Mutants of Streptomyces freundii TylF methyltransferase and their application in tylosin production

By mutating four amino acid sites of the TylF methyltransferase in Streptomyces freundii, the C/A conversion efficiency of tylosin was improved, solving the problem of temperature-limited enzyme activity and enabling efficient production of tylosin at low temperatures, thus reducing energy consumption.

CN118879655BActive Publication Date: 2025-10-31HUAZHONG AGRI UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410492363.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-04-23
Publication Date
2025-10-31
Estimated Expiration
2044-04-23

AI Technical Summary

Technical Problem

The existing TylF methyltransferase has a problem in tylosin production where the enzyme activity is limited by temperature. The temperature needs to be increased to 38°C to improve the C/A conversion rate of tylosin, resulting in high energy consumption.

Method used

Through protein molecular evolution studies, four amino acid site mutants of the TylF methyltransferase from Streptomyces freundii were obtained, which improved its enzyme activity at 30°C, thereby achieving efficient tylosin C/A conversion without heating.

Benefits of technology

The mutant proteins TylFQ138H, F232Y and TylFT36S, V54A showed significantly improved C/A conversion efficiency at 32℃, which was 1.43% and 2.70% higher than that of the wild type, respectively. High yields could be achieved without raising the temperature to 38℃, thus reducing energy consumption.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118879655B_ABST
    Figure CN118879655B_ABST
Patent Text Reader

Abstract

This invention belongs to the fields of biomedicine and bioengineering technology, specifically relating to mutants of *Streptomyces freundii* TylF methyltransferase and their application in tylosin production. The amino acid sequences of mutants and combined mutants of the TylF methyltransferase amino acid sites, and the corresponding nucleotide sequences of the encoding genes are provided. These mutants significantly improve the enzyme activity characteristics of TylF: (1) the mutants have higher TylF methyltransferase activity, which can significantly increase tylosin yield; (2) the mutants have a lower optimal catalytic temperature (30℃), which allows for efficient conversion of tylosin C to tylosin A (tylosin C / A conversion) without raising the temperature to 38℃ in the later stages of fermentation, reducing production energy consumption. This invention has application value in the genetic engineering modification of macrolide antibiotic biosynthetic strains such as tylosin and in the industrial production of macrolide antibiotics such as tylosin.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of biomedicine and bioengineering technology, specifically relating to mutants of four amino acid sites of TylF methyltransferase from Streptomyces freundii and their application in the production of macrolide antibiotics such as tylosin. Background Technology

[0002] Tylosin is a first-generation macrolide antibiotic specifically for animals. Since 1961, it has been used as a feed additive for animals and for the prevention and treatment of infections caused by Gram-positive bacteria and mycoplasma in livestock and poultry. Subsequent generations of animal-specific macrolide antibiotics, such as tilmicosin, tylosin, and tebuconazole, are all produced using tylosin as a raw material.

[0003] Tylosin is mainly produced industrially through fermentation with *Streptomyces freundii*. Fermentation produces four components: tylosin A (tylosin), tylosin B (decarboxymethyl tylosin), tylosin C (macrocin), and tylosin D (delomycin). Tylosin A is the main component and also the most active. Therefore, production requires a high concentration of tylosin A, at least 80%, while minimizing the content of other components.

[0004] The conversion of tylosin C to A (referred to as "tylosin C / A conversion") is crucial. This conversion is catalyzed by tylosin-O-methyltransferase (TylF methyltransferase). Encoded by the tylF gene of *Streptomyces freundii*, TylF methyltransferase is the rate-limiting enzyme in tylosin biosynthesis. It transfers the methyl group (-CH3) from S-adenosylmethionine (SAM) to the hydroxyl group (-OH) at the C3 position of tylosin C (tylosin), generating tylosin A. This is the rate-limiting step in tylosin synthesis. Existing TylF methyltransferases exhibit the highest activity at 38°C. Therefore, in the later stages of industrial-scale tylosin fermentation production, the fermentation broth temperature needs to be increased from 30°C to 38°C to improve the tylosin C / A conversion rate. This process requires a significant amount of energy.

[0005] Therefore, screening for TylF methyltransferases with high enzyme activity, or TylF with high enzyme activity at lower temperatures, plays an important role in improving the conversion efficiency of tylosin C / A components, and is crucial for the industrial production of macrolide antibiotics such as tylosin. Summary of the Invention

[0006] To improve the C / A conversion efficiency of tylosin and reduce energy consumption, this invention, through protein molecular evolution research, obtained mutants of four amino acid sites (including single-site mutants and combined mutants of multiple sites) of the tylosin-O-methyltransferase TylF (hereinafter referred to as "TylF methyltransferase") from *Streptomyces freundii*. These mutants can improve enzyme activity at 30°C, enabling efficient conversion of tylosin C / A components in industrial fermentation production without raising the temperature to 38°C, thereby improving production efficiency and reducing energy consumption.

