Pediococcus acidilactici IOB701 for inhibiting hyphae formation of Candida albicans and its application

Abstract

The invention provides a strain of Pediococcus acidilactici IOB701 that inhibits the formation of Candida albicans hyphae and its application, and relates to the field of microorganisms. Hyphae formation is one of the important factors of Candida albicans pathogenicity. The inhibition of hyphae formation by Pediococcus acidilactici IOB701 can reduce its colonization and spread in host tissues, thereby reducing the risk of infection. Pediococcus acidilactici IOB701 also has good cell adhesion function and has a relatively good coaggregation ability to Candida albicans. Pediococcus acidilactici competes with Candida albicans for adhesion sites and nutritional resources on the surface of cervical cells, and the copolymerization can separate Candida albicans from the surface of cervical cells, reducing the chance of direct contact and colonization in host cells. These two effects enable Pediococcus acidilactici to effectively reduce the colonization and spread of Candida albicans, thereby combating vaginitis caused by Candida albicans.

Description

Technical Field

[0001] The invention relates to the field of microorganisms, and in particular to a Pediococcus acidilactici IOB701 strain that inhibits the formation of Candida albicans hyphae and an application thereof. Background Art

[0002] Vulvovaginal candidiasis (VVC) is a very common female lower genital tract mucosal infection caused primarily by Candida albicans. Common clinical symptoms of VVC include vaginal itching, burning, pain, and redness. It is usually accompanied by vaginal discharge, including desquamated epithelium, immune cells, yeast, and vaginal fluid. It is estimated that approximately 10% to 15% of asymptomatic women are colonized by Candida, approximately 70% to 75% of women will experience an episode of VVC in their lifetime, approximately 50% of women with the first infection will develop a second VVC, and 5% to 10% of women will develop recurrent vulvovaginal candidiasis (RVVC). VVC harms millions of women every year and is considered an important public health issue.

[0003] Although the specific pathogenic mechanism of VVC has yet to be explored, some studies have also found that the main pathogenic mechanism of Candida albicans is mediated by virulence factors, which are mainly related to the adhesion of Candida albicans, the formation of biofilms, the production of extracellular hydrolases, and the formation of hyphae. Candida albicans usually lives in mammalian hosts as a benign symbiotic bacterium in the form of yeast. It can transform from a conditional pathogen to a pathogen. Its spores and filaments (pseudohyphae and fungal hyphae) can undergo morphological transformation, and the virulence of the strain can be enhanced after hyphae growth. Surface adhesins such as Candida albicans hyphae wall proteins can bind to epithelial cell receptors, adhere to mucosal epithelial cells, and then invade the lower adhesion layer. Adhesion, invasion and tissue damage are the main pathogenic processes of Candida albicans. The filamentous structure provides greater possibilities for Candida albicans to colonize and invade host tissues, and shows stronger resistance to the phagocytosis of human immune cells, which is one of the main characteristics of candidal vaginitis.

[0004] Clinically, oral or topical antibiotics are mainly used to treat vaginitis. Although antibiotics can usually relieve symptoms, single and long-term use of antibiotics can lead to a series of problems such as increased pathogen resistance, high recurrence rate, and inability to rebuild vaginal flora. Currently, methods such as probiotic therapy have been proposed as an alternative and auxiliary therapy to antibiotic treatment.

[0005] As the dominant flora in the vaginal microecology, lactic acid bacteria can not only maintain the health of the vaginal microecology, but also prevent vaginal infection, and play an irreplaceable role in resisting the invasion of pathogenic microorganisms. Probiotics need to be effectively colonized on their cell surface to facilitate their function in the body. Studies have shown that after colonization of epithelial cells, lactobacilli can protect the vaginal mucosa by repelling, competing for receptor sites, and replacing adherent pathogens. Postbiotics refer to inanimate microorganisms or their metabolites that are beneficial to the host. They contain a variety of ingredients, including organic acids, teichoic acids, peptidoglycans, and bacteriocins. They have anti-inflammatory, anti-allergic, antioxidant, immune regulation, prevention or treatment of metabolic diseases, and are an excellent health effector. Compared with probiotics, postbiotics are more stable and safer. At present, probiotics and postbiotics have been studied in inhibiting Candida albicans, but there are few studies on the inhibition of hyphae formation of Candida albicans by Pediococcus acidilactici and its postbiotics. Summary of the invention

[0006] In view of the technical problems existing in the prior art, the present invention aims to provide a strain of Pediococcus acidilactici IOB701 for inhibiting the formation of Candida albicans hyphae and its application.

[0007] One of the purposes of the present invention is to provide a strain of Pediococcus acidilactici IOB701 that inhibits the formation of Candida albicans hyphae. The classification of the Pediococcus acidilactici IOB701 is named Pediococcus acidilactici It was deposited on July 10, 2018 in the General Microbiology Center of China Microorganism Culture Collection, referred to as CGMCC. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC.No.16077.

[0008] The second object of the present invention is to provide an application of a strain of Pediococcus acidilactici IOB701 for inhibiting the formation of Candida albicans hyphae. The Pediococcus acidilactici IOB701 can be used to prepare Pediococcus acidilactici IOB701 bacterial powder, Pediococcus acidilactici IOB701 postbiotics and Candida albicans inhibitors.

[0009] Preferably, the method for preparing the Pediococcus acidilactici IOB701 bacterial powder comprises:

[0010] (1) Strain activation: inoculate Pediococcus acidilactici IOB701 from a cryopreserved tube into a seed culture medium and culture at 35-37°C for 20-24 hours to prepare an activated bacterial solution;

[0011] (2) Seed solution preparation: inoculate the prepared activated bacterial solution into the seed culture medium at a rate of 1-3%, and culture it in a 35-37°C incubator for 20-22 hours to obtain a first-level seed solution; inoculate the first-level seed solution into the seed culture medium at a rate of 3%, and culture it in a 35-37°C incubator for 20-22 hours to obtain a second-level seed solution;

[0012] (3) Expansion: Inoculate the prepared secondary seed solution into the fermentation medium at a rate of 1-3%, and culture in a 35-37°C incubator for 20-22 hours until the strain concentration reaches 1×10 9 -8.0×10 11 CFU / mL of bacterial solution;

[0013] (4) Centrifugation: Centrifuge the cultured bacterial solution at 4-6°C and 4000-6000 rpm / min for 20-30 min, discard the supernatant, and collect the bacterial cells;

[0014] (5) Drying: Collect the bacterial precipitate after centrifugation, place it at -80~-82℃ for pre-freezing for 2-3 hours, and then freeze-dry it. The drying temperature is set to -60~-80℃ and the drying time is 24-48 hours to obtain lactic acid bacteria IOB701 powder.

