SNP 10-117646255 marker related to content of ginsenoside Rg1 in panax notoginseng and application thereof

Abstract

The application discloses an application of a kit for detecting a SNP molecular marker related to the content of ginsenoside Rg1 in panax notoginseng in breeding of the content of ginsenoside Rg1 in panax notoginseng, wherein the SNP molecular marker is SNP10-117646255, is located at the 117646255th base of a Chr11 chromosome, and the mutation type is T / A. The KASP primer combination developed in the application can accurately distinguish panax notoginseng with high and low contents of ginsenoside Rg1, and can be applied to molecular assisted marker breeding of panax notoginseng, shortens the breeding cycle of new varieties, and has low detection cost, is not limited by environment, has high accuracy of detection results, and is easy to repeat. The application has important theoretical and practical guiding significance for accelerating the genetic improvement process of panax notoginseng with high content of ginsenoside Rg1 and improving the breeding selection efficiency.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular genetic breeding, and particularly relates to a SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng and application thereof. BACKGROUND

[0002] Panax notoginseng is a perennial herb of the genus Panax in the family Araliaceae, and its roots and rhizomes are used as medicines. Panax notoginseng has the effects of removing blood stasis, stopping bleeding, and relieving swelling and pain. Panax notoginseng is one of the most valuable traditional Chinese medicinal materials in China. Panax notoginseng is widely used in clinical practice, and is one of the main raw materials of Xuesaitong soft capsules, Yunnan white medicine, compound salvia miltiorrhiza tablets, compound salvia miltiorrhiza dripping pills, and Zhangzhou Banling Decoction. Ginsenosides are the main active ingredients in Panax notoginseng, and the content and types of ginsenosides are important indicators for evaluating the quality of Panax notoginseng.

[0003] Quality breeding is the core measure of good seed selection. Studies have shown that the excellent allelic variation of key genes controlling important agronomic traits can be effectively utilized in molecular marker-assisted selection breeding through the development of allelic specific molecular markers. Panax notoginseng variety selection mainly adopts group mixed selection method, mainly relies on phenotypic selection, and obtains population varieties, which is the main breeding method for Panax notoginseng variety selection at present. However, Panax notoginseng requires at least 3 years per generation, and the speed of phenotypic separation and population construction is extremely slow, and there is also a lack of early selection and identification means, resulting in a long breeding cycle, low efficiency, and the need for 15-20 years to cultivate a new variety. At the same time, Panax notoginseng is a common cross-pollinated plant, and there is no pure line breeding material so far, which seriously limits the application of hybrid breeding method in Panax notoginseng variety selection. It is also difficult to use distant hybridization for Panax notoginseng quality improvement.

[0004] With the development of omics technology, molecular genetic breeding of medicinal plants based on molecular markers can greatly improve the breeding efficiency, and make it possible to carry out molecular design breeding for targeted improvement of effective components of medicinal plants. SNP marker (single nucleotide polymorphism) mainly refers to DNA sequence polymorphism caused by single nucleotide variation at the genome level, which is the highest in polymorphism coverage and density among current molecular markers. Compared with traditional molecular marker-assisted selection, high-throughput resequencing technology can generate large-scale SNP markers, promote accurate association analysis of markers and traits, and improve the efficiency of molecular-assisted selection breeding. The content and types of ginsenosides in Panax notoginseng should be the core target of Panax notoginseng variety selection. Therefore, it is particularly important to use known ginsenoside biosynthetic genes and rich Panax notoginseng germplasm resources to excavate SNPs significantly associated with the content of ginsenoside Rg1 in Panax notoginseng, develop KASP molecular markers for assisting breeding, and realize early molecular-assisted selection of target traits to improve breeding efficiency. SUMMARY

[0005] In view of the above problems, the present application aims to provide a SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng and application thereof.

[0006] To achieve the above object, the present application adopts the following technical solution:

[0007] The present application provides application of a kit for detecting a SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng in breeding of the content of ginsenoside Rg1 in Panax notoginseng, wherein the SNP molecular marker is SNP10-117646255, located at base 117646255 of Chr11 chromosome, and the mutation type thereof is T / A.

[0008] Preferably, the content of ginsenoside Rg1 of AA genotype in SNP10-117646255 is higher than that of TT / TA genotype.

