An SNP molecular marker related to inosine monophosphate content in blunt snout bream and its application
By identifying and using molecular markers of specific SNP sites in the bream ampd1 gene, the problem of difficulty in screening bream with high inosine content in the prior art is solved, and the improvement of bream breeding efficiency and fish quality is achieved.
Patent Information
- Application Number
- CN202410999543.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-24
- Publication Date
- 2025-06-27
- Estimated Expiration
- 2044-07-24
AI Technical Summary
The prior art is difficult to effectively screen out gene markers related to the inosine content of bream, resulting in inefficient breeding in bream.
A SNP molecular marker associated with inosine content in the bream, specifically including SNP marker located at specific base mutation sites in the ampd1 gene fragment sequence, is provided, and the genotypes of these SNP sites are detected by designing specific primer pairs.
Through this SNP molecular marker, breams with high inosine content can be quickly screened, bream breeding efficiency can be improved, fish quality and economic benefits can be improved.
Smart Images

Figure CN118853901B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of molecular breeding of aquatic animals, and particularly relates to an SNP molecular marker related to the inosine monophosphate content of blunt snout bream and its application. Background Art
[0002] Inosine-5-Monophate (IMP) has been regarded as a quite important flavor index in animal meat. The content of IMP is closely related to the umami taste of fish meat. A higher inosine monophosphate content in muscle can make the fish meat taste better, thereby increasing its economic value. Therefore, exploring molecular marker loci related to the inosine monophosphate content and improving the muscle quality of aquatic animals have been the long-term research focuses in the aquaculture industry. The traditional breeding method is to select according to phenotypes, which has a long cycle and low efficiency. It is necessary to use molecular marker technology to assist breeding at the genotype level to improve breeding efficiency. At present, using the method of molecular markers to screen genes or markers related to the inosine monophosphate content for genetic improvement is a relatively direct and rapid solution.
[0003] Adenosine 5'-monophosphate deaminase (AMPD) is one of the key enzymes in the purine nucleotide cycle. It catalyzes the cleavage of adenosine 5'-monophosphate (AMP) to generate inosine monophosphate and ammonia, and plays a very important role in the energy metabolism of eukaryotes. The three members of the AMPD gene family, namely AMPD1, AMPD2, and AMPD3, are isozymes. AMPD1 mainly acts on the deamination of AMP to generate inosine monophosphate. In this process, the intracellular metabolites (purines and inorganic phosphorus) have a great influence on the activity of AMPD1. In the non-exercise state, since about 90% of AMPD1 is not bound to the heavy chain of myosin in muscle fibers, it is in an inactivated state. In the exercise state, about 50% of the inactivated AMPD1 is activated; in addition, the activity of AMPD1 is also affected by the ATP concentration in the cytoplasm and the energy level of adenylate in the cell. Therefore, AMPD1 can often be regarded as a "sensor" of cell energy demand. Therefore, it is urgent to provide an SNP molecular marker related to the inosine monophosphate content of blunt snout bream, which lays a foundation for establishing the relationship between the ampd1 gene and the IMP content, and is of great significance for breeding blunt snout bream with a high inosine monophosphate content and carrying out fish assisted breeding. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to overcome the deficiencies of the prior art and provide an SNP molecular marker related to the inosine monophosphate content of blunt snout bream and its application.
[0005] To solve the above technical problems, the present invention adopts the following technical solutions:
[0006] An SNP molecular marker related to the inosine monophosphate content of blunt snout bream, and the SNP molecular marker includes at least one of a), b), c), and d);
[0007] a) The SNP molecular marker is a base mutation at the 141st bp of the blunt snout bream ampd1 gene fragment sequence, and the base at the 141st bp is A or T;
[0008] b) The SNP molecular marker is a base mutation at the 185th bp of the blunt snout bream ampd1 gene fragment sequence, and the base at the 185th bp is A or C;
[0009] c) The SNP molecular marker is a base mutation at the 223rd bp of the blunt snout bream ampd1 gene fragment sequence, and the base at the 223rd bp is A or G;
[0010] d) The SNP molecular marker is a base mutation at the 250th bp of the blunt snout bream ampd1 gene fragment sequence, and the base at the 250th bp is A or G.