[0007] To achieve the above objectives, this invention provides mutants containing four amino acid sites of the TylF methyltransferase and their combined mutants. The original amino acid sequence of the TylF mutant protein is shown in SEQ ID No. 17. The TylF mutant protein provided by this invention is TylF... Q138H,F232Y and TylF T36S,V54A The C / A conversion efficiency was highest at 32℃, and significantly higher than that of wild-type TylF, by 1.43% and 2.70%, respectively. Wild-type TylF had the highest C / A conversion efficiency at 38℃.

[0008] This invention also provides the encoding genes for four amino acid site mutant proteins containing TylF methyltransferase and their combined mutant proteins.

[0009] The present invention also provides recombinant bacteria containing the coding genes of mutant proteins at the four amino acid sites of TylF and their combined mutant proteins, including recombinant Streptomyces, Escherichia coli, Bacillus, etc., for the purpose of producing macrolide antibiotics such as tylosin.

[0010] Preferably, the starting strain is *Streptomyces freundii*. The method for preparing the recombinant strain includes the following steps:

[0011] Step 1: Clone the gene encoding the TylF mutant protein into a suitable expression vector to construct a recombinant plasmid;

[0012] Step 2: The recombinant plasmid is transferred into the recipient bacterial cells via conjugation transfer, and the recombinant bacteria are screened to obtain the recombinant bacteria.

[0013] Preferably, the expression vector is the pSET152 plasmid, the conjugation transfer donor is Escherichia coli ET12567, and the recipient is Streptomyces freundii.

[0014] Preferably, the ratio of donor strain to recipient strain is 1:9, and the conjugation transfer conditions are 30°C for 3 days.

[0015] Preferably, the pretreatment conditions for the recipient strain are: heat shock at 50°C for 10 min and pre-culture at 37°C for 2–3 h.

[0016] This invention also provides the application of the recombinant bacteria in the biosynthesis of macrolide antibiotics such as tylosin. The recombinant bacteria synthesize macrolide antibiotics such as tylosin through bio-fermentation.

[0017] Preferably, the macrolide antibiotic is tylosin.

[0018] Preferably, the tylosin fermentation seed culture medium is: 6 g / L corn steep liquor, 10 g / L yeast extract, 5 g / L low-temperature soybean meal powder, 3 g / L light calcium carbonate, 5 g / L soybean oil, pH 7.2.

[0019] Preferably, the culture medium for tylosin fermentation production is: 14 g / L corn flour, 8 g / L corn gluten meal, 7 g / L fish meal, 2 g / L cottonseed meal, 4 g / L peanut meal, 5 g / L fried soybean meal, 2 g / L light calcium carbonate, 3 g / L betaine hydrochloride, 0.3 g / L diammonium hydrogen phosphate, 1 g / L magnesium sulfate heptahydrate, 20 mg / L cobalt chloride, 13 mg / L nickel sulfate, and 54 g / L soybean oil, with a pH of 7.0.

[0020] Preferably, the fermentation production conditions for tylosin are as follows: recombinant bacteria are selected and inoculated into the fermentation seed culture medium, and cultured in a high-amplitude shaking incubator at 30℃ and 220r / min for 48h. Then, 10% of the inoculum is inoculated into the fermentation production culture medium, and cultured in a high-amplitude shaking incubator at 30℃ and 220r / min for 144h. After that, the temperature is raised to 38℃ and cultured for another 24h to end the fermentation.

[0021] Preferably, the detection method for tylosin is high-performance liquid chromatography (HPLC). HPLC detection conditions: C18 column (3.9×300mm), mobile phase: sodium perchlorate:acetonitrile (60:40, v / v), flow rate: 1mL / min, column temperature: 30℃, injection volume: 20μL, UV detection wavelength: 280nm.