[0009] The present application also provides application of a KASP primer pair for detecting a SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng in breeding of the content of ginsenoside Rg1 in Panax notoginseng, wherein the KASP primer comprises an upstream primer SNP10-F1 and SNP10-F2 and a downstream primer SNP10-R for detecting SNP10-117646255.

[0010] Preferably,

[0011] The SNP10-F1 is 5'-GAAGGTGACCAAGTTCATGCTGCATGGTGGTATAATGGCAGTGT-3';

[0012] The SNP10-F2 is 5'-GAAGGTCGGAGTCAACGGATTGCATGGTGGTATAATGGCAGTGA-3';

[0013] The SNP10-R is 5'-CACAAATATGCCCACCCCGA-3'.

[0014] The present application also provides a method for detecting the content of ginsenoside Rg1 in Panax notoginseng, comprising the following steps:

[0015] (1) extracting DNA of a sample of Panax notoginseng to be detected as a template;

[0016] (2) performing PCR amplification on the template by using the KASP primer pair;

[0017] (3) reading the fluorescence signal after PCR amplification is completed by a high-throughput genotyping system GeneMatrix, and analyzing and converting the fluorescence signal to genotype the SNP10-117646255 molecular marker site of the ginsenoside Rg1 content sample to be identified;

[0018] (4) the method for determining the ginsenoside Rg1 content phenotype of the sample to be identified in step (3) is as follows: if the genotype determined is AA, it is determined that the ginsenoside Rg1 content in the Panax notoginseng sample is high; if the genotype determined is TT / TA, it is determined that the ginsenoside Rg1 content in the Panax notoginseng sample is low.

[0019] Preferably, the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec; 61-55℃ annealing for 40 sec, decreasing 0.6℃ for each cycle, 10 cycles; 95℃ denaturation for 20 sec, 55℃ annealing for 40 sec, 40 cycles.

[0020] Preferably, the PCR amplification system is as follows: 15 ng / μL of DNA template 1 μL; 2×KASP Master mix 1 μL; KASP mixed primers 0.01 μL, wherein the volume ratio of the upstream primer SNP10-F1, the upstream primer SNP10-F2 and the downstream primer SNP10-R is 1:1:3.

[0021] The present application has the following beneficial effects:

[0022] The SNP provided by the present application is significantly related to the ginsenoside Rg1 content in Panax notoginseng, is obtained by performing association analysis on 236 Panax notoginseng natural populations, using SNP sites as genotype data, using the ginsenoside Rg1 content as its phenotype data, using EMMAX software, and using a mixed linear model (MLM) to perform whole genome association (GWAS) analysis screening. The SNP molecular marker SNP10-117646255 is located at the 117646255th base of Chr11 chromosome, and provides technical support for molecular marker assisted breeding of the ginsenoside Rg1 content trait in Panax notoginseng.

[0023] The KASP primer combination developed by the application can directly distinguish and detect the mutation site T or A base of SNP10-117646255. When the KASP primer combination is used to identify the content of ginsenoside Rg1, the two genotypes can be clearly separated. In the molecular marker SNP10-117646255, the dot close to the Y axis is the AA allelic variation site, and the genotype is AA. The content of ginsenoside Rg1 of the panax notoginseng with the genotype AA is relatively high. The dot close to the X axis is the TT allelic variation site, and the genotype is TT. The content of ginsenoside Rg1 of the panax notoginseng with the genotype TT is relatively low. The KASP primer combination developed by the application has good application value, can realize the pre-selection and molecular assisted breeding of the content of ginsenoside Rg1 of panax notoginseng, and has important theoretical and practical guiding significance for improving the breeding selection efficiency of the content of ginsenoside Rg1 of panax notoginseng. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is a Manhattan and QQ-plot diagram of GWAS results of ginsenoside Rg1 in panax notoginseng;

[0025] Figure 2 It is a statistical diagram of allelic variation and phenotype significance of ginsenoside Rg1 content in panax notoginseng;

[0026] Figure 3 It is a genotyping result of KASP special primer on different panax notoginseng samples. DETAILED DESCRIPTION

[0027] The specific embodiments of the application will be further described below. It should be noted that the description of these embodiments is used to help understand the application, but does not constitute a limitation on the application. In addition, the technical features involved in each embodiment of the application described below can be combined with each other as long as they do not conflict with each other.