[0015] Preferably, the preparation method of the Pediococcus acidilactici IOB701 postbiotics comprises:

[0016] (1) Strain activation: inoculate Pediococcus acidilactici IOB701 from a cryopreserved tube into a seed culture medium and culture at 35-37°C for 20-24 hours to prepare an activated bacterial solution;

[0017] (2) Seed solution preparation: inoculate the prepared activated bacterial solution into the seed culture medium at an inoculation rate of 1-3%, and culture it in a 35-37°C incubator for 20-22 hours to obtain a first-level seed solution; inoculate the first-level seed solution into the seed culture medium at an inoculation rate of 1-3%, and culture it in a 35-37°C incubator for 20-22 hours to obtain a second-level seed solution;

[0018] (3) Expansion: Inoculate the prepared secondary seed solution into the fermentation medium at a rate of 1-3%, and culture in a 35-37°C incubator for 20-22 hours until the strain concentration reaches 1×10 9 -8.0×10 11 CFU / mL of bacterial solution;

[0019] (4) Centrifugation: Centrifuge the cultured bacterial solution at 4-6°C and 4000-6000 rpm / min for 20-30 min, discard the supernatant, and collect the bacterial cells;

[0020] (5) Inactivation: sterilize the bacterial pellet after centrifugation at 80-95°C for 20-30 min;

[0021] (6) Drying: Collect the inactivated bacterial precipitate, place it at -80~-82℃ for pre-freezing for 2-3h, and then freeze-dry it. The drying temperature is set at -60~-80℃ and the drying time is 24-48h to obtain the postbiotics of Pediococcus acidilactici IOB701.

[0022] Preferably, the seed culture medium consists of: 1-2% peptone, 1-2% beef extract, 0.5-1% yeast extract, 1-2% glucose, 0.1-0.5% dipotassium hydrogen phosphate, 0.3-0.6% sodium acetate, 0.005-0.008% manganese sulfate, 0.1-0.2% Tween 80, 0.1-0.3% ammonium citrate, pH 6.2-6.4.

[0023] Preferably, the fermentation medium consists of: 1.5-2.5% peptone, 1-2% yeast extract, 1.5-2.5% glucose, 0.3-0.6% dipotassium hydrogen phosphate, 0.3-0.6% sodium acetate, 0.01-0.03% magnesium sulfate, 0.001-0.005% manganese sulfate, 0.1-0.5% Tween 80, 0.2-0.5% ammonium citrate, and pH 6.2-6.4.

[0024] Preferably, the viable bacterial count of the Pediococcus acidilactici IOB701 powder is 1.0×10 9 CFU / mL~8.0×10 11 CFU / mL, the viable count of Candida albicans inhibitor is 1.0×10 9 CFU / mL~8.0×10 11 CFU / mL.

[0025] Preferably, the raw material of the Candida albicans inhibitor includes Pediococcus acidilactici IOB701 bacterial powder and / or Pediococcus acidilactici IOB701 postbiotics.

[0026] Preferably, the Candida albicans inhibitor has at least one of the following functions:

[0027] (1) Inhibit the formation of Candida albicans hyphae;

[0028] (2) Reduce the ability of Candida albicans to adhere to cervical epithelial cells;

[0029] (3) It has good co-aggregation ability against Candida albicans;

[0030] (4) It has immune regulatory function.

[0031] Beneficial effects of the present invention:

[0032] The present invention provides a strain of Pediococcus acidilactici IOB701 that inhibits the formation of Candida albicans hyphae. In the first aspect, Pediococcus acidilactici IOB701 can inhibit the formation of Candida albicans hyphae. Candida albicans is an opportunistic pathogen that can form hyphae in the host and cause infection through this morphological transformation. Hyphae is the invasive form of Candida albicans, which can penetrate host tissues and induce inflammatory reactions, ultimately leading to infectious diseases such as vaginitis. Candida albicans transforms from a yeast form to a hyphae form under specific conditions. Inhibiting this transformation can reduce its invasiveness, thereby reducing the severity of infection. Hyphae formation is also one of the important factors in the pathogenicity of Candida albicans. Inhibiting hyphae formation can reduce its colonization and spread in host tissues, thereby reducing the risk of infection. The formation of hyphae is usually accompanied by an overreaction of the host immune system, leading to tissue damage. By inhibiting the formation of hyphae, this overreaction can be reduced, the host tissues can be protected, and the anti-infection ability can be enhanced. Candida albicans in hyphae form has a low sensitivity to antifungal drugs. By inhibiting hyphae formation, the effectiveness of drug treatment can be improved and the emergence of drug-resistant strains can be reduced.

[0033] Secondly, the live bacteria of Pediococcus acidilactici IOB701 and its postbiotics have good cell adhesion function and relatively good coaggregation ability against Candida albicans. Pediococcus acidilactici competes with Candida albicans for adhesion sites and nutritional resources on the surface of cervical cells. Coaggregation can separate Candida albicans from the surface of cervical cells, reducing its chance of direct contact and colonization in host cells. These two effects enable Pediococcus acidilactici to effectively reduce the colonization and spread of Candida albicans.

[0034] In addition, copolymerization can also enhance the recognition and clearance capabilities of the host immune system, allowing the body to more effectively respond to Candida albicans infection. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 This is the hyphae morphology of Candida albicans;

[0036] Figure 2 is the hypha length of Candida albicans;

[0037] Figure 3 is the Candida albicans colonization rate;

[0038] Figure 4 It is the adhesion of Pediococcus acidilactici IOB701 to cells;

[0039] Figure 5 is the coaggregation ability of Pediococcus acidilactici IOB701 against Candida albicans;

[0040] Figure 6 is the self-aggregation ability of Pediococcus acidilactici IOB701;

[0041] Figure 7 is the amount of Candida albicans hyphae in the lavage fluid;

[0042] Figure 8 The vaginal tissue pathology of mice;

[0043] Fig. 9 is the IL-6 level in the vaginal lavage fluid of mice;

[0044] Fig.10 is the level of TNF-α in the vaginal lavage fluid of mice.