[0022] The beneficial effects of this invention are:

[0023] The present invention provides the TylF mutant protein TylF Q138H,F232Y and TylF T36S,V54A The highest C / A conversion efficiency was observed at 32℃, significantly higher than that of wild-type TylF, with increases of 1.43% and 2.70%, respectively. Wild-type TylF exhibited the highest C / A conversion efficiency at 38℃. This invention utilizes the TylF mutant protein TylF... Q138H,F232Y and TylF T36S ,V54A The encoding gene was used to construct the recombinant strain SF-3::PtylF-tylF Q138H,F232Y and SF-3::PtylF-tylFT36S,V54A In the later stages of fermentation, it is not necessary to raise the temperature of the fermentation broth from 30℃ to 38℃ to achieve the maximum yield of tylosin A. Attached Figure Description

[0024] Figure 1 TylF and the mutant enzyme TylF in Example 3 Q138H,F232Y TylF T36S,V54A TylF V54D Tylosin C / A conversion rate at different in vitro temperatures.

[0025] Figure 2 The SF-3 strain and SF-3::PtylF-tylF in Example 5 T36S,V54A The yield (A) of tylosin A and the tylosin C / A conversion rate (B) of the recombinant strain at different temperatures in the later stage of fermentation. Detailed Implementation

[0026] Unless otherwise specified, the experimental methods used in the following examples are all commonly used laboratory methods.

[0027] Those skilled in the art should understand that the discussion of any of the following embodiments is merely exemplary and is not intended to imply that the scope of the invention (including the claims) is limited to these examples; within the framework of the invention, the technical features of the above embodiments or different embodiments can also be combined, the steps can be implemented in any order, and there are many other variations of the different aspects of the invention as described above, which are not provided in detail for the sake of brevity.

[0028] This invention is intended to cover all such substitutions, modifications, and variations that fall within the broad scope of the appended claims. Therefore, any omissions, modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this invention should be included within the scope of protection of this invention.

[0029] In the following examples, Streptomyces freundii SF-3 was donated by Wuhan Huisheng Biotechnology Co., Ltd., China. The plasmids pKC1139 and pSET152 were used to construct the tylF gene deletion strain (ΔtylF) and the complement strain (CΔtylF), respectively.

[0030] In the following examples, the *Streptomyces freundii* tylF gene deletion strain (ΔtylF) and complement strain (CΔtylF) were constructed using the following methods:

[0031] (1) The tylF gene deletion strain (ΔtylF) was constructed by Streptomyces freundii SF-3, using the same method as gene knockout for most Gram-positive bacteria.

[0032] Based on the publicly available sequence information (GenBank accession number AF147703.1), using primers tylF-A (as shown in SEQ ID No. 01: AGGTCGACTCTAGAGGATCCCGCCATGGGGAGCGCGAAGT) and tylF-B (as shown in SEQ ID No. 02: CTCTCGGGCGGAACGACTCAGTGGTCCGGGGAAGGTGCCACG) as templates, the upstream homologous arm of the tylF gene was amplified by PCR using the genome of *Streptomyces freundii* strain SF-3.

[0033] Using primers tylF-C (as shown in SEQ ID No. 03: CGTGGCACCTTCCCCGGACCACTGAGTCGTTCCGCCCGAGAGCCC) and tylF-D (as shown in SEQ ID No. 04: GTGGCACCTTCCCCGGACCACTGAGTCGTTCCGCCCGAGAGCCC) as templates, the downstream homologous arm of the tylF gene was amplified using the genome of *Streptomyces freundii* strain SF-3. The PCR reaction program was: 98℃ for 5 min, 30 cycles (98℃ for 10 s, 60℃ for 10 s, 72℃ for 45 s), 72℃ for 5 min.

[0034] The amplified upstream and downstream homologous arm fragments were ligated to the BamHI site of the pKC1139 plasmid using the ClonExpress MultiS One StepCloning Kit from Novizuma. The ligation was carried out at 37°C for 30 min. The recombinant plasmid was electroporated into the donor strain *Escherichia coli* ET12567, and then introduced into *Streptomyces freundii* SF-3 via *E. coli*-streptomyces conjugate transfer. The bacteria were then cultured at 28°C for 4-5 days. Positive conjugation transferons were detected using primers. Stranded positive strains were transferred to new MS plates containing 50 μg / mL apramycin and cultured at 37°C for 2-3 days. Single-exchange transformations were detected using primers as shown in SEQ ID No. 05 (tylF-outF: TGATCAGCCGGTCGAGGTAG), SEQ ID No. 06 (tylF-D: ATGA TTACGAATTCGATATCGACATCCCCCGGGCCGTCAC), SEQ ID No. 07 (tylF-outR: GCTTCGACCAGATCGTCGAC), and SEQ ID No. 08 (tylF-A: AGGTCGACTCTAGAGGATCCCGCCATGGGGAGCGCGAAGT).

