Arsenic-resistant Clostridium parabenzoicacidiolyticum with synchronous nitrogen fixation and hydrogen production functions and its application

Abstract

The present invention discloses a strain of Clostridium benzoic acid-solubilizing with arsenic resistance, synchronous nitrogen fixation and hydrogen production functions and its application. The Clostridium benzoic acid-solubilizing was deposited in the Guangdong Provincial Microbial Culture Collection Center on May 30, 2024, with a deposit number of GDMCC No: 64705; the Clostridium benzoic acid-solubilizing YH01 provided by the present invention produces hydrogen and fixes nitrogen by anaerobic fermentation, while tolerating high concentrations of arsenic stress, and reducing inorganic pentavalent arsenic to As(III) intracellularly. Clostridium benzoic acid-solubilizing YH01 can fix nitrogen and produce ammonium by itself in a nitrogen-free culture medium, and has a good nitrogen fixation effect. It can be used in soil remediation to effectively improve nitrogen nutrients and reduce the application of chemical fertilizers by a certain proportion. At the same time, it can efficiently generate clean energy H 2 , can be used for the development and application of new energy, and the benzoic acid-solubilizing Clostridium YH01 can be used in soil fertility improvement, new energy H 2 It has great application potential in production and remediation of arsenic-contaminated soil.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and specifically relates to a parabenzoic acid-solubilizing Clostridium with arsenic resistance, synchronous nitrogen fixation and hydrogen production functions and an application thereof. Background Art

[0002] Nitrogen is one of the vital elements of plants. Applying nitrogen fertilizer to farmland can effectively increase crop yields. However, long-term excessive application of nitrogen fertilizer has caused a series of damages to the farmland system and ecological environment. The application of inorganic nitrogen fertilizer leads to H + Accumulation, severe soil acidification, decreased soil fertility, soil compaction, decreased microbial diversity, sub-healthy soil, especially in flooded paddy fields. Excessive nitrogen fertilizer application has aggravated N2O emissions, leading to increased greenhouse gas emissions and a serious decline in air quality. In addition, the synthesis of industrial nitrogen fertilizers requires high temperature and high pressure conditions and consumes a large amount of fossil energy, which is not conducive to the development of carbon neutrality and low-carbon technologies.

[0003] Therefore, improving nitrogen utilization efficiency and reducing nitrogen fertilizer application are of great significance for the development of green and sustainable agriculture. At present, microbial nitrogen fixation technology has attracted much attention from scholars, and microbial nitrogen fixation is expected to replace some chemical fertilizers. Soil nitrogen-fixing bacteria use nitrogenase in their bodies to reduce N2 in the atmosphere to ammonium nitrogen, which can increase the effective nitrogen content in the soil and supplement nitrogen for plants. The process is green, pollution-free, and occurs under mild conditions. However, many nitrogen-fixing bacteria find it difficult to survive in flooded rice fields and under the stress of heavy metal pollution, and their nitrogen fixation efficiency is very low.

[0004] Studies have shown that the intensity of nitrogen fixation by nitrogen-fixing bacteria decreases with the increase of Cd / Cu and As / Pb content in soil. The amount of nitrogen fixation by microorganisms in soils with low concentrations of heavy metals is 10 times that of soils with high concentrations of heavy metals. The sensitivity of nitrogen-fixing microorganisms to heavy metals limits their nitrogen fixation efficiency. The flooded environment of rice fields increases the bioavailability of arsenic. Arsenic adsorbed on the soil solid phase easily migrates to the soil solution, which has a great impact on the activity of nitrogen-fixing microorganisms and the nitrogen fixation process.

[0005] Therefore, how to improve the nitrogen fixation efficiency of microorganisms in heavy metal contaminated soil is an important and difficult problem that needs to be solved urgently. Isolating and screening nitrogen-fixing bacteria with heavy metal resistance is an effective strategy to save nitrogen in farmland and improve nitrogen fixation efficiency. Summary of the invention

[0006] The first aspect of the present invention aims to provide a strain of Clostridium benzoic acidisolutans having arsenic resistance, synchronous nitrogen fixation and hydrogen production functions.