[0045] The classification of Pediococcus acidilactici IOB701 of the present invention is named Pediococcus acidilactici It was deposited on July 10, 2018 in the General Microbiology Center of China Microorganism Culture Collection, referred to as CGMCC. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC.No.16077. DETAILED DESCRIPTION

[0046] According to a first aspect of the present invention, a strain of Pediococcus acidilactici IOB701 is provided that inhibits the formation of Candida albicans hyphae. The classification of the Pediococcus acidilactici IOB701 is named Pediococcus acidilactici It was deposited on July 10, 2018 in the General Microbiology Center of China Microorganism Culture Collection, referred to as CGMCC. The deposit address is No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC.No.16077.

[0047] Specifically, the 16srDNA sequencing sequence of Pediococcus acidilactici IOB701 is:

[0048] TCGAACGAAC TTCCGTTAAT TGATTATGAC GTGCTTGCAC TGAATGAGAT

[0049] TTTAACACGA AGTGAGTGGC GGACGGGTGA GTAACACGTG GGTAACCTGC

[0050] CCAGAAGCAG GGGATAACAC CTGGAAACAG ATGCTAATAC CGTATAACAG

[0051] AGAAAACCGC CTGGTTTTCT TTTAAAAGAT GGCTCTGCTA TCACTTCTGG

[0052] ATGGACCCGC GGCGCATTAG CTAGTTGGTG AGGTAACGGC TCACCAAGGC

[0053] GATGATGCGT AGCCGACCTG AGGGTAAT CGGCCACATT GGGACTGAGA

[0054] CACGGCCCAG ACTCCTACGG GAGGCAGCAG TAGGGAATCT TCCACAATGG

[0055] ACGCAAGTCT GATGGAGCAA CGCCGCGTGA GTGAAGAAGG GTTTCGGCTC

[0056] GTAAAGCTCT GTTGTTAAAG AAGAACGTGG GTGAGAGTAA CTGTTCACCC

[0057] AGTGACGGTA TTTAACCAGA AAGCCACGGC TAACTACGTG CCAGCAGCCG

[0058] CGGTAATACG TAGGTGGCAA GCGTTATCCG GATTTATTGG GCGTAAAGCG

[0059] AGCGCAGGCG GTCTTTTAAG TCTAATGTGA AAGCCTTCGG CTCAACGAA

[0060] GAAGTGCATT GGAAACTGGG AGACTTGAGT GCAGAAGAGG ACAGTGGAAC

[0061] TCCATGTGTA GCGGTGAAAT GCGTAGATAT ATGGAAGAAC ACCAGTGGCG

[0062] AAGGCGGCTG TCTGGTCTGT AACTGACGCT GAGGCTCGAA AGCATGGGTA

[0063] GCGAACAGGA TTAGATACCC TGGTAGTCCA TGCCGTAAAC GATGATTACT

[0064] AAGTGTTGGA GGGTTTCCGC CCTTCAGTGC TGCAGCTAAC GCATTAAGTA

[0065] ATCCGCCTGG GGAGTACGAC CGCAAGGTTG AAACTCAAAA GAATTGACGG

[0066] GGGCCCGCAC AAGCGGTGGA GCATGTGGTT TAATTCGAAG CTACGCGAAG

[0067] AACCTTACCA GGTCTTGACA TCTTCTGCCA ACCTAAGAGA TTAGGCGTTC

[0068] CCTTCGGGGA CAGAATGACA GGTGGTGCAT GGTTGTCGTC AGCTCGTGTC

[0069] GTGAGATGTT GGGTTAAGTCCCGCAACGAG CGCAACCCTT ATTACTAGTT

[0070] GCCAGCATTC AGTTGGGCAC TCTAGTGAGA CTGCCGGTGA CAAACCGGAG

[0071] GAAGGTGGGG ACGACGTCAA ATCATCATGC CCCTTATGAC CTGGGCTACA

[0072] CACGTGCTAC AATGGATGGT ACAACGAGTC GCGAAACCGC GAGGTTTAGC

[0073] TAATCTCTTA AAACCATTCT CAGTTCGGAC TGTAGGCTGC AACTCGCCTA

[0074] CACGAAGTCG GAATCGCTAG TAATCGCGGA TCAGCATGCC GCGGTGAATA

[0075] CGTTCCCGGG CCTTGTACACACCGCCCGTC ACACCATGAG AGTTTGTAAC

[0076] ACCCAAAGCC GGTGGGGTAA CCTTTTAGGA GCT

[0077] According to a second aspect of the present invention, the present invention provides an application of a strain of Pediococcus acidilactici IOB701 for inhibiting the formation of Candida albicans hyphae. The Pediococcus acidilactici IOB701 can be used to prepare Pediococcus acidilactici IOB701 powder, Pediococcus acidilactici IOB701 postbiotics and Candida albicans inhibitors.

[0078] In a preferred embodiment of the present invention, the method for preparing the powder of Pediococcus acidilactici IOB701 comprises:

[0079] (1) Strain activation: inoculate Pediococcus acidilactici IOB701 from a cryopreserved tube into a seed culture medium and culture at 35-37°C for 20-24 hours to prepare an activated bacterial solution;

[0080] (2) Seed solution preparation: inoculate the prepared activated bacterial solution into the seed culture medium at a rate of 1-3%, and culture it in a 35-37°C incubator for 20-22 hours to obtain a first-level seed solution; inoculate the first-level seed solution into the seed culture medium at a rate of 3%, and culture it in a 35-37°C incubator for 20-22 hours to obtain a second-level seed solution;

[0081] (3) Expansion: Inoculate the prepared secondary seed solution into the fermentation medium at a rate of 1-3%, and culture in a 35-37°C incubator for 20-22 hours until the strain concentration reaches 1×10 9 -8.0×10 11 CFU / mL of bacterial solution;

[0082] (4) Centrifugation: Centrifuge the cultured bacterial solution at 4-6°C and 4000-6000 rpm / min for 20-30 min, discard the supernatant, and collect the bacterial cells;

[0083] (5) Drying: Collect the bacterial precipitate after centrifugation, place it at -80~-82℃ for pre-freezing for 2-3 hours, and then freeze-dry it. The drying temperature is set to -60~-80℃ and the drying time is 24-48 hours to obtain lactic acid bacteria IOB701 powder.