[0035] Bacteria exhibiting single crossover were selected and cultured in YEME (yeast extract peptone glucose medium) at 28°C for 4-5 days. These colonies were then plated onto MS plates and incubated at 28°C for 4-5 days. Single colonies grown on MS plates were transferred to MS plates containing 50 μg / mL apramycin and to antibiotic-free MS plates, and incubated at 37°C. If bacteria grew on antibiotic-free MS plates but not on MS plates containing 50 μg / mL apramycin, they were considered candidate strains for the tylF deletion mutant, and further PCR and sequencing identification were performed. The gene deletion strain (ΔtylF) was obtained.

[0036] (2) Based on the prediction, the transcription promoter of the tylF gene was determined to be located upstream of the tylF gene. Therefore, using primers PtylF-F152 (AGGTCGACTCTAGAGGATCCGACTCGCTGCGGCCTCAACG) as shown in SEQ ID No. 09 and primers tylF-R (TCAGCCGCTGTGCCGCCAAT) as shown in SEQ ID No. 10, the tylF gene and its promoter were amplified by PCR using the genome of Streptomyces freundii SF-3 as a template. The amplified ...

[0037] (3) The results were validated by PCR amplification, fermentation, and tylosin assay. HPLC results from fermentation showed that tylF knockout completely blocked the conversion from dacryomycin to tylosin, and the restoration of tylF expression restored tylosin production. This confirms that tylF is an indispensable component in tylosin biosynthesis and demonstrates that tylF restoration was achieved.

[0038] Example 1: Molecular evolution of TylF protein and screening of highly active mutants

[0039] The main method of this embodiment includes: amplifying the coding region (CDS) of the *Streptomyces freundii* tylF gene using error-prone PCR; introducing a random mutation into the tylF gene fragment; amplifying the promoter sequence of the tylF gene in the *Streptomyces freundii* genome; cloning the promoter sequence of the tylF gene and the mutated tylF gene fragment together into the pSET152 plasmid; obtaining the recombinant plasmid pSET152:ep-tylF carrying the random mutation fragment of the tylF gene; transferring the recombinant plasmid pSET152:ep-tylF into *E. coli* DH5α cells to prepare a recombinant plasmid library; electroporating the recombinant plasmid into *E. coli* ET12567 (Miaoling); using *E. coli* ET12567 as a donor; and delivering the mutated tylF gene fragment to a gene-deleted strain (ΔtylF) via *E. coli*-Streptomyces conjugate transfer to obtain a random mutant library of the *Streptomyces freundii* tylF gene.

[0040] By micro-fermentation and HPLC analysis of *Streptomyces freundii*, high-yielding mutant strains of tylosin A and mutant strains with high tylosin C / A conversion rates were screened. DNA sequencing was used to identify the mutation sites of the tylF gene in these mutant strains.

[0041] 1. Construction of a random mutant library of the *Streptomyces freundii* tylF gene based on error-prone PCR:

[0042] Using *Streptomyces freundii* genomic DNA as a template, the coding region sequence of the tylF gene was amplified using primers as shown in SEQ ID No. 11: eptylF-F (5'-CCC GCT ACT GGA GGA CCC GTG GCA CCT TCC CCG GAC CA-3') and primers as shown in SEQ ID No. 12: eptylF-R (5'-ATG ATT ACG AAT TCG ATA TCT CAG CCG CTG TGC CGC C-3').

[0043] The error-prone PCR reaction system is as follows:

[0044] Taq DNA polymerase (Cwbio) 2.5U, 10mM dATP 1μL, 10mM dGTP 1μL, 10mM dCTP 5μL, 10mM dTTP 5μL, 10×PCR Buffer (Cwbio) 5μL, Mn 2+ 0.1–0.3 mM, Mg 2+ Add 0.5 μL of 10 μM eptyl F-F, 0.5 μL of 10 μM eptyl F-R, and 20 ng of template DNA to a final volume of 50 μL with water.

[0045] The PCR reaction procedure is as follows:

[0046] 94℃ for 5 min, 30 cycles (94℃ for 30 s, 58℃ for 30 s, 72℃ for 45 s), 72℃ for 3 min.

[0047] Through the above steps, a random mutant library of the tylF gene was obtained by error-prone PCR amplification.

[0048] 2. The promoter sequence of the tylF gene was amplified from the genome of *Streptomyces freundii* using primers as shown in SEQ ID No. 13: PtylF-F (5'-AGG TCG ACT CTA GAG GAT CCGACT CGC TGC GGC CTC AAC G-3') and primers as shown in SEQ ID No. 14: PtylF-R (5'-GTC CGGGGA AGG TGC CAC-3').