[0011] For the above SNP molecular marker, further improved, the nucleotide sequence of the blunt snout bream ampd1 gene fragment is as shown in SEQ ID NO.1.
[0012] As a general technical concept, the present invention also provides a primer pair for detecting the above SNP molecular marker, the primer pair includes a forward primer and a reverse primer, the nucleotide sequence of the forward primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.3.
[0013] As a general technical concept, the present invention also provides an application of the above primer pair in detecting the above SNP molecular marker.
[0014] For the above application, further improved, when the primer pair is used to detect the above SNP molecular marker, it includes the following steps:
[0015] (1.1) Extract the genomic DNA of blunt snout bream;
[0016] (1.2) Use the primer pair to perform PCR amplification on the genomic DNA of the blunt snout bream to be tested to obtain an amplification product;
[0017] (1.3) Sequence the amplification product to detect the base mutation site of the SNP molecular marker.
[0018] As a general technical concept, the present invention also provides an application of the above SNP molecular marker in assisting the breeding of bream or in correlating and analyzing the inosine monophosphate content of bream.
[0019] For the above application, further improved, when the SNP molecular marker is used to assist the breeding of bream, it includes the following steps:
[0020] (2.1) Extract the genomic DNA of bream;
[0021] (2.2) Use a primer pair to perform PCR amplification on the genomic DNA of the bream to be tested to obtain an amplification product;
[0022] (2.3) Sequence the amplification product to obtain a sequencing peak map;
[0023] (2.4) Perform genotyping according to the sequencing peak map. If the SNP molecular marker shows a single peak in the sequencing peak map, the bream to be tested is a homozygous genotype variety; if the SNP molecular marker shows a doublet peak in the sequencing peak map, the bream to be tested is a heterozygous genotype variety.
[0024] For the above application, further improved, when the SNP molecular marker is used to correlate and analyze the inosine monophosphate content of bream, it includes the following steps:
[0025] (3.1) Extract the genomic DNA of bream;
[0026] (3.2) Use a primer pair to perform PCR amplification on the genomic DNA of the bream to be tested to obtain an amplification product;
[0027] (3.3) Sequence the amplification product to obtain a sequencing peak map;
[0028] (3.4) Analyze the sequencing peak map. If the SNP molecular marker shows a single peak in the sequencing peak map, the bream to be tested is a bream with a high inosine monophosphate content; if the SNP molecular marker shows a doublet peak in the sequencing peak map, the bream to be tested is a bream with a low inosine monophosphate content.
[0029] For the above application, further improved, the primer pair includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is as shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is as shown in SEQ ID NO.3.
[0030] For the above application, further improved, the bream is at least one of Megalobrama skolkovii and Megalobrama amblycephala.
[0031] Compared with the prior art, the advantages of the present invention are as follows:
[0032] The present invention provides an SNP molecular marker related to inosine monophosphate content in bream. When this SNP molecular marker is used for assisted breeding or for correlation analysis of inosine monophosphate content in bream, it can quickly and conveniently screen out bream with high inosine monophosphate content, that is, homozygous genotype varieties, which not only lays a solid foundation for marker-assisted breeding selection of bream (such as hybrid bream and blunt snout bream), but also can improve the quality of bream and enhance the production economic benefits. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 It is the electrophoresis result diagram of the PCR amplification product in Example 1 of the present invention.
[0034] Figure 2 It is the MEGA sequence alignment result diagram of the A141T mutation in Example 1 of the present invention.
[0035] Figure 3 It is the MEGA sequence alignment result diagram of the A185C mutation in Example 1 of the present invention.
[0036] Figure 4 It is the MEGA sequence alignment result diagram of the A223G mutation in Example 1 of the present invention.
[0037] Figure 5 It is the MEGA sequence alignment result diagram of the A250G mutation in Example 1 of the present invention.
[0038] Figure 6 It is a partial gel diagram of the gene fragment where the SNP locus of hybrid bream and blunt snout bream is located in Example 2 of the present invention.
[0039] Figure 7 It is the sequencing peak diagram of the A141T mutation in Example 2 of the present invention.
[0040] Figure 8 It is the sequencing peak diagram of the A185C in Example 2 of the present invention.