[0007] The second aspect of the present invention aims to provide the use of the above-mentioned Clostridium parabenzoicalyticum.

[0008] The third aspect of the present invention aims to provide a method for nitrogen fixation, hydrogen production, arsenic reduction and / or environmental remediation.

[0009] The technical solution adopted by the present invention is:

[0010] The first aspect of the present invention provides a Paraclostridium benzoelyticum YH01, the taxonomic name of the Paraclostridium benzoelyticum YH01 is Paraclostridium benzoelyticum, and it was deposited in the Guangdong Provincial Microbiological Culture Collection Center on May 30, 2024, with the deposit number: GDMCCNo: 64705.

[0011] The present invention also provides a culture or fermentation product of the parabenzoic acidolyticus.

[0012] The second aspect of the present invention provides the use of the parabenzoic acid-solubilizing Clostridium YH01 or its culture or fermentation product described in the first aspect of the present invention in at least one of the following:

[0013] (a1) Nitrogen fixation;

[0014] (b1) preparing nitrogen-fixing products;

[0015] (c1) producing hydrogen;

[0016] (d1) preparing hydrogen-producing products;

[0017] (e1) Arsenic pollution remediation;

[0018] (f1) Preparation of products for arsenic pollution remediation

[0019] (g1) Environmental remediation;

[0020] (h1) Preparation of products for environmental remediation.

[0021] Preferably, the arsenic is inorganic pentavalent arsenic;

[0022] Preferably, the concentration of the inorganic pentavalent arsenic in the environment is 0 to 5 mmol / L, but not 0.

[0023] Preferably, the inorganic pentavalent arsenic is arsenic acid or arsenate.

[0024] Preferably, the arsenic pollution remediation is specifically carried out by reducing inorganic pentavalent arsenic, specifically reducing As(V) entering the cell to As(III) under the action of ArsC reductase, the functional gene is arsC, and then pumping As(III) out of the cell through the ArsA / ArsB cell membrane protein encoded by the arsA gene and arsB gene to reduce the arsenic content in the cell and alleviate arsenic toxicity.

[0025] Preferably, the reduction product As(III) is arsenous acid or arsenite.

[0026] Preferably, the environment includes but is not limited to water, soil, wetlands, and sediments.

[0027] The third aspect of the present invention provides a method for nitrogen fixation and / or hydrogen production and / or arsenic reduction and / or environmental remediation, comprising culturing the Clostridium parabenzoica-solubilizing YH01 or its culture or its fermentation product described in the first aspect of the present invention in an environment to be remediated.

[0028] Preferably, the environment includes but is not limited to water, soil, wetlands, and sediments.

[0029] Preferably, the environment is an arsenic-contaminated environment.

[0030] Preferably, the inoculation amount of the Clostridium parabenzoicacidiolyticum YH01 is 0.1-5% (v / v).

[0031] Preferably, the inoculation amount of the Clostridium parabenzoicacidiolyticum YH01 is 0.5-2% (v / v).

[0032] Preferably, the Parabenzoic acid-solubilizing Clostridium YH01 is preferably prepared by the following steps before being placed in the environment to be repaired: inoculating Parabenzoic acid-solubilizing Clostridium YH01 into a seed culture medium to obtain a Clostridium seed solution.

[0033] Preferably, the seed culture medium comprises LB medium.

[0034] Preferably, the LB medium has a formula of 8-12 g / L of tryptone, 4-6 g / L of yeast extract, 8-12 g / L of sodium chloride (NaCl), and a pH between 6.5 and 7.2, and is mainly used for rejuvenation of strains.

[0035] Preferably, in the seed culture medium, the inoculation amount of Clostridium parabenzoicacidiolyticum YH01 is 0.5%-3%, preferably 1%.