[0049] 3. Subsequently, the tylF gene random mutation library obtained in step 1 and the tylF promoter sequence obtained in step 2 were recombined into the BamHI site of the pSET152 plasmid using a multi-fragment one-step cloning kit (Vazyme), resulting in the recombinant plasmid pSET152:ep-tylF carrying a random mutation fragment of the tylF gene. The recombinant plasmid pSET152:ep-tylF was then transferred into *E. coli* DH5α cells to prepare a recombinant plasmid library. Sequencing of the plasmids extracted from transformants determined that the base mismatches in the error-prone PCR products were approximately 90-100%. Then, the plasmids were mixed with approximately 1 × 10⁻⁶ ions. 5 All transformants consisting of clones yielded a mutant library.

[0050] 4. Electroporate the recombinant plasmid library with random mutations of the tylF gene obtained in step 3 into Escherichia coli ET12567, and then transfer it to Streptomyces freundii strain with tylF gene deletion ΔtylF to obtain a Streptomyces freundii tylF gene random mutant library.

[0051] Electroporation of Escherichia coli ET12567: ET12567 electroporation competent cells stored at -80℃ were thawed naturally on an ice bath. No more than 5 μL of the recombinant plasmid with a random mutation of the tylF gene to be transformed was added, and the mixture was gently shaken to mix. The mixture was transferred to a sterile and pre-cooled 1 mm electroporation cuvette, and electroporated at 1.8 kV for 5.8 ms. Immediately afterward, 500 μL of LB medium was added, and the mixture was incubated at 28℃ with shaking for 2 h.

[0052] Streptomyces freundii conjugation transfer:

[0053] (1) Preparation of donor bacteria ET12567: Select a single colony of the identified culture and inoculate it into 5 mL of LB liquid medium containing 25 μg / mL kanamycin, 25 μg / mL chloramphenicol and 50 μg / mL apramycin. After incubating overnight at 28°C with shaking, transfer it to 25 mL of LB liquid medium containing the same antibiotics at a 1:50 inoculation rate and incubate at 28°C with shaking until OD. 600 The turbidity is approximately 0.7. Centrifuge at 4000 r / min for 10 min at 4℃, discard the supernatant, and wash the bacterial cells twice with an equal volume of physiological saline to fully remove residual antibiotics. Take an appropriate amount of bacterial cells and prepare a bacterial suspension with a McFarland turbidity of 0.7 using physiological saline for later use.

[0054] (2) Preparation of the mutant ΔtylF of Streptomyces freundii with deletion of tylF gene: After the ΔtylF strain was cultured in Gao's No. 1 medium until the spores matured, 5 mL of TES Buffer was added to the plate, and the spores were gently scraped off with a disposable sterile spreader and transferred to a bacterial bottle. The plate was heat-shocked in a 50℃ constant temperature water bath for 10 min. After cooling to room temperature, an equal volume of 2× spore pre-germination medium was added to the spore suspension. The plate was cultured at 37℃ with shaking for 2-3 h. The plate was centrifuged at 5000 r / min for 15 min, and the germinated spores were collected. The spore suspension with a McFarland turbidity of about 0.7 was prepared with physiological saline for later use.

[0055] (3) Conjugation transfer: The prepared donor bacterial suspension and recipient bacterial suspension were mixed at a volume ratio of 1:9, vortexed thoroughly, and then spread on an MS plate containing 10 mM MgCl2. After incubation at 28°C for 18 h, the culture on the plate was washed off with physiological saline and spread on an MS plate containing 50 μg / mL apramycin and 50 μg / mL naridinolone acid. The conjugation transferon was obtained by incubation at 28°C for 2-3 days.

[0056] 5. Screening of mutant libraries using micro-fermentation method:

[0057] Using the original Streptomyces freundii strain SF-3 and the complement strain of ΔtylF (CΔtylF) as control strains, the tylF mutant strains from the random mutant library of the tylF gene obtained in step 4 above were inoculated one by one into 24-well culture plates, with 2 mL of seed medium per well. After incubation at 30℃ for 48 h, 10% of the culture was transferred to 24-well culture plates containing 1.5 mL of fermentation medium and incubated at 30℃ for 120 h. After fermentation, the culture was centrifuged at 3000 r / min for 15 min, and the supernatant was collected. The tylosin components and contents in the fermentation broth were detected by HPLC, and the tylosin C / A conversion rate was calculated.

[0058] High-yielding mutant strains of tylosin A and mutant strains with high tylosin C / A conversion rates were screened out, and the mutation sites of the tylF gene in these mutant strains were identified by DNA sequencing.