[0041] Figure 9 It is the sequencing peak diagram of the A223G in Example 2 of the present invention.
[0042] Figure 10 It is the sequencing peak diagram of the A250G in Example 2 of the present invention. DETAILED DESCRIPTION OF THE INVENTION
[0043] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific preferred embodiments, but the protection scope of the present invention is not limited thereby. The materials and instruments used in the following embodiments are all commercially available.
[0044] Example 1:
[0045] A method for obtaining an SNP molecular marker point related to inosine monophosphate content in bream, comprising the following steps:
[0046] (1) Experimental materials: Five Megalobrama hoevenii and five Megalobrama amblycephala were randomly sampled from the same batch and cultured in the same pond. Muscle tissues were taken to extract genomic DNA.
[0047] (2) Primer design: According to the general rule that the closer the phylogenetic relationship of species, the higher the similarity and identity between their homologous genes, the original parental Megalobrama amblycephala ampd1 gene sequence in NCBI was selected as the design template for the ampd1 cloning primers of Megalobrama hoevenii and Megalobrama amblycephala, and primer pairs were designed, including forward primers and reverse primers. Principles for designing primers: The length is 18 - 25 bp, the GC content is 40% - 60%, and the annealing temperature is between 45 - 55 °C.
[0048] The forward primer is shown in SEQ ID NO.2, specifically: 5′-ATAAAGGCACAAAGGGGA-3′; the reverse primer is shown in SEQ ID NO.3, specifically: 5′-CCAACTACTTGAAGGACG-3′.
[0049] The Megalobrama ampd1 gene fragment was obtained by PCR amplification with the above forward primer and reverse primer. Its nucleotide sequence is shown in SEQ ID NO.1, specifically:
[0050] AAGATTGGGTACTGCAAACTTGCAGTAAGACCTAAAGGTCAGACATAAGACAAACTGCACAAGCTGACAGACACCTGTGTACAGGAAGACTCTGTTCTGGAGTGTCATTTCACATTAAGATATAAGTCTCATGGATGTTATCACATGGGCTTCACAATAATGATAGCAGAAATGTTGTTGTCACTGACAATTTAAGTACAGTGCAAAACAAACACTTTGCATGTATGCATGCTTGTTTATTCACCCATCACACCCTCTCTAATGAGGTTCAGCTCATAGCACTGAGTCTCATAGCGGTAGGCCATGCGAATCTGAGCTACGTTGGTTTTGCGGATGTCGTTGCCCGCTGGACCGTCCTTA AGTAGTTGG.
[0051] (3) The genomic DNA of the test samples was subjected to PCR amplification using the primer pair related to the SNP molecular marker associated with inosine monophosphate content in Megalobrama, that is, the DNA of five Megalobrama hoevenii and five Megalobrama amblycephala individuals was used as templates respectively, and the above forward primer and reverse primer were used for PCR amplification. After purification, the amplification products were obtained.
[0052] PCR reaction system (total 50 μL): 25 μL of MIX (containing dye), 0.1 - 1 μg of genomic DNA template, 2 μL each of forward primer and reverse primer (10 μmol / L), and made up to 50 μL with ddH2O.
[0053] PCR reaction program: Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 48°C for 15 s, extension at 72°C for 45 s, for a total of 32 cycles; extension at 72°C for 5 min, and finally stored at 16°C.
[0054] Electrophoresis: Take 2 μL of the PCR amplification product and load it onto a 1% ordinary agarose gel (containing Gelred), and load 2 μL of DL2000bp DNA Marker as a reference. Electrophoresis parameters: Electrophoresis at 200 V and 150 mA for 12 min. After electrophoresis, observe the amplification results under a gel imager, as Figure 1 shown. Figure 1 Among them, M-10 represents different lanes. Lanes 1 - 5: Megalobrama skolkovii, lanes 6 - 10: Megalobrama amblycephala, lane M: DL 2000bp DNA Marker.