[0084] In a preferred embodiment of the present invention, the preparation method of the Pediococcus acidilactici IOB701 postbiotics comprises:

[0085] (1) Strain activation: inoculate Pediococcus acidilactici IOB701 from a cryopreserved tube into a seed culture medium and culture at 35-37°C for 20-24 hours to prepare an activated bacterial solution;

[0086] (2) Seed solution preparation: inoculate the prepared activated bacterial solution into the seed culture medium at an inoculation rate of 1-3%, and culture it in a 35-37°C incubator for 20-22 hours to obtain a first-level seed solution; inoculate the first-level seed solution into the seed culture medium at an inoculation rate of 1-3%, and culture it in a 35-37°C incubator for 20-22 hours to obtain a second-level seed solution;

[0087] (3) Expansion: Inoculate the prepared secondary seed solution into the fermentation medium at a rate of 1-3%, and culture in a 35-37°C incubator for 20-22 hours until the strain concentration reaches 1×10 9 -8.0×10 11 CFU / mL of bacterial solution;

[0088] (4) Centrifugation: Centrifuge the cultured bacterial solution at 4-6°C and 4000-6000 rpm / min for 20-30 min, discard the supernatant, and collect the bacterial cells;

[0089] (5) Inactivation: sterilize the bacterial pellet after centrifugation at 80-95°C for 20-30 min;

[0090] (6) Drying: Collect the inactivated bacterial precipitate, place it at -80~-82℃ for pre-freezing for 2-3h, and then freeze-dry it. The drying temperature is set at -60~-80℃ and the drying time is 24-48h to obtain the postbiotics of Pediococcus acidilactici IOB701.

[0091] In a preferred embodiment of the present invention, the seed culture medium consists of: 1-2% peptone, 1-2% beef extract, 0.5-1% yeast extract, 1-2% glucose, 0.1-0.5% dipotassium hydrogen phosphate, 0.3-0.6% sodium acetate, 0.005-0.008% manganese sulfate, 0.1-0.2% Tween 80, 0.1-0.3% ammonium citrate, pH 6.2-6.4.

[0092] In a preferred embodiment of the present invention, the fermentation medium consists of: 1.5-2.5% peptone, 1-2% yeast extract, 1.5-2.5% glucose, 0.3-0.6% dipotassium hydrogen phosphate, 0.3-0.6% sodium acetate, 0.01-0.03% magnesium sulfate, 0.001-0.005% manganese sulfate, 0.1-0.5% Tween 80, 0.2-0.5% ammonium citrate, pH 6.2-6.4.

[0093] In a preferred embodiment of the present invention, the viable count of the Pediococcus acidilactici IOB701 bacterial powder is 1.0×10 9 CFU / mL~8.0×10 11 CFU / mL, the viable count of Candida albicans inhibitor is 1.0×109 CFU / mL~8.0×10 11 CFU / mL.

[0094] In a preferred embodiment of the present invention, the raw material of the Candida albicans inhibitor includes Pediococcus acidilactici IOB701 bacterial powder and / or Pediococcus acidilactici IOB701 postbiotics.

[0095] In a preferred embodiment of the present invention, the Candida albicans inhibitor has at least one of the following functions:

[0096] (1) Inhibit the formation of Candida albicans hyphae;

[0097] (2) Reduce the ability of Candida albicans to adhere to cervical epithelial cells;

[0098] (3) It has good co-aggregation ability against Candida albicans;

[0099] (4) It has immune regulatory function.

[0100] In order to further explain the technical means and effects adopted by the present invention, the technical solution of the present invention is further described below in conjunction with the preferred embodiments of the present invention, but the present invention is not limited to the scope of the embodiments.

[0101] Example 1

[0102] Preparation of Pediococcus acidilactici IOB701 powder

[0103] (1) Strain activation: Inoculate Pediococcus acidilactici IOB701 from a cryopreserved tube into a seed culture medium and culture at 37°C for 24 h to prepare an activated bacterial solution;

[0104] (2) Seed solution preparation: inoculate the prepared activated bacterial solution into the seed culture medium at a rate of 3% (v / v), and culture it in a 37°C incubator for 22 h to obtain the first-level seed solution; inoculate the first-level seed solution into the seed culture medium at a rate of 3% (v / v), and culture it in a 37°C incubator for 20 h to obtain the second-level seed solution;

[0105] The composition of the seed culture medium is: peptone 1%, beef extract 1%, yeast extract 0.5%, glucose 2%, dipotassium hydrogen phosphate 0.2%, sodium acetate 0.5%, magnesium sulfate 0.02%, manganese sulfate 0.005%, Tween 80 0.1%, ammonium citrate 0.2%, pH 6.4;

[0106] (3) Expansion: The prepared secondary seed solution was inoculated into the fermentation medium at a rate of 3% (v / v) and cultured in a 37°C incubator for 20 h until the strain concentration reached 1×10 9 CFU / mL of bacterial solution;

[0107] The fermentation medium composition is: peptone 1.5%, yeast extract 1%, glucose 2.5%, dipotassium hydrogen phosphate 0.3%, sodium acetate 0.5%, magnesium sulfate 0.02%, manganese sulfate 0.005%, Tween 80 0.5%, ammonium citrate 0.4%, pH 6.2;

[0108] (4) Centrifugation: Centrifuge the cultured bacterial suspension at 4°C, 4000 rpm / min for 20 min, discard the supernatant, and collect the bacterial cells;

[0109] (5) Drying: The precipitate after centrifugation was collected and placed at -80°C for pre-freezing for 2 h, and then freeze-dried. The drying temperature was set at -60°C and the drying time was 26 h to obtain the lactic acid bacteria powder of Pediococcus acidilactici IOB701.