[0059] In the first round of screening, HPLC analysis revealed that a total of nine mutant strains exhibited higher tylosin yields. All nine mutants also demonstrated high conversion efficiency from piracetam to tylosin. The mutation site of the tylF gene in the high-yielding mutants was identified through amplification of the tylF gene from the mutant genome and subsequent DNA sequencing analysis. (See figure.) Table 1 Significant mutations were identified in all nine mutants, with the number of amino acid mutations for each protein ranging from 1 to 3.

[0060] Table 1. Mutation sites of the tylF gene in high-yielding strains

[0061]

[0062] The HPLC detection method was as follows: First, the strain was cultured in an Erlenmeyer flask containing 50 ml of seed culture medium at 30°C and 220 rpm for 2 days to obtain mycelium. Then, the mycelium was subcultured in 30 ml of fermentation medium. This was followed by culturing for another 7 days under the same conditions. The fermentation product was extracted by centrifugation, and tylosin was quantified using an Agilent 1260 series high-performance liquid chromatography (HPLC) column (Agilent Technologies, Palo Alto, CA, USA).

[0063] The relevant parameters for HPLC detection are as follows: chromatographic column: C-18, 3.9×300mm, column temperature: 30℃, mobile phase: 2M sodium perchlorate (pH 2.5): acetonitrile = 60:40, eluent flow rate: 1.0mL / min, injection volume: 20uL, UV detection wavelength: 280nm, detection time: 30min / sample.

[0064] Example 2: Expression and purification of TylF and its mutant protein

[0065] Using the genomic DNA of the *Streptomyces freundii* mutant strain obtained in step 4 of Example 1 as a template, PCR amplification was performed using primers as shown in SEQ ID No. 15: F28a(NdeI)-tylF-F(5'-GCC TGG TGC CGC GCG GCA GCG TGG CACCTT CCC CGG ACC A-3') and primers as shown in SEQ ID No. 16: F28a(NdeI)-tylF-R(5'-TGT CCACCA GTC ATG CTA GCT CAG CCG CTG TGC CGC CAA T-3'). The PCR program was 98℃ for 5 min, 98℃ for 10 s, 60℃ for 10 s, and 72℃ for 1 min, for 30 cycles.

[0066] The amplified products (encoding nucleotide sequences of TylF and its mutant protein) were digested with NdeI and ligated to the pET28a plasmid, which was also digested with the same enzyme. After the recombinant plasmid was verified by sequencing, it was transformed into E. coli BL21(DE3) to express the mutant protein with an N-terminal His6 tag. The expression of TylF methyltransferase was induced by IPTG at 18°C. The culture was centrifuged at 10,000 rpm for 15 minutes to harvest cells, and the cell pellet was resuspended in lysis buffer (50 mM Tris-HCl, 300 mM NaCl, 20 mM imidazole, 10% (v / v) glycerol, pH 7.6) and lysed under high pressure in a cell disruptor (Life Technologies, Carlsbad, CA, USA).

[0067] The lysed expression product was purified into soluble recombinant protein according to the Ni-NTA Purification System (Invitrogen) instructions. The purified recombinant protein was analyzed by SDS-PAGE; the molecular weight should be around 28.7 kDa. The recombinant protein was concentrated using a 10 kDa ultrafiltration tube (Merck), aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C.

[0068] Example 3: In vitro determination of TylF methyltransferase activity

[0069] The in vitro assay of tylosin-O-methyltransferase activity was performed in a 1 mL reaction system (50 mM Tris-HCl, 10 mM MgCl2, 6 mM 2-mercaptoethanol, 1 mM phenylmethanesulfonyl fluoride (PMSF), 0.4 mM SAM, 0.2 mM tylosin C, pH 7.6). After adding 4 μM of TylF protein or its mutant protein (obtained in Example 2) and mixing thoroughly, the mixture was incubated at 30 °C for 1 h. The reaction was then terminated by placing the mixture in a boiling water bath for 10 min. The mixture was centrifuged at 12000 r / min for 10 min, and the supernatant was collected. The yield of tylosin A and the tylosin C / A conversion ratio were determined using the HPLC method described in Example 1.

[0070] The results are as follows Figure 1 As shown. The TylF point mutant protein TylF in strains EP2-7, EP11-1, and EP21-19. Q138H,F232Y TylF T36S,V54A and TylF V54D The highest C / A conversion rate was observed at 32℃, significantly higher than that of wild-type TylF. Among them, TylF... Q138H,F232Y and TylF T36S,V54A The C / A conversion rates of tylosin were increased by 1.43% and 2.70%, respectively, while wild-type TylF showed the highest enzyme activity at 38°C.