[0036] Preferably, the culture conditions are a temperature of 28 to 32° C. and a time of 10 to 36 hours; preferably a temperature of 30° C. and a time of 18 hours, with anaerobic constant temperature static culture.

[0037] Preferably, the anaerobic condition is obtained by replacing the headspace gas in the container containing the culture medium with nitrogen.

[0038] Preferably, the method for preparing the fermentation product is: inoculating seed liquid into a fermentation medium for anaerobic fermentation to obtain a fermentation liquid.

[0039] Preferably, the fermentation medium comprises TSB medium; preferably 1 / 4 TSB medium.

[0040] Preferably, the TSB medium (Tryptone Soy Broth) formula is: tryptone 16-18 g / L, soy peptone 2-4 g / L, sodium chloride 4-6 g / L, potassium dihydrogen phosphate 2-3 g / L, glucose 2-3 g / L, the balance is water, pH value 6.8-7.5; preferably: tryptone 17 g / L, soy peptone 3 g / L, sodium chloride 5 g / L, potassium dihydrogen phosphate 2.5 g / L, glucose 2.5 g / L, the balance is water, pH value 7.0±0.2.

[0041] Preferably, the fermentation conditions are 28-32° C. and the fermentation time is 36-60 h.

[0042] Preferably, the nitrogen-fixing and hydrogen-producing fermentation medium is: the substrate is glucose, a nitrogen-free medium, and its composition is preferably as follows: NaCl 4-6 g / L, K2HPO4 1-3 g / L, KH2PO4 0.4-0.6 g / L, glucose 3-5 g / L, trace element I solution 4-6 mL / L, trace element II solution 9-11 mL / L, pH 6.5-7.5; more preferably, NaCl 5 g / L, K2HPO4 2 g / L, KH2PO4 0.5 g / L, glucose 4 g / L, trace element I solution 5 mL / L, trace element II solution 5 mL / L, pH 7.0.

[0043] Preferably, the trace element I solution is composed of: NaCl 25-35 g / L, CaCl2·2H2O 0.2-0.6 g / L, MgCl2·6H2O 2-6 g / L, FeCl2·4H2O 60-100 mg / L, MnCl2·4H2O 1-3 mg / L, ZnCl2 1-3 mg / L, CuCl2·2H2O 1.0-1.4 mg / L, AlCl3 1-3 mg / L, (NH4)6Mo7O 24 ·4H2O 1~3mg / L, CoCl3·6H2O6~10mg / L, H3BO4 0.02~0.04g / L, and the balance is deionized water; more preferably, the trace element I solution is composed of: NaCl 30g / L, CaCl2·2H2O 0.4g / L, MgCl2·6H2O 4g / L, FeCl2·4H2O80mg / L, MnCl2·4H2O2mg / L, ZnCl2 2mg / L, CuCl2·2H2O 1.2mg / L, AlCl3 2mg / L, (NH4)6Mo7O 24·4H2O 2mg / L, CoCl3·6H2O 8mg / L, H3BO4 0.028g / L, the balance is deionized water.

[0044] Preferably, the trace element II solution is composed of: biotin 0.06-0.10 mg / L, folic acid 0.06-0.10 mg / L, vitamin B1 0.1-0.3 mg / L, vitamin B6 0.2-0.6 mg / L, vitamin B 12 0.1~0.3mg / L, riboflavin 0.1~0.3mg / L, niacin 0.1~0.3mg / L, p-aminobenzoic acid 0.1~0.3mg / L, pantothenic acid 0.1~0.3mg / L, and the balance is deionized water; more preferably, the trace element II solution is composed of: biotin 0.08mg / L, folic acid 0.08mg / L, vitamin B10.2mg / L, vitamin B6 0.4mg / L, vitamin B 12 0.2mg / L, riboflavin 0.2mg / L, niacin 0.2mg / L, p-aminobenzoic acid 0.2mg / L, pantothenic acid 0.2mg / L, and the balance is deionized water.