[0055] (4) Sequence the amplification product,
[0056] Send the purified PCR amplification product to Boshi Biotechnology Company for sequencing, and use MEGA software to compare the sequencing results. As Figures 2 to 5 shown, a total of four polymorphic sites were identified in the UTR region and exon region of this sequence, located at positions 141bp, 185bp, 223bp, and 250bp of the Megalobrama skolkovii ampd1 gene fragment sequence, namely the A141T mutation, A185C mutation, A223G mutation in the 3'UTR region, and the A250G mutation in the exon, corresponding to the bases A / T, A / C, A / G, A / G.
[0057] Example 2:
[0058] Application of an SNP molecular marker related to inosine monophosphate content in Megalobrama skolkovii in assisted breeding,
[0059] (1) Experimental materials: Randomly sample 50 Megalobrama skolkovii and 50 Megalobrama amblycephala from the same batch and cultured in the same pond. Genomic DNA was extracted from the muscle tissues of all the above individuals.
[0060] (2) Use primer pairs to perform PCR amplification on the genomic DNA of the tested Megalobrama skolkovii to obtain amplification products, and the results are as Figure 6 shown.
[0061] PCR reaction system (total 50 μL): 25 μL of MIX (containing dye solution), 0.1 - 1 μg of DNA template, 2 μL each of forward and reverse primers for PCR amplification (10 μmol / L), and made up to 50 μL with ddH2O.
[0062] PCR reaction procedure: Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing at 48°C for 15 s, extension at 72°C for 45 s, for a total of 32 cycles; extension at 72°C for 5 min, and finally stored at 16°C.
[0063] Electrophoresis: Load 2 μL of the PCR product onto a 1% ordinary agarose gel (containing Gelred), and load 2 μL of DL 2000 bp DNA Marker as a reference. Electrophoresis at 200 V and 150 mA for 12 min.
[0064] (3) Send the above amplified product to Hunan Qingke Biotechnology Co., Ltd. for sequencing to obtain a sequencing peak map.
[0065] (4) Use SnapGene software to view the sequencing peak map of the mutation site, and perform gene typing on the SNP site in combination with the sequencing peak map. The results are as Figures 7 to 10 shown. If there is only one sequencing peak, i.e., a single peak, at the mutation site of an individual, then this site is a homozygous genotype; if there are two sequencing peaks, i.e., overlapping peaks, at this site, then this site is a heterozygous genotype. The results show that there are 2 genotypes at each of the four SNP sites in the ampd1 gene, namely: heterozygous genotypes AT / AC / AG / AG (overlapping peaks), homozygous genotypes AA / AA / AA / AA (single peak).
[0066] Example 3:
[0067] Application of an SNP molecular marker related to inosine monophosphate content in blunt snout bream in the association analysis of inosine monophosphate content in blunt snout bream. After gene typing in Example 2, perform an association analysis on the genotypes of the four SNP sites in the ampd1 gene and the IMP content, measure the inosine monophosphate content in the muscle of each individual, and record the genotype typing results of the four SNP sites A141T, A185C, A223G, and A250G in all individuals. Specifically:
[0068] (1) Determination of IMP content: Cut the muscles on both sides of the back, mash them, mix them, and store them at -20°C for later use. Use high performance liquid chromatography to determine the IMP content in blunt snout bream muscle. The chromatographic column is Agilent C 18 (5 μm, 4.6 × 250 mm), the mobile phase is A: phosphate buffer solution, the mobile phase is B: methanol, and the flow rate is 1 mL / min. The column temperature is 25°C, and the ultraviolet detection wavelength is 254 nm.
[0069] (2) Independent sample T-test and chi-square test modules in SPSS 22 software were used for correlation analysis. The dependent variable was IMP content or different species, and the independent variable was the different genotypes of the screened SNP loci. The results of the correlation between the SNP loci of ampd1 and IMP content are shown in Table 1.
[0070] Table 1 Correlation between ampd1 SNP genotypes and IMP content
[0071]
[0072]
[0073] In Table 1, * indicates that the IMP content of homozygous genotype individuals is significantly higher than that of heterozygous genotype individuals (P<0.05), and ** indicates that the IMP content of homozygous genotype individuals is extremely significantly higher than that of heterozygous genotype individuals (P<0.01).