[0028] Example 1

[0029] Obtaining of nucleotide mutation site (SNP) related to ginsenoside Rg1 content in panax notoginseng

[0030] (1) DNA extraction and high-throughput sequencing:

[0031] Take 236 panax notoginseng natural population materials, extract genomic DNA by CTAB method, and perform 10X whole genome resequencing.

[0032] (2) Determination of ginsenoside Rg1 content:

[0033] The notoginseng sample was dried at 50°C until constant weight, and then crushed with a pulverizer and passed through a No. 4 sieve. 0.6 g of the sample was precisely weighed, 50 ml of methanol was added, weighed, and the bottle opening was sealed with a sealing film. The mixture was ultrasonicated for 30 min, and then left to stand for 20 h. The sealing film was removed, the weight was determined, the lost weight was made up with methanol, and the mixture was shaken and filtered with a 0.22 μm microporous filter to obtain 1 ml of a test solution. The ginsenoside Rg1 was quantitatively analyzed by using a high performance liquid chromatography (HPLC) technique and an external standard method. The chromatographic column was Agilent ZORBAX SB-AQ (3.5 μm, 4.6 x 150 mm), the flow rate was 0.7 ml / min, the column temperature was 30°C, the sample volume was 10 μl, the detection wavelength was 203 nm, and the mobile phase was acetonitrile (A) and H2O (B) with an elution gradient of 0-12 min, 19% (A); 12-60 min, 19-36% (A). The compounds were identified according to the retention time, and quantified by using an external standard method, and the peak area was used as the quantitative basis.

[0034] (3) Genome-wide association analysis (GWAS)

[0035] The SNP site was used as the genotype data, the content of ginsenoside Rg1 was used as the phenotype data, the EMMAX software was used, and the mixed linear model (MLM) was used for genome-wide association (GWAS) analysis. The results are shown in Table 1. Figure 1 The threshold value of -log10(P) > 6 was used, and the SNP molecular marker SNP10-117646255 significantly associated with ginsenoside Rg1 was located at the 117646255th base of Chr11 chromosome. By comparing the reference genome of notoginseng, the sequence allelic variation of the SNP was extracted, and the content of ginsenoside Rg1 of the population material was combined for joint analysis. The SNP10-117646255 had three genotypes TT, AA and TA, and the T test found that the content of ginsenoside Rg1 in the AA genotype was higher, which was the dominant genotype. Figure 2

[0036] The gene sequence containing 100 bp before and after the SNP10-117646255 site is shown in SEQ ID NO. 1:

[0037] ​GATTTGGACTTAAATAGTGGTAATCCTGCTTATTTCTATTCATTTTTACTTGTTTTGTGTTTAGGATTACATTATGTGGCATGGTGGTATAATGGCAGTG[T / A]TATGGCAAGAATTGGCGTGAAAAAGGCAAGAAATC AGAACTGCGGAAGTACCCCCCGTCGGGGTGGGCATATTTGTGAAGAAAACCCCCGCCGGGGCAGG (SEQ ID NO. 1)

[0038] Example 2

[0039] Development of SNP marker KASP specific primers

[0040] Three primers were designed according to the sequence of SEQ ID NO. 1 using the Primer-BLAST function of NCBI, the upstream primer SNP10-F1, the upstream primer SNP10-F2 and the downstream primer SNP10-R, wherein SNP10-F1 and SNP10-F2 respectively contain FAM and HEX fluorescent linker sequences (underlined), and the sequences are as follows:

[0041] SNP10-F1: 5’- GAAGGTGACCAAGTTCATGCT GCATGGTGGTATAATGGCAGTGT-3’

[0042] SNP10-F2: 5’- GAAGGTCGGAGTCAACGGATT GCATGGTGGTATAATGGCAGTGA-3’

[0043] SNP10-R: 5’-CACAAATATGCCCACCCCGA-3’

[0044] Example 3

[0045] Detection of genotypes of SNP sites in different Panax notoginseng samples and application thereof

[0046] The authenticity of SNP10-117646255 in the natural population of Panax notoginseng was verified by high-throughput genotyping system GeneMatrix (GM). Ninety-four Panax notoginseng single plant materials were randomly selected, and the genomic DNA of the samples was extracted. The genomic DNA was used as a template, and the SNP marker KASP specific primers developed in Example 2 were used for PCR amplification.