[0045] The beneficial effects of the present invention are:

[0046] The present invention screened a strain of Paraclostridium benzoelyticum YH01 with arsenic resistance, synchronous nitrogen fixation and hydrogen production functions. The taxonomic name of the Paraclostridium benzoelyticum YH01 is Paraclostridium benzoelyticum, which was deposited in the Guangdong Provincial Microbial Culture Collection Center on May 30, 2024, with a deposit number of GDMCC No: 64705; the Paraclostridium benzoelyticum YH01 provided by the present invention produces hydrogen and fixes nitrogen through anaerobic fermentation, tolerates high concentrations of arsenic stress, and reduces inorganic pentavalent arsenic to As(III) intracellularly. The bacterial agent fixes nitrogen and produces ammonium by itself in a nitrogen-free culture medium, has a good nitrogen fixation effect, and can be used in soil remediation to effectively improve nitrogen nutrients and reduce a certain proportion of chemical fertilizer application. At the same time, it can efficiently generate clean energy H2, which can be used in the development and application of new energy. Clostridium benzoate-solvating YH01 and its composite bacterial agent have great application potential in soil fertility improvement, new energy H2 production and arsenic-contaminated soil remediation. BRIEF DESCRIPTION OF THE DRAWINGS

[0047] Figure 1 The colony morphology of nitrogen-fixing, hydrogen-producing, arsenic-resistant Clostridium parabenzoicisolutans YH01;

[0048] Figure 2 This is a scanning electron micrograph of the nitrogen-fixing, hydrogen-producing, arsenic-resistant parabenzoic acid-solubilizing Clostridium YH01;

[0049] Figure 3 This is the growth curve of nitrogen-fixing, hydrogen-producing, arsenic-resistant Clostridium parabenzoicisolutans YH01;

[0050] Figure 4 The reduction efficiency and hydrogen production results of the nitrogen-fixing, hydrogen-producing arsenic-resistant Clostridium parabenzoicisolutans YH01 were investigated when different concentrations of As(V) substrates were added.

[0051] Figure 5 This is a diagram showing the results of hydrogen and ammonium production by nitrogen-fixing, hydrogen-producing, arsenic-resistant Clostridium parabenzoicisolutans YH01 in nitrogen-free fermentation medium;

[0052] Figure 6 This is an analysis of the results of hydrogen production and nitrogen fixation by the nitrogen-fixing, hydrogen-producing, arsenic-resistant Clostridium parabenzoicisolutans YH01 in the anaerobic culture system of arsenic-contaminated soil;

[0053] Figure 7 This is a diagram analyzing the efficiency of arsenic form transformation of nitrogen-fixing, hydrogen-producing, arsenic-resistant Clostridium benzoicisoluting YH01 in the anaerobic culture system of arsenic-contaminated soil. DETAILED DESCRIPTION

[0054] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0055] Example 1: Isolation and identification of an anaerobic hydrogen-producing, nitrogen-fixing, arsenic-resistant parabenzoic acid-solubilizing Clostridium YH01

[0056] 1. The strain was isolated from arsenic-contaminated paddy soil. The soil samples were collected from arsenic-contaminated paddy fields around Shimen Mine in Changde City, Hunan Province.

[0057] 1) Weigh 500g of soil into a 1L beaker, flood and activate for 1 month, weigh 10g of soil in the middle of the beaker and put it into a 100mL vial, add 60mL of ultrapure water after autoclaving, aerate with high-purity nitrogen for 30 minutes, cover with butyl rubber stopper, press on aluminum cap to seal the vial; culture in a 30℃ incubator for 28 days, add 100μL of 60mM arsenic acid to the culture system every 7 days for acclimatization and culture, take headspace gas samples every 7 days during the culture period to monitor the generated hydrogen concentration, and collect supernatant samples to monitor the conversion of arsenate. Select soil suspensions with more hydrogen production and high arsenate conversion rate as inoculants and transfer them to TSB medium containing 1mM arsenate for subculture.