[0110] Example 2

[0111] Preparation of postbiotics from Pediococcus acidilactici IOB701

[0112] (1) Strain activation: Inoculate Pediococcus acidilactici IOB701 from a cryopreserved tube into a seed culture medium and culture at 37°C for 24 h to prepare an activated bacterial solution;

[0113] (2) Preparation of seed solution: inoculate the prepared activated bacterial solution into the seed culture medium at an inoculation rate of 3% (v / v), and culture it in a 37°C incubator for 22 hours to obtain a first-level seed solution; inoculate the first-level seed solution into the seed culture medium at an inoculation rate of 3% (v / v), and culture it in a 37°C incubator for 20 hours to obtain a second-level seed solution; the seed culture medium comprises: 1% peptone, 1% beef extract, 0.5% yeast extract, 2% glucose, 0.2% dipotassium hydrogen phosphate, 0.5% sodium acetate, 0.02% magnesium sulfate, 0.005% manganese sulfate, 0.1% Tween 80, 0.2% ammonium citrate, pH 6.4;

[0114] (3) Expansion: The prepared secondary seed solution was inoculated into the fermentation medium at a rate of 3% (v / v) and cultured in a 37°C incubator for 20 h until the strain concentration reached 1×10 9 CFU / mL of bacterial liquid; the fermentation medium consists of: 1.5% peptone, 1% yeast extract, 2.5% glucose, 0.3% dipotassium hydrogen phosphate, 0.5% sodium acetate, 0.02% magnesium sulfate, 0.005% manganese sulfate, 0.5% Tween 80, 0.4% ammonium citrate, pH 6.2;

[0115] (4) Centrifugation: Centrifuge the cultured bacterial suspension at 4°C, 4000 rpm / min for 20 min, discard the supernatant, and collect the bacterial cells;

[0116] (5) Inactivation: sterilize the pellet after centrifugation at 95°C for 30 min;

[0117] (6) Drying: Collect the precipitate after centrifugation, place it at -80°C for pre-freezing for 2 h, and then freeze-dry it. The drying temperature is set to -60°C and the drying time is 26 h to obtain the postbiotics of Pediococcus acidilactici IOB701.

[0118] Example 3

[0119] Effects of Pediococcus acidilactici IOB701 powder and its postbiotics on hyphal length of Candida albicans

[0120] Experimental Materials:

[0121] PBS Beijing Solable Technology Co., Ltd.

[0122] MRS liquid culture medium Qingdao Haibo Biotechnology Co., Ltd.

[0123] Fetal bovine serum Gibco

[0124] Candida albicans was taken out from the cryopreservation tube, inoculated into Sabouraud glucose medium, cultured on a shaking platform at 30°C for 18-20h for activation, activated twice, centrifuged at 12000rpm for 2min, resuspended in PBS, and OD600nm was adjusted to about 0.75 to obtain a Candida albicans suspension;

[0125] The IOB701 bacterial powder and the IOB701 postbiotic powder were resuspended in PBS, and the OD600nm was adjusted to about 0.75 to obtain an IOB701 bacterial powder suspension and an IOB701 postbiotic powder suspension;

[0126] The experiment was divided into three groups: control group, IOB701 bacterial powder group, and IOB701 postbiotic group;

[0127] Add 500 μL MRS liquid culture medium, 200 μL Candida albicans suspension and 90 μL fetal bovine serum to each well. Add 200 μL IOB701 powder or postbiotic powder suspension to each well of the experimental group, and add 200 μL MRS liquid culture medium to the control group. Incubate at 37°C for 3 hours and then take out. Mix the liquid in the wells, take 10 μL from each well and drop it on the slide for Gram staining. Observe the staining results under a microscope. Figure 1 40 hyphae were selected and their lengths were measured using Image J software. The results are shown in Figure 2 As shown, Figure 2 is the hypha length of Candida albicans;

[0128] Figure 1 It is the hyphae morphology of Candida albicans. Figure 1It can be seen that after 3 hours of IOB701 powder and IOB701 postbiotics acting on Candida albicans, compared with the control group, the hyphae of Candida albicans were shorter after the intervention of IOB701 live bacteria, and yeast-type Candida albicans existed after 3 hours of IOB701 postbiotics, and the hyphae were shorter. Both IOB701 live bacteria and postbiotics had bacteria attached to the hyphae. The results showed that the live bacteria and postbiotics of Pediococcus acidilactici IOB701 had an inhibitory effect on the hyphae formation of Candida albicans.

[0129] When P. acidilactici adheres to the hyphae surface of C. albicans, they form a physical barrier that hinders the extension and expansion of the hyphae. This physical barrier restricts the absorption of nutrients from the surrounding environment by occupying sites on the hyphae surface, thereby inhibiting further growth of the hyphae.

[0130] Lactic acid produced by the metabolism of Pediococcus acidilactici can reduce the local pH value and make the environment more acidic. The low pH environment is not conducive to the growth of the hyphae morphology of Candida albicans, but is more suitable for its yeast morphology, thereby inhibiting the further development of hyphae; Pediococcus acidilactici can secrete hydrogen peroxide, antimicrobial peptides and other antibacterial substances, which can directly inhibit the hyphae growth of Candida albicans and even cause damage to its cell membrane and death of hyphae. When Pediococcus acidilactici adheres to hyphae, it can competitively inhibit Candida albicans from obtaining the required nutrients and growth factors. For example, Pediococcus acidilactici may compete with Candida albicans for specific sugars or other nutrients, resulting in the restricted growth of Candida albicans hyphae.

[0131] Example 4

[0132] Effects of Pediococcus acidilactici IOB701 powder and its postbiotics on the ability of Candida albicans to adhere to cervical epithelial cells

[0133] Experimental Materials:

[0134] 1640 Complete Medium Gibco

[0135] Serum double antibody (penicillin and streptomycin) Beijing Solebow Technology Co., Ltd.

[0136] PBS Beijing Solebow Technology Co., Ltd.

[0137] MTT Reagent Biotech Research Institute

[0138] Crystal violet dyeBeijing Solebow Technology Co., Ltd.

[0139] Trypsin Beijing Solebow Technology Co., Ltd.

[0140] Paraformaldehyde Biotechnological Research Institute

[0141] Candida albicans, IOB701 bacterial powder and IOB701 postbiotic powder were prepared into 10 8 CFU / mL suspension, centrifuge, resuspend in 1640 complete medium without double antibody, and make Candida albicans suspension, IOB701 bacterial powder suspension and IOB701 postbiotic powder suspension. Take CaSki cells (human cervical cancer cell line) out of -80 ℃ and place in 37 ℃ water bath to thaw quickly. Add the thawed cells to the centrifuge tube containing 1640 medium on the operating table, centrifuge at 800 r / min, 3 min, centrifuge and discard the supernatant, add 2mL of medium to blow and aspirate the precipitate to suspend the precipitate to obtain cell suspension, prepare a culture dish and add 8mL of medium. Disperse the suspended cell suspension into the culture dish, shake it crosswise, place it in the incubator and culture it for 24 h. When CaSki cells grow to 80%, aspirate and discard the medium, add trypsin digestion, centrifuge, and make a cell suspension with 1640 medium containing serum double antibody.