[0071] The original amino acid sequence of TylF methyltransferase is shown in SEQ ID No. 17. DNA sequencing revealed that the mutant protein of strain EP2-7 has two amino acid mutation sites compared to the original amino acid sequence of TylF methyltransferase: glutamine (Q) at position 138 is mutated to histidine (H), and phenylalanine (F) at position 232 is mutated to tyrosine (Y). This mutation site is denoted as TylF. Q138H,F232Y The amino acid sequence of the TylF methyltransferase with the mutation site is shown in SEQ ID No. 18.

[0072] The mutant protein of strain EP11-1 has two amino acid mutation sites compared to the original amino acid sequence of TylF methyltransferase: threonine (T) at position 36 is mutated to serine (S), and valine (V) at position 54 is mutated to alanine (A). This mutation site is denoted as TylF. T36S,V54A The amino acid sequence of the TylF methyltransferase with the mutation site is shown in SEQ ID No. 19.

[0073] The mutant protein of strain EP21-19 has one amino acid mutation site compared to the original amino acid sequence of TylF methyltransferase: valine (V) at position 54 is mutated to aspartic acid (D). This mutation site is denoted as TylF. V54DThe amino acid sequence of the TylF methyltransferase with the mutation site is shown in SEQ ID No. 20.

[0074] Example 4: Construction of recombinant Streptomyces freundii containing the tylF mutant gene

[0075] With tylF T36S,V54A Recombinant bacteria were constructed using a gene as an example. Using the method in step 3 of Example 1, the coding sequence of the tylF mutant gene was amplified by PCR and recombined with the tylF gene promoter PtylF into the BamHI site of the pSET152 plasmid, obtaining the recombinant plasmid pSET152:ep-tylF carrying a random mutant fragment of the tylF gene. This plasmid was then transformed into *E. coli* ET12567 using the electroporation method in step 4 of Example 1. Using *E. coli* ET12567 containing the recombinant plasmid as the donor bacterium and *Streptomyces freundii* as the recipient bacterium, the recombinant plasmid was transferred to *Streptomyces freundii* using the conjugation transfer method in step 4 of Example 1. Single colonies were picked for PCR detection, and positive single colonies were further purified and cultured to obtain recombinant *Streptomyces freundii* containing the tylF mutant gene, namely SF-3::PtylF-tylF. T36S,V54A Recombinant strain.

[0076] PCR program: 98℃ for 5 min, 98℃ for 10 s, 60℃ for 10 s, 72℃ for 1 min, 30 cycles.

[0077] This embodiment provides a detailed implementation method and specific operation process, but the recombinant Streptomyces freundii containing the tylF mutant gene constructed by this invention is not limited to the above embodiment, but also includes strains containing tylF. Q138H,F232Y or tylF V54D or tylF V54A or tylF Q138H or tylF F232Y or tylF T36S Recombinant bacteria were constructed using genes as an example.

[0078] With tylF V54A Taking the gene as an example, the mutant protein expressed by the recombinant bacteria has one amino acid mutation site compared to the original amino acid sequence of TylF methyltransferase: valine (V) at position 54 is mutated to aspartic acid (A). This mutation site is denoted as TylF. V54A The amino acid sequence of the TylF methyltransferase with the mutation site is shown in SEQ ID No. 22.

[0079] With tylF Q138HTaking the gene as an example, the mutant protein expressed by the recombinant bacteria has one amino acid mutation site compared to the original amino acid sequence of TylF methyltransferase: glutamine (Q) at position 138 is mutated to histidine (H). This mutation site is denoted as TylF. Q138H The amino acid sequence of the TylF methyltransferase with the mutation site is shown in SEQ ID No. 23.

[0080] With tylF F232Y Taking the gene as an example, the mutant protein expressed by the recombinant bacteria has one amino acid mutation site compared to the original amino acid sequence of TylF methyltransferase: phenylalanine (F) at position 232 is mutated to tyrosine (Y). This mutation site is denoted as TylF. F232Y The amino acid sequence of the TylF methyltransferase with the mutation site is shown in SEQ ID No. 24.

[0081] With tylF T36S Taking the gene as an example, the mutant protein expressed by the recombinant bacteria has one amino acid mutation site compared to the original amino acid sequence of TylF methyltransferase: the threonine (T) at position 36 is mutated to a serine (S). This mutation site is denoted as TylF. T36S The amino acid sequence of the TylF methyltransferase with the mutation site is shown in SEQ ID No. 25.