[0058] The main components of TSB culture medium are: 17g / L tryptone, 3g / L soy peptone, 5g / L sodium chloride, 2.5g / L potassium dihydrogen phosphate, 2.5g / L glucose, and the balance is water, pH value 7.0±0.2, 300mL culture medium is measured and divided into 500mL capacity vials, high-purity nitrogen is aerated for 1h to replace the air in the bottle, and then sealed with butyl rubber stopper, and aluminum cap is pressed with a capping device to prevent air from entering. The sealed vials are placed in an autoclave at 121℃ for 20min, and after cooling, 30mL of acclimated soil suspension is added on the sterile operating table. After 7 passages, the soil is removed to obtain hydrogen-producing and arsenic-resistant enriched bacterial liquid.

[0059] 2) Dilute the enriched bacterial solution step by step by 10 4 ~10 7 After that, the Hungate tube rolling technique was used to isolate hydrogen-producing arsenic-resistant single colonies. 8 mL of TSB medium containing 1 mM arsenate and 1.2% agar was placed in a Hungate tube, and 0.2 mL of the enriched bacterial solution was added. The tube was rolled on an ice box and placed in a 30°C incubator for 2 days. After a single colony grew on the tube wall, it was taken out.

[0060] 3) Pick a single colony into an anaerobic vial containing 60 mL of sterilized and deoxygenated nitrogen-free culture medium with 1 mM arsenate, and place it in a 30°C incubator for 48 hours. Extract the gas in the headspace of the vial to test the hydrogen content, use a sterile syringe to collect 1 mL of the suspension, pass it through a 0.22um filter head, and then test the concentration of inorganic arsenic acid, arsenite, and ammonia nitrogen in the solution on the machine. Select a bacterial solution with high concentrations of ammonia nitrogen, arsenite, and hydrogen, and perform three tube-rolling purifications on it. After picking a single colony, obtain a purified nitrogen-fixing and hydrogen-producing strain with arsenic resistance.

[0061] 2. Morphological characteristics, physiological and biochemical analysis:

[0062] 1) This strain is a Gram-positive bacillus with spores, oval in shape, terminal or subterminal. When cultured on a nutrient agar plate at 36°C for 2 days, it can grow round colonies with raised, smooth surfaces and neat edges. Figure 1 As shown. Figure 2 As shown, scanning electron microscopy (SEM) showed that the overall morphology of the strain was rod-shaped, 2-4 μm long, formed connections after division, and the cell surface was smooth without surface attachments such as pili.

[0063] 2) The strain can ferment glucose and L-raffinose, but cannot utilize sucrose and fructose. The strain has strong proteolytic ability, can hydrolyze casein, secrete arginine dihydrolase and alkaline phosphatase.

[0064] 3) Genomic gene sequence analysis: The genomic DNA of the strain was extracted using a bacterial DNA extraction kit (DNeasy Blood & Tissue Kit, Qiagen, Valencia, CA) and sent to Shanghai Paisono Biotechnology Co., Ltd. for whole genome sequencing;

[0065] The obtained 16S rRNA gene fragment sequence of the strain (SEQ ID NO.1) was compared in NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome), and the sequence with the greatest similarity was selected as the species identification result.

[0066] The results showed that the arsenic-resistant strain YH01 belonged to the genus Paraclostridium, and had a 100% similarity with Paraclostridium benzoelyticum. The GC content of the strain was 29.21%, and the average nucleotide identity (ANI) between it and the genome of Paraclostridium benzoelyticum JC272 strain was 96.32%.