[0047] The PCR reaction system is as follows: 15 ng / μL of DNA template 1 μL; 2×KASP Master mix 1 μL; KASP mixed primer 0.01 μL, wherein the volume ratio of upstream primer SNP10-F1, upstream primer SNP10-F2 and downstream primer SNP10-R is 1:1:3. The PCR amplification procedure is as follows: 95°C pre-denaturation for 10 min; 95°C denaturation for 20 sec; 61-55°C annealing for 40 sec, decreasing 0.6°C for each cycle, 10 cycles; 95°C denaturation for 20 sec, 55°C annealing for 40 sec, 40 cycles. After the completion of PCR amplification, the fluorescence signal is read, the conversion fluorescence signal is analyzed, and the fluorescence scanning result is automatically converted into a graph, and two pairs of marker primers can clearly separate two genotypes.

[0048] In the molecular marker SNP10-117646255, the dot close to the Y axis carries an AA allelic variation site, and the genotype is AA, and the content of ginsenoside Rg1 in the ginseng of the genotype is relatively high; the dot close to the X axis carries a TT allelic variation site, and the genotype is TT, and the content of ginsenoside Rg1 in the ginseng of the genotype is relatively low. Figure 3

[0049] The above has been described in detail in combination with the embodiments of the present application, but the present application is not limited to the described embodiments. For those skilled in the art, various changes, modifications, replacements and variations can be made to the embodiments without departing from the principles and spirits of the present application, and still fall within the protection scope of the present application.​

Claims

1. The use of a kit for detecting a SNP molecular marker related to the content of ginsenoside Rg1 in Panax notoginseng in breeding of the content of ginsenoside Rg1 in Panax notoginseng, characterized in that: The SNP molecular marker is SNP10-117646255, located at base 117646255 of chromosome 11, the mutation type is T / A; the gene sequences containing 100bp before and after SNP10-117646255 site are shown as SEQ ID NO. 1 and SEQ ID NO. 2; in the SNP10-117646255, the content of ginsenoside Rg1 of AA genotype is higher than that of TT / TA genotype. ​ 2. Use of the KASP primer pair for detecting the SNP10-117646255 molecular marker associated with the content of ginsenoside Rg1 in Panax notoginseng as claimed in claim 1 in breeding the content of ginsenoside Rg1 trait in Panax notoginseng, characterized in that: The KASP primer includes an upstream primer SNP10-F1 and SNP10-F2 and a downstream primer SNP10-R for detecting the SNP10-117646255; in the SNP10-117646255, the content of ginsenoside Rg1 of AA genotype is higher than that of TT / TA genotype; The SNP10-F1 is 5'-GAAGGTGACCAAGTTCATGCTGCATGGTGGTATAATGGCAGTGT-3'; The SNP10-F2 is 5'-GAAGGTCGGAGTCAACGGATTGCATGGTGGTATAATGGCAGTGA-3'; The SNP10-R is 5'-CACAAATATGCCCACCCCGA-3'.

3. A method for detecting the content of ginsenoside Rg1 in Panax notoginseng, characterized in that: The method comprises the following steps: (1) extracting DNA of the to-be-tested Panax notoginseng sample as a template; (2) using the KASP primer in claim 2 to perform PCR amplification on the template; (3) reading a fluorescence signal after PCR amplification by using a high-throughput genotyping system GeneMatrix, and analyzing and converting the fluorescence signal, so as to perform genotyping on the SNP10-117646255 molecular marker site in the to-be-identified Panax notoginseng ginsenoside Rg1 content sample as claimed in claim 1; (4) the method for determining the phenotype of the to-be-identified Panax notoginseng ginsenoside Rg1 content trait in step (3) is as follows: if the identified genotype is AA, it is determined that the content of ginsenoside Rg1 in the Panax notoginseng sample is high; if the identified genotype is TT / TA, it is determined that the content of ginsenoside Rg1 in the Panax notoginseng sample is low.

4. The method of claim 3, wherein, The program of the PCR amplification is: 95℃ pre-denaturation for 10min; 95℃ denaturation for 20sec; 61-55℃ annealing for 40sec, decreasing 0.6℃ for each cycle, 10 cycles; 95℃ denaturation for 20sec, 55℃ annealing for 40sec, 40 cycles.

5. The method of claim 4, wherein, The system of the PCR amplification is: 15 ng / μL of DNA template 1μL; 2×KASP Master mix 1μL; KASP mixed primer 0.01μL, wherein the volume ratio of the upstream primer SNP10-F1, the upstream primer SNP10-F2 and the downstream primer SNP10-R is 1:1:3.

Images