[0142] Dilute the CaSki cell suspension to a concentration of 3 × 10 5 / mL, take 100μL of the diluted CaSki cell suspension and inoculate it into a 96-well plate, incubate it at 37℃, 5% CO2 for 18h, and then wash it with PBS.

[0143] The experiment was divided into background group, control group and experimental group, as shown in Table 1. In the background group, 100 µL 1640 medium was added to each well, in the experimental group, 50 µL Candida albicans suspension was added to each well, 50 µL IOB701 powder suspension was added to the IOB701 group, 50 µL IOB701 postbiotic suspension was added to the IOB701 postbiotic group, 50 µL Candida albicans suspension and 50 µL 1640 medium were added to the Candida albicans control group, 50 µL IOB701 powder suspension and 50 µL 1640 medium were added to the IOB701 control group, and 50 µL IOB701 postbiotic suspension and 50 µL 1640 medium were added to the IOB701 postbiotic control group, and incubated at 37 °C for 2.5 h;

[0144] Then, each group of cells was washed three times with PBS to remove non-adherent bacteria. After the cells were treated with MTT reagent, the optical density (OD) of the solution was measured under light with a wavelength of 490 nanometers (nm), and the relative adhesion rate was calculated. The results are shown in Tables 2, 3 and Figure 3 As shown, Figure 3 is the colonization rate of Candida albicans.

[0145] Table 1 Experimental groups

[0146]

[0147] Table 2 OD values ​​of each group

[0148]

[0149] Table 3 Relative adhesion rate of IOB701 bacterial powder and its postbiotics

[0150]

[0151] Relative adhesion rate (%) = (OD A +OD D ) / (OD B +OD C )×100%

[0152] Among them, the background group OD490nm is OD A , the OD490nm of Candida albicans in the control group was OD B OD490nm of bacterial powder or postbiotics in the control group was OD C , OD490nm of the experimental group was OD D .

[0153] Depend on Figure 3 It can be seen that the adhesion rate of untreated Candida albicans on CaSki cells was 100%, the relative adhesion rate decreased to 67.84% after the action of IOB701 bacterial powder, and the relative adhesion rate of Candida albicans decreased to 67.35% after the action of IOB701 postbiotics.

[0154] Study on the ability of Pediococcus acidilactici IOB701 powder and its postbiotics to adhere to cervical epithelial cells:

[0155] Adjust IOB701 powder and postbiotics to 10 7 CFU / mL, resuspended in complete medium without anti-1640. Sterilize the slide and place it in a six-well plate. Passage CaSki cells to the third generation, adjust the cell concentration and inoculate it in a six-well plate with a slide, at 37°C, 5% CO2, for 18h. Wash the cells with PBS and inoculate 600μL 10 7 CFU / mL IOB701 bacterial powder and postbiotic powder were incubated in the cell culture plate at 37℃ for 2h, PBS was added, and the decolorization shaker was repeated three times for 10min to remove the non-adherent bacterial powder and postbiotic powder. The cells were fixed with paraformaldehyde for 15min and stained with crystal violet dye. The adhesion of lactic acid Pediococcus to the cells was observed under an oil microscope. Figure 4 Schematic diagram of the adhesion of Pediococcus acidilactici IOB701 to cells. Figure 4It can be seen that a large amount of IOB701 powder and postbiotics adhere to CaSki cells, and both IOB701 live bacteria and postbiotics have good cell adhesion properties. Therefore, P. acidilactici IOB701 may compete with C. albicans for the same binding sites on cervical epithelial cells. This competition may reduce the available adhesion sites for C. albicans, thereby limiting its colonization.

[0156] Example 5

[0157] Coaggregation ability of Pediococcus acidilactici IOB701 powder and its postbiotics with Candida albicans

[0158] Candida albicans was activated to the third generation, centrifuged at 12000rpm for 2min, washed with PBS, and Candida albicans, IOB701 powder and postbiotics were resuspended in PBS and adjusted to an OD600nm of about 0.50. The suspension was added to a 1.5mL EP tube according to the following groups, vortexed at 500 rpm for 5min, and statically cultured at 37℃ for 2h. The supernatant was aspirated and the OD value of the solution was measured under light with a wavelength of 600nm, and the coaggregation rate was calculated. Three parallel experiments were performed in each group.

[0159] E: 500µL Candida albicans F: 500µL LIOB701 bacterial powder or 500µL LIOB701 postbiotic powder

[0160] G: 500µL Candida albicans + 500µL LIOB701 bacterial powder or 500µL Candida albicans + 500µL LIOB701 postbiotic powder

[0161] Coaggregation rate (%) = [(OD E0 +OD F0 -2OD Gt ) / (OD E0 +OD F0 )]×100%

[0162] Among them, the OD of Candida albicans at 0h is OD E0 , the OD of bacterial powder and postbiotic powder at 0h is OD F0 At a certain moment, the OD of IOB701 mixed with Candida albicans was OD Gt .

[0163] The OD values ​​and co-aggregation rates of each group are shown in Tables 4 and 5.

[0164] Table 4 OD E0 (Candida albicans), OD F0 (bacterial powder) and OD G0 OD value of (postbiotic powder)

[0165]

[0166] Table 5 OD Ct Coaggregation rate

[0167]

[0168] The average co-aggregation rate of the three parallel experimental groups at each time point was taken and plotted. Figure 5 , indicating the coaggregation ability of Pediococcus acidilactici IOB701 against Candida albicans, such as Figure 5 As shown in the figure, in the first 2 hours, the coaggregation ability of IOB701 powder and postbiotic powder with Candida albicans was 29.98% and 51.50%, respectively. At 8 hours, the coaggregation ability of IOB701 powder and postbiotic powder with Candida albicans reached 60.88% and 75.58%, respectively. At 10 hours, the coaggregation ability of IOB701 powder and postbiotic powder with Candida albicans reached 79.35% and 80.88%, respectively. The results show that IOB801 postbiotic powder has a relatively good coaggregation ability with Candida albicans.

[0169] Analysis of the autoaggregation of live bacteria and postbiotics of Pediococcus acidilactici IOB701:

[0170] Candida albicans was activated to the third generation, centrifuged at 12000 rpm for 2 minutes, washed with PBS, and 1 mL of PBS was added to resuspend Candida albicans, IOB701 powder, and IOB701 postbiotic powder until the OD600nm was about 0.5. 500 µL of the resuspended Candida albicans, IOB701 powder, and IOB701 postbiotic powder were added to 1.5 mL EP tubes, vortexed at 500 rpm for 5 minutes, and statically cultured at 37 ° C for 2 hours. The supernatant was aspirated and the OD value of the solution was measured under light with a wavelength of 600 nm. Three parallel experiments were performed in each group.