[0067] Among them, the 16S rRNA sequence is:

[0068]

[0069] The strain has strong arsenic resistance and can convert arsenate into arsenite in the cell and excrete it for detoxification. The sequence of the arsenic resistance gene arC of the strain after amplicon sequencing is as follows: scaffold1_802 835583-836119+length=537nt;

[0070] (SEQ ID NO.2);

[0071] In addition to the ability to degrade benzoic acid, the strain also has the ability to fix nitrogen. The sequence of the nitrogen-fixing gene nifH of the strain after amplicon sequencing is as follows:

[0072] ATGAGGAAAATAGCTATATATGGGAAGGGTGGAATTGGAAAATCTACCACTAC

[0073] TTCAAACTTATCAGCAGCTTTATCTAGTTTAGGATATAAAGTTATGCAAATAGGGTG

[0074] TGATCCTAAAGCAGATTCTACTAAAAATTTAATGAAGGGGAAATTTATTCCAACAGT

[0075] TTTAGATGTCATGAATACTAAAGGCGATGGAGTTGAGTTAGAAGATATAGTATTTAA

[0076] AGGTTATAATGGAGTACTTTGCGTAGAGGCAGGAGGCCCAACTCCTGGGGTTGGAT

[0077] GCGCAGGAAGGGGTATAATAGCTGCATTTGAGAAGTTAGAAGAGCTTAATGCATTT

[0078] GAAAAATATAACCCAGATAGTTATATATGACGTTTTGGGAGATGTTGTATGTGGA

[0079] GGATTTTCAATGCCTATTCGAAATGGGTATGCAGAAGAAGTATATATAGTAACTTCT

[0080] GGAGAAATGATGTCTATGTATGCAGCAAGTAATATTTCAACTGCTGTAATTCAATTT

[0081] AAAAATAGGGGATATGCATCCCTTAAAGGATTAATATTAAATGCTAAAAATGTTGAA

[0082] GGTGAAATGGATTTAGTTGAAACTTTAGCAGATGAAATAAATAGTGAAGTTTTCCA

[0083] TTATATACCTAGAGAAAAAATGGTACAAATATCAGAAAACGATGGAAAAACAGTTA

[0084] TAGAAAAAGATAAAAATTGCGATATGGCTAATGTTTATTTGGAATTAGCTAAAAAAG

[0085] TATAGGATAA(SEQ ID NO.3);

[0086] Based on the morphological characteristics, physiological and biochemical characteristics, and gene sequence analysis results, the strain was preliminarily judged to be Paraclostridium benzoelyticum, and the strain was named Paraclostridium benzoelyticum YH01 (Paraclostridium benzoelyticum YH01), with a taxonomic name: Paraclostridium benzoelyticum; and it was preserved in the Guangdong Provincial Microbiological Culture Collection Center (GDMCC) at Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province on May 30, 2024, with the preservation number: GDMCC No: 64705.

[0087] Example 2: Arsenic conversion efficiency and growth status of Clostridium parabenzoica YH01 at different arsenate concentrations

[0088] The anaerobic penicillin bottle was used to culture Clostridium parabenzoic acidisolution YH01, and 0.1mM and 0.5mM arsenate were added to TSB medium to investigate the conversion rate of arsenic and the efficiency of hydrogen production in the anaerobic system.

[0089] The specific process is as follows:

[0090] Seed solution preparation: weigh 10g of tryptone, 5g of yeast extract, and 10g of sodium chloride (NaCl), add 1L of deionized water and ultrasonically shake to dissolve, prepare LB liquid culture medium, adjust the pH to 7.0, dispense 60mL of culture medium into 100mL vials, place them on a clean bench for aeration for 30min, replace the oxygen in the bottle with high-purity nitrogen, quickly plug in butyl rubber stoppers, tighten the aluminum caps, place them in a high-temperature sterilizer for sterilization at 120℃ for 20min, and prepare for inoculation after the culture medium cools down; take out the YH01 strain frozen in a -80℃ refrigerator and thaw it at room temperature, quickly inoculate 600uL of bacterial solution into a 100mL anaerobic vial with a 1mL sterile syringe, and place it in a 30℃ constant temperature incubator for 12h.

