGTGGGTCTCGTCAGGGTCCATCCACTCCAAGCTC-3' (SEQ ID NO. 20);

[0112] Pps-GG2 sequence:

[0113] 5'-TTCAGAGGTCTCTCTGACACTGGAATCGGCAGCAAAGG-3' (SEQ ID NO. 21);

[0114] Pgs-GGR sequence:

[0115] 5'-AGCGTGGGTCTCGACCGACGCGTATCCATCCACTCCAAGCTC-3'

[0116] (SEQ ID NO.22);

[0117] Table 1. Enzyme digestion-ligation reaction system of binary vector and sgRNA expression cassette

[0118] reagents Amount added (μl) Final concentration 10×CutSmartBuffer 1.5 1× 10mMATP 1.5 1mM pYLCRISPR / Cas9 plasmid 60-80ng 4-6 ng / μl sgRNA expression cassette mixture 10-15ng per expression box BsaI-HF 10U 0.1-0.2 U / μl T4 DNA ligase 35U 2-3U / μl <![CDATA[H2O]]> Final 15μl .

[0119] Example 3

[0120] Identification of miR5513 expression level and knockout site in transgenic rice plants.

[0121] Expression levels and knockout sites were identified in the T2 generation homozygous transgenic lines of the transgenic plants (MIM5513, KO5513) obtained in Examples 1 and 2. Primers were designed based on the pre-miR5513 sequence to amplify the miR5513 sequence in the genome of the miR5513 knockout plants. The results showed that, compared with the control, miR5513 had a deletion of one base on the sense strand and an insertion of one base on the antisense strand. Figure 6 B). RNA was extracted from MIM5513 and KO5513, and after reversing the cDNA, quantitative PCR was performed to verify the expression level using U6 as the housekeeping gene. The results showed that the expression level of miR5513 was downregulated in both the mimicry transgenic plant (MIM5513) and the knockout plant (KO5513). Figure 6 C).

[0122] The amplification primer sequences are as follows:

[0123] qRT5513-F:5'-TACGTTTGTTTCATTTAGGATAGACA-3'(SEQ ID NO.23)

[0124] qRT5513-R: 5'-AACATATCCGGCTAATGTCAG-3' (SEQ ID NO. 24).

[0125] Example 4

[0126] Resistance of MIM5513 and KO5513 plants to brown planthopper

[0127] 1. Seedling Group Method

[0128] In rice tea cups, susceptible control materials (Nipponbare, transgenic background material), resistant control materials (near-isogenic line of Nipponbare containing Bph6, NIP-Bph6-NIL), MIM5513, and KO5513 plants were sown respectively. Three cups were used for each material, with 15 seeds per cup, and the experiment was repeated three times. Insects were released when the plants reached the three-leaf stage, ensuring 8 insects per rice seedling. After most of the Nipponbare plants died, the resistance values ​​of MIM5513 and KO5513 plants were counted. The results showed that even after all Nipponbare plants died, MIM5513 and KO5513 plants still survived well, with lower resistance values, indicating good resistance to brown planthoppers. Figure 7 AB).

[0129] 2. Determination of insect weight gain and honeydew volume

[0130] Three cups were used to sow susceptible control materials (Nipponbare, transgenic background material), resistant control materials (near-isogenic line containing Bph6 in Nipponbare background, NIP-Bph6-NIL), MIM5513, and KO5513 plants, respectively. Each material had three cups, with six seeds per cup. When the plants reached the five-leaf stage, folded wax bags were tied to the rice stems, two bags per plant, with one brown planthopper in each bag. After 48 hours of feeding, the wax bags were removed, and the brown planthoppers and wax bags were weighed. The difference in weight of the brown planthoppers before and after feeding, as well as the difference in weight of the wax bags, were calculated. The results showed that after feeding on MIM5513 and KO5513 plants, the brown planthoppers experienced a significant increase in weight and a decrease in honeydew secretion compared to those feeding on Nipponbare, indicating that MIM5513 and KO5513 plants had good resistance to brown planthoppers. Figure 7 CD).

[0131] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Therefore, any changes and modifications made to the embodiments described herein based on the innovative concept of the present invention, or equivalent structural or procedural transformations made using the content of the present invention's specification and drawings, directly or indirectly applying the above technical solutions to other related technical fields, are all included within the scope of protection of this patent.

Claims

1. A method for increasing rice resistance to brown planthopper by downregulating miR5513 expression or knocking out the rice miR5513 gene, characterized in that, The method for downregulating rice miR5513 expression involves using a miR5513 silencing agent based on target mimicry technology to downregulate miR5513 expression, including the following steps: (1) Based on the mimicry miR5513 sequence shown in SEQ NO.3 and the IPS1 gene sequence shown in SEQ NO.4, design the MIM5513-I sequence shown in SEQ NO.5 and the MIM5513-II sequence shown in SEQ NO.6, and place them in the site between the sequence SEQ NO.27 and the sequence SEQ NO.28 in the IPS1 gene sequence to obtain the ips-MIM5513 sequence shown in SEQ NO.7; (2) The ips-MIM5513 sequence fragment shown in SEQ NO.7 was transferred into rice plants to obtain transgenic plants, which are improved rice.

2. The method according to claim 1, characterized in that, The miR5513 silencing variant was constructed based on target mimicry technology and includes the mimicry miR5513 sequence located in the ips gene sequence.

3. A method for increasing rice resistance to brown planthopper by downregulating miR5513 expression or knocking out the rice miR5513 gene, characterized in that, The rice miR5513 gene knockout was achieved by knocking out the miR5513 gene using an sgRNA expression cassette based on CRISPR / Cas9 technology, as shown in SEQ NO.

8.

4. The method according to claim 3, characterized in that, Includes the following steps: (1) The knockout sites were analyzed based on the miRNA precursor sequence using the online software CRISPR-P. Two target sites were selected on the sense strand and antisense strand of miR5513 respectively: the target sequence of the sense strand of mi5513 is shown in SEQ NO.9; the target sequence of the antisense strand of mi5513 is shown in SEQ NO.

10. Based on the target sequence, the positive linker primer 5513-gRT1 (SEQ NO. 11) and the negative linker primer 5513-gRT2 (SEQ NO. 12) were designed to construct sgRNA expression cassettes of miR5513 positive and negative strands, obtaining the miR5513 positive strand sgRNA expression cassette sequence fragments as shown in SEQ NO. 13 and the negative strand sgRNA expression cassette as shown in SEQ NO.

14. (2) The sgRNA expression cassette was ligated into the CRISPR / Cas9 vector and transformed into rice to obtain miR5513 knockout plants, which are improved rice.

5. The method according to claim 4, characterized in that, The miR5513 sgRNA expression cassette described in step (2) is constructed based on CRISPR / Cas9 technology and includes the sgRNA miR5513 sequence located in the intermediate vector; the sense and antisense strand sequences of the sgRNA miR5513 are shown in SEQ ID NO.13 and SEQ ID NO.14.

Images