[0074] As can be seen from Table 1, the four polymorphic loci are all significantly correlated with IMP content. The IMP content of homozygous genotype individuals is significantly higher than that of heterozygous genotype individuals. SNP molecular markers can be used as candidate marker genes for muscle IMP content (P<0.05).
[0075] The genotypes and alleles of SNP molecular markers related to inosine monophosphate content in bream were detected, and their genetic structures were analyzed. The results are shown in Table 2.
[0076] Table 2 Statistical differences in genotypes and gamete distributions of ampd1 SNP among species
[0077]
[0078] As can be seen from Table 2, the genotypes of all SNP loci are strongly associated with the varieties. The number of homozygous genotype individuals in hybrid bream is significantly more than that in blunt snout bream, and the number of heterozygous genotype individuals in hybrid bream is significantly lower than that in blunt snout bream. Among the four polymorphic loci of hybrid bream and blunt snout bream, the dominant alleles are A / A / G / G in turn. These gene frequencies are above 95% in hybrid bream and above 85% in blunt snout bream. From the perspective of genotype distribution frequency, homozygous genotypes such as AA / AA / AA / AA are dominant, and homozygous genotype individuals of the minor allele are not found in hybrid bream and blunt snout bream.
[0079] From the above results, it can be seen that when the SNP molecular markers of the present invention are used for assisted breeding or for correlation analysis of inosine monophosphate content in bream, high-inosine monophosphate content bream, that is, homozygous genotype varieties, can be quickly and conveniently screened out. This not only lays a solid foundation for marker-assisted breeding selection of bream (such as hybrid bream and blunt snout bream), but also can improve the quality of bream and enhance the production economic benefits.
[0080] As described above, it is only the preferred embodiment of the present invention and does not impose any formal limitation on the present invention. Although the present invention has been disclosed above with the preferred embodiment, it is not intended to limit the present invention. Any person skilled in the art can make many possible changes and modifications to the technical solution of the present invention by using the methods and technical contents disclosed above, or modify it into an equivalent embodiment with equivalent changes. Therefore, any simple modification, equivalent replacement, equivalent change and modification made to the above embodiments based on the technical essence of the present invention without departing from the technical solution of the present invention still fall within the scope of protection of the technical solution of the present invention.
Claims
1. A primer pair for detecting SNP molecular markers in assisting bream inosinic acid content breeding or association analysis of bream inosinic acid content, characterized in that: The SNP molecular markers include at least one of a), b), c), and d); a) The SNP molecular marker is located in bream ampd1 A base mutation at the 141 bp of the gene fragment sequence, wherein the base at the 141 bp is A or T; b) The SNP molecular marker is located in bream ampd1 A base mutation at the 185th bp of the gene fragment sequence, wherein the base at the 185th bp is A or C; c) The SNP molecular marker is located in bream ampd1 A base mutation at the 223rd bp of the gene fragment sequence, wherein the base at the 223rd bp is A or G; d) The SNP molecular marker is located in bream ampd1 A base mutation at the 250th bp of the gene fragment sequence, wherein the base at the 250th bp is A or G; The bream is at least one of the group consisting of the bream of the Chinese bream and the giant bream of the Chinese bream; The bream ampd1 The nucleotide sequence of the gene fragment is shown in SEQ ID NO.1; The dominant genotype of the SNP molecular marker is AA / AA / AA / AA.
2. The use according to claim 1, characterized in that: When the primer pair for detecting the SNP molecular marker is used to assist in breeding of bream inosinic acid content, the method comprises the following steps: (2.1) Extracting genomic DNA from bream; (2.2) using primers to perform PCR amplification on the genomic DNA of the bream to be tested to obtain an amplified product; (2.3) Sequencing the amplified product to obtain a sequencing peak graph; (2.4) Genotyping is performed on the sequencing peak graph. If the SNP molecular marker is a single peak in the sequencing peak graph, the bream to be tested is a homozygous genotype variety. If the SNP molecular marker is an overlapping peak in the sequencing peak graph, the bream to be tested is a heterozygous genotype variety.
3. The use according to claim 2, characterized in that: The primer pair includes a forward primer and a reverse primer. The nucleotide sequence of the forward primer is shown in SEQ ID NO.2, and the nucleotide sequence of the reverse primer is shown in SEQ ID NO.3.