[0091] Preparation of fermentation broth: prepare 1L, 30mM PIPS buffer, adjust the pH to 7.0, add 1 / 4 dose of TSB culture medium, stir and dissolve, aerate and deoxygenate with high-purity nitrogen for 1h, plug with top-grade rubber stopper, press on aluminum cap, sterilize in an autoclave for 20min, cool and inoculate 30mL of logarithmic phase seed solution into a vial with a 10mL syringe on an ultra-clean workbench, place in a 30℃ constant temperature incubator and culture for 48h to obtain 1L fermentation broth.

[0092] Arsenic resistance experiment of YH01 strain: prepare 30mM PIPS buffer, adjust the pH to 7.0, add 1 / 4 dose of TSB culture medium, stir and dissolve, then dispense into 100mL penicillin bottles, 60mL of culture medium in each bottle, set two gradients of arsenate initial addition amount of 0.1mM and 0.5mM, place on the clean bench and aerate with high-purity nitrogen for 30min to deoxygenate, quickly plug with butyl rubber stopper, seal with aluminum cap with capping machine, put in high pressure sterilizer at 120℃ for 20min, take out and cool, inoculate 0.6mL of Clostridium parabenzoicasolv YH01 fermentation broth (OD600=0.5) on the clean bench, seal with silica gel and place in incubator for 48h, take liquid sample every 6-8 hours to test the OD600 of the bacterial solution and the concentration of arsenate and arsenite.

[0093] The results are as follows Figures 3-4 As shown, Figure 3 The results showed that the logarithmic phase of Clostridium parabenzoicasolvum YH01 in 1 / 4TSB medium was 11-18 hours, and the highest OD600 reached 2.16.

[0094] Figure 4 The results showed that under the condition of adding 0.1mM arsenate, arsenate could be reduced to arsenite by Clostridium benzoicum YH01 within 24 hours, with a conversion rate of more than 99%; under the condition of adding 0.5mM arsenate, it was completely reduced to arsenite in about 36 hours, with the maximum OD600 value of 1.93.

[0095] Example 3: Inoculation of parabenzoic acid-solubilizing Clostridium YH01 in nitrogen-free medium to investigate its nitrogen fixation and hydrogen production efficiency

[0096] The specific process is as follows:

[0097] Prepare a medium without nitrogen source and with glucose as substrate. Other ingredients are: NaCl 5g / L, K2HPO4 2g / L, KH2PO40.5g / L, glucose 4g / L, trace salt solution 10mL / L, vitamin solution 10mL / L, dissolve in sequence and adjust pH to 7.0. Dispense into 100mL capacity vials according to 60mL per bottle, and add 0.1mM arsenate. Use high-purity nitrogen aeration for 40 minutes to replace the oxygen in the bottle, seal with butyl rubber stopper and aluminum cap, put it in an autoclave and sterilize at 121℃ for 20 minutes, and inoculate with benzoic acid paraclostridium YH01 at a 5% inoculation rate after cooling, and set a blank medium without bacteria as a control, with 3 parallels for each treatment. All treatment vials are placed in a 30℃ incubator for static culture. Every 6 hours, 200uL of headspace gas was extracted, and the hydrogen concentration was determined by gas chromatography (GC, Agilent). 1mL of the suspension was extracted to test the ammonium nitrogen concentration in the system. A total of 6 samples were collected.

[0098] The results are as follows Figure 5 As shown, the results showed that the control without bacteria did not produce hydrogen and ammonium nitrogen, while the group with bacteria quickly fixed nitrogen and produced hydrogen under arsenate stress, the ammonium nitrogen concentration reached 19.83 mg / L, and the H2 generation reached 3547 Pa.