[0171] Self-aggregation rate (%) = (1- OD t / OD0)×100%

[0172] Among them, OD at a certain moment is OD t , OD at 0h is OD0, the measured values ​​and self-aggregation rate are shown in Table 6.

[0173] Table 6 OD t Value and self-aggregation rate

[0174]

[0175] The average of the self-aggregation rates of the three parallel experimental groups at each time point was plotted. Figure 6 , indicating the self-aggregation ability of Pediococcus acidilactici IOB701. Figure 6As shown in the figure, in the first 2 hours, the self-aggregation rate of IOB701 powder was 1.91%, and the self-aggregation rate of IOB701 postbiotics reached 36.88%. As time went on, the self-aggregation ability of IOB701 powder and postbiotics gradually increased. At 8 hours, the self-aggregation ability of IOB701 powder reached 34.03%, and the self-aggregation rate of IOB701 postbiotics reached 64.48%. In short, compared with IOB701 powder, IOB701 postbiotics have better self-aggregation.

[0176] Pediococcus acidilactici IOB701 and its postbiotics have strong self-aggregation ability, making them more likely to form aggregates with Candida albicans, that is, they have better co-aggregation ability with Candida albicans. This aggregate will limit the direct contact and adhesion of Candida albicans to vaginal epithelial cells, and may also competitively inhibit the growth and colonization of Candida albicans in the vaginal environment by occupying physical space. Thereby reducing its colonization and infection risks, helping to maintain or restore healthy microbial communities, and thus combating vaginitis caused by Candida albicans.

[0177] Example 6

[0178] Establishment and treatment of mouse model of candidal vaginitis

[0179] Thirty-five female Kunming mice (25-28 g SPF grade, 6-8 weeks old female Kunming mice) were selected and randomly divided into five groups after adaptive feeding for 7 days: control group, model group, lactic acid Pediococcus IOB701 powder treatment group, lactic acid Pediococcus IOB701 postbiotic treatment group, and plant lactobacillus 021 treatment group. Except for the control group, each mouse was subcutaneously injected with 0.05 mL of estradiol benzoate (2 mg / mL) every other day until the end of the experiment. After three consecutive injections of estradiol benzoate, 20 μL (10 9 CFU / mL) Candida albicans suspension was inoculated into the vagina of mice, and the mice were hung upside down with their heads facing down for 3-5 minutes. The control group was given an equal amount of normal saline and inoculated for 3 consecutive days. The colonization was observed every other day. The vaginal lavage fluid was taken for Gram staining to detect whether the model was successful.

[0180] After successful modeling, the control group was not modeled or treated, the model group was treated with 20 μL of normal saline after modeling, and the lactic acid Pediococcus IOB701 powder treatment group was given 20 μL (10 9 CFU / mL) of Pediococcus acidilactici IOB701 powder, and the postbiotic treatment group of Pediococcus acidilactici IOB701 was given 20 μL (10 9 CFU / mL) of Pediococcus acidilactici IOB701 postbiotic powder, and the Lactobacillus plantarum 021 treatment group was given 20μL (10 9CFU / mL) of Lactobacillus plantarum 021 live bacteria were treated by vaginal instillation for 8 days. During the experiment, mice were allowed to eat and drink freely. On the last day of treatment, the vagina of mice was irrigated with normal saline, and the vaginal irrigating fluid was stored at 4 ℃ for later use. Then the mice were killed by cervical dislocation, and the vagina of the mice was completely removed, one part was stored in paraformaldehyde, and the other part was stored at -80 ℃.

[0181] Example 7

[0182] Changes in hyphae formation in a mouse model of candidal vaginitis

[0183] After successful modeling, after infection with Candida albicans (0 day), on the 4th and 8th day of treatment, 100 μL of saline was taken with a micropipette to rinse the vagina of each group of mice, and 10 μL of the lavage fluid was applied to a clean cover glass. After it dried naturally, it was fixed with paraformaldehyde and Gram-stained. Then, it was placed under a microscope and photographed to observe the amount of Candida albicans hyphae in the lavage fluid after infection with Candida albicans and at different stages of treatment. The conversion rate of vaginal inflammation in mice after treatment was determined based on the presence or absence of hyphae.

[0184] Figure 7 is the amount of Candida albicans hyphae in the lavage fluid, Figure 7 It can be seen that after infection with Candida albicans (0 day), the lavage fluid of the infection group showed a large number of hyphae, while the lavage fluid of the control group showed no hyphae, indicating that the mouse Candida albicans vaginitis model was successful. The lavage fluid of the untreated model group continued to have a large number of hyphae (4 days and 8 days), indicating that the degree of Candida albicans infection did not change significantly, and after treatment for 4 days and 8 days respectively, the amount of hyphae in the vaginal lavage fluid of all treatment groups of mice decreased significantly.

[0185] At the same time, the degree of infection was graded according to the amount of hyphae. The results are shown in Table 7. After 4 days of treatment, there were no mice in the model group that turned negative. The infection in all treatment groups was alleviated. Except for the postbiotic group, there was no negative conversion. One mouse in the other treatment groups was cured. The infection degree of the treatment group was mostly grade I. After 8 days of treatment, the amount of hyphae in the lavage fluid of the model group was slightly reduced, and there was no negative conversion mouse. The negative conversion rate of mice in all treatment groups was higher than 71.43%. The above results show that if mice are not treated after infection, the hyphae in the mouse vagina will continue to grow. After 8 days of treatment with lactic acid Pediococcus IOB701, only a few mice in the lactic acid Pediococcus IOB701 powder treatment group and lactic acid Pediococcus IOB701 postbiotic treatment group still had hyphae in the vaginal lavage fluid, and most mice were detected without obvious hyphae.

[0186] According to the amount of hyphae in the vaginal lavage fluid of mice, the degree of infection was divided into three levels: Grade I, Grade II and Grade III. Grade I was when the amount of hyphae in each field of view was <10; Grade II was when the amount of hyphae in each field of view was 10-30; Grade III was when the amount of hyphae in each field of view was >30.