[0099] Example 4: Nitrogen fixation, hydrogen production and arsenic resistance test of anaerobic hydrogen-producing nitrogen-fixing arsenic-resistant Clostridium parabenzoicisolutans YH01 in arsenic-contaminated soil anaerobic reactor

[0100] Arsenic-contaminated soil (pH 6.0) was collected from a certain place in Guangdong Province, and after natural air drying, it was crushed and passed through a 10-mesh sieve for later use. Weigh 6g of arsenic-contaminated soil sterilized by Co-γ irradiation into a 100mL cillin bottle, and add 60mL of ultrapure water to mix. Set two gradients of arsenate addition of 1mM and 3mM. After 40 minutes of high-purity nitrogen aeration and deoxygenation, plug the butyl rubber stopper and press the aluminum cover, and sterilize at high temperature and high pressure for 20 minutes. After the culture medium is cooled, the YH01 strain obtained in Example 1 is added to the clean bench according to an inoculum amount of 3%, and a sterilized soil culture system without sterilization is set as a control. Headspace gas and soil suspension are collected regularly. After centrifugation of the soil suspension, the concentrations of arsenate, arsenite and ammonium nitrogen in the supernatant are measured.

[0101] The results are as follows Figure 6 As shown, the results showed that no increase in the concentration of dissolved ammonia nitrogen was detected in the sterilized soil control group. After inoculation with the YH01 strain obtained in Example 1, the dissolved ammonia nitrogen in the soil increased by 10.4 mg / L. Similarly, no H2 production was detected in the sterilized soil control group. However, after inoculation with the YH01 strain obtained in Example 1, 4309 Pa H2 was still monitored under 1 mM and 3 mM arsenate stress.

[0102] The transformation of dissolved arsenic in soil Figure 7 As shown, there was no significant change in the arsenic form in the sterilized soil control group. After inoculation with the YH01 strain obtained in Example 1, 1mM and 3mM arsenate were converted into arsenite within 8 days, with conversion rates of 82.0% and 77.5%, respectively. This demonstrated that the YH01 strain has good nitrogen fixation and hydrogen production effects in the arsenic-contaminated soil system and has strong arsenic resistance.

[0103] The above results further prove that the YH01 strain helps to fix nitrogen in the soil and produce H2, and has great potential in the development and application of soil fertility improvement and nitrogen fixation and emission reduction technology.

[0104] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A Paraclostridium benzoelyticum YH01, the taxonomic name of the Paraclostridium benzoelyticum YH01 is Paraclostridium benzoelyticum, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on May 30, 2024, with a deposit number of GDMCC No: 64705.

2. The culture of Clostridium parabenzoicalyticum YH01 according to claim 1.

3. Use of the parabenzoic acid-solubilizing Clostridium YH01 according to claim 1 or the culture according to claim 2 in at least one of the following; (a1) Nitrogen fixation; (b1) preparing nitrogen-fixing products; (c1) producing hydrogen; (d1) preparing hydrogen-producing products; (e1) reducing arsenic; (f1) preparing a product of reduced arsenic; (g1) Environmental remediation; (h1) Preparation of products for environmental remediation.

4. A method for nitrogen fixation and / or hydrogen production and / or arsenic reduction and / or environmental remediation, comprising culturing the parabenzoic acidolytic Clostridium YH01 described in claim 1 or the culture described in claim 2 in an environment to be remediated.

5. The method according to claim 4, characterized in that The environment includes water bodies, soil, wetlands, and sediments.

6. The method according to claim 4, characterized in that The environment is an arsenic-contaminated environment.

7. The method according to claim 6, characterized in that The arsenic is inorganic pentavalent arsenic.

8. The method according to claim 7, characterized in that The inorganic pentavalent arsenic is arsenic acid or arsenate.

9. The method according to claim 7, characterized in that: The concentration of the inorganic pentavalent arsenic in the environment is 0-5 mmol / L, and is not zero.

10. The method according to claim 4, characterized in that The inoculation amount of the parabenzoic acid-solubilizing Clostridium YH01 is 0.1-5% (v / v).

Images