[0187] Table 7 Infection degree of mice

[0188]

[0189] Example 8

[0190] HE staining of vaginal tissue

[0191] After 7 days of treatment, the mice were killed by spinal dislocation, and the vaginal tissue was preserved in paraformaldehyde. The fixed vagina was removed for dehydration, embedding, slicing, etc., and then HE staining was performed, and the pathological conditions of each tissue were observed under a microscope.

[0192] Step 1: Place the slices in a hematoxylin solution for staining. Step 2: Separate the colors in acid water and ammonia water. Step 3: Rinse with running water for 1 hour and then immerse in distilled water. Step 4: Dehydrate in 70% and 90% alcohol for 10 minutes each. Step 5: Stain in alcohol eosin staining solution for 3 minutes. Step 6: Dehydrate the slices with 100% alcohol and make them transparent with xylene. Step 7: Drop gum on the slices and cover with a coverslip to seal. Step 8: Place the coverslip under a microscope and take pictures for observation.

[0193] The skin tissues of mice in each group were fixed and stained for observation. Figure 8 The pathological condition of vaginal tissue in mice. Figure 8 It can be seen that compared with the model group, the keratinized layer of the vaginal tissue in the control group was intact, smooth and continuous, without necrosis and shedding, no obvious inflammatory cell infiltration was found, and the cells were tightly connected. Compared with the control group, the keratinized layer in the model group showed obvious shedding, and the cells in the stratum spinosum and dermis of the vaginal tissue were loosely connected, with inflammatory factor infiltration. The relief effects of the lactic acid Pediococcus IOB701 powder treatment group and the lactic acid Pediococcus IOB701 postbiotic treatment group were similar to those of the plant lactobacillus 021 treatment group. Compared with the model group, the shedding of the stratum corneum and the infiltration of inflammatory cells were significantly improved.

[0194] Example 9

[0195] Changes of inflammatory factors IL-6 / TNF-α in vaginal lavage fluid of mice

[0196] The vaginal lavage fluid of the treated mice for 8 days was collected and the IL-6 and TNF-α in the vaginal lavage fluid were detected according to the instructions of the Elisa kit. The results are as follows: Fig. 9 and Fig.10As shown, Fig. 9 is the level of IL-6 in the vaginal lavage fluid of mice, Fig.10 is the level of TNF-α in the vaginal lavage fluid of mice. After 8 days of treatment, compared with the control group, the level of IL-6 in the model group was significantly increased, and the IL-6 levels in the lactic acid Pediococcus IOB701 powder treatment group and lactic acid Pediococcus IOB701 postbiotic powder treatment group were significantly reduced compared with the model group; compared with the control group, the level of TNF-α in the model group was significantly increased, and the TNF-α levels in the lactic acid Pediococcus IOB701 powder treatment group and lactic acid Pediococcus IOB701 postbiotic treatment group were significantly reduced compared with the model group. This result shows that lactic acid Pediococcus IOB701 powder and postbiotics have immunomodulatory functions, and may play a therapeutic role in vaginitis caused by Candida albicans by reducing inflammatory factors.

[0197] In summary, the present invention provides a strain of lactic acid Pediococcus acidilactici IOB701 and its postbiotics that can inhibit the formation of Candida albicans hyphae and reduce vaginal inflammation. The lactic acid Pediococcus acidilactici IOB701 and its postbiotics have a strong adhesion effect on cervical epithelial cells in in vitro tests, inhibit the formation of Candida albicans hyphae and adhere to cervical epithelial cells; in vivo experiments in mice have proved that IOB701 bacterial powder and postbiotics significantly alleviate vaginitis caused by Candida albicans. The above results suggest that lactic acid Pediococcus acidilactici IOB701 and its postbiotics may have good therapeutic and preventive effects on female vaginal infectious diseases.

Claims

1. An application of a postbiotic of Pediococcus acidilactici IOB701 in the preparation of a product that inhibits the formation of Candida albicans hyphae, characterized in that: The deposit number of the Pediococcus acidilactici IOB701 postbiotic is CGMCC No.16077; The preparation method of the Pediococcus acidilactici IOB701 postbiotics comprises: (1) Strain activation: inoculate Pediococcus acidilactici IOB701 from a cryopreserved tube into a seed culture medium and culture at 35-37°C for 20-24 hours to prepare an activated bacterial solution; (2) Seed solution preparation: inoculate the prepared activated bacterial solution into the seed culture medium at an inoculation rate of 1-3%, and culture it in a 35-37°C incubator for 20-22 hours to obtain a first-level seed solution; inoculate the first-level seed solution into the seed culture medium at an inoculation rate of 1-3%, and culture it in a 35-37°C incubator for 20-22 hours to obtain a second-level seed solution; (3) Expansion: Inoculate the prepared secondary seed solution into the fermentation medium at a rate of 1-3%, and culture in a 35-37°C incubator for 20-22 hours until the strain concentration reaches 1×10 9 -8.0×10 11 CFU / mL of bacterial solution; (4) Centrifugation: Centrifuge the cultured bacterial solution at 4-6°C and 4000-6000 rpm / min for 20-30 min, discard the supernatant, and collect the bacterial cells; (5) Inactivation: sterilize the bacterial pellet after centrifugation at 80-95°C for 20-30 min; (6) Drying: Collect the inactivated bacterial precipitate, place it at -80~-82℃ for pre-freezing for 2-3h, and then freeze-dry it. The drying temperature is set at -60~-80℃ and the drying time is 24-48h to obtain the postbiotics of Pediococcus acidilactici IOB701.

2. The use of the postbiotics of Pediococcus acidilactici IOB701 according to claim 1, characterized in that: The seed culture medium comprises: 1-2% peptone, 1-2% beef extract, 0.5-1% yeast extract, 1-2% glucose, 0.1-0.5% dipotassium hydrogen phosphate, 0.3-0.6% sodium acetate, 0.005-0.008% manganese sulfate, 0.1-0.2% Tween 80, 0.1-0.3% ammonium citrate, and pH 6.2-6.

4.

3. The use of the postbiotic of Pediococcus acidilactici IOB701 as claimed in claim 1, characterized in that: The fermentation medium comprises: 1.5-2.5% peptone, 1-2% yeast extract, 1.5-2.5% glucose, 0.3-0.6% dipotassium hydrogen phosphate, 0.3-0.6% sodium acetate, 0.01-0.03% magnesium sulfate, 0.001-0.005% manganese sulfate, 0.1-0.5% Tween 80, 0.2-0.5% ammonium citrate, and pH 6.2-6.4.

Images