[0082] The nucleotide sequence shown in SEQ ID No. 26 is the original nucleotide sequence of the tylF gene from *Streptomyces freundii*. The four underlined codons are the codons for threonine (T) at position 36, valine (V) at position 54, glutamine (Q) at position 138, and phenylalanine (F) at position 232, as described in Example 4. Mutating these four nucleotide codons in the nucleotide sequence shown in SEQ ID No. 26 yields tylF. Q138H,F232Y or tylF V54D or tylF V54A or tylF Q138H or tylF F232Y or tylF T36S Genes, specifically mutant proteins, consist of degenerate nucleotide sequences encoding the same mutated amino acid site. The specific details of mutated codons with four nucleotide codons are as follows:

[0083] acc 36 : The acc mutation can be converted to tcc, tca, tcg, tct, agt, or agc;

[0084] GTC 54 : The mutation of gtc into gcc, gct, gca, gcg, gac, or gat;

[0085] cag 138 : mutated from cag to cat, aca;

[0086] ttc 232 : mutated from ttc to tac, tat.

[0087] SEQ ID No.26:

[0088] gtggcaccttccccggaccacgcccgcgatctctacatcgagctgctgaagaaggtcgtctcgaacgtcatctacgaggaccccacccatgtggcggggatgatc acc 36 gacgcgtcgttcgaccggacgtcccgtgagagcggcgaggactaccccacg GTC 54 gcccacacgatgatcggcctcaagcgtctggacaatctccaccggtgcctcgcggacgtcgtggaggacggcgtccccggtgacttcatcgagaccggggtgtggcgcggcggcgcctgcatcttcgcccgcggactgctgaacgcgtacggccaggccgaccgcaccgtctgggtcgccgactccttccagggctttcccgagctgaccgggtccgaccacccgctggacgtcgagatcgacctccac cag 138 tacaacgaggccgtggacctgcccaccagcgaggagaccgtgcgggagaacttcgcccggtacgggctgctcgacgacaacgtccgtttcctggcggggtggttcaaggacaccatgccggctgcgcccgtgaagcagctcgcggtgatgcgcctggacggcgactcctacggcgccaccatggatgtgctcgacagcctgtacgagcggctgtcgccgggcggttacgtcatcgtcgacgactactgcatcccggcctgccgcgaggcggtgcacgac ttc 232cgcgaccggctcggcatccgcgacacgatccaccggatcgaccgccagggcgcctattggcggcacagcggctga

[0089] Example 5: Fermentation of *Streptomyces freundii* and determination of tylosin yield and composition.

[0090] Scrape the spores of *Streptomyces freundii* cultured on Gao's No. 1 medium. These spores include wild-type *Streptomyces freundii* strain SF-3 and the SF-3::PtylF-tylF strain from Example 4. T36S,V54A The recombinant strain, with wild-type Streptomyces freundii SF-3 as a control, was prepared using sterile physiological saline to achieve a McFarland turbidity of 0.5 (approximately 1.5 × 10⁻⁶). 8 A spore suspension (CFU / mL) was vortexed and mixed thoroughly. 1 mL of this suspension was inoculated into seed culture medium and cultured for 46–48 h in a high-amplitude shaking incubator at 30°C, 35% humidity, and 220 rpm. The nucleic acid content of the culture was then measured. Subculture was performed by inoculating 30 mL of fermentation medium with a culture containing 0.09 g of nucleic acid. The culture was first cultured for 144 h under the above conditions in a high-amplitude shaking incubator, then the temperature was adjusted to 38°C and cultured for another 24 h to terminate the fermentation. The HPLC method described in Example 1 was used to determine the content of tylosin C and A components in the fermentation broth.

[0091] Determination of nucleic acid content in *Streptomyces freundii*: Take 2 mL of fermentation broth into a 15 mL centrifuge tube, centrifuge at 3500 r / min for 15 min, and discard the supernatant; add 5 mL of physiological saline, vortex to mix, centrifuge at 3500 r / min for 15 min, and discard the supernatant; add 2 mL of 10% trichloroacetic acid solution, vortex to mix, cool at -20℃ for 3 min, centrifuge at 3500 r / min for 15 min, and discard the supernatant; add 2 mL of 5% trichloroacetic acid solution, vortex to mix, boil in a water bath for 30 min, cool to room temperature, and then centrifuge at 3500 r / min for 15 min; take 4 μL of supernatant into 196 μL of purified water, vortex to mix, and detect the absorbance A260 of the sample at 260 nm wavelength using a UV spectrophotometer; calculate the nucleic acid content according to the following formula: Nucleic acid content (mg / mL) = A260 × 1.72 × 50 / 2 (1.72 is the absorption coefficient).

[0092] The results are as follows Figure 2 As shown, SF-3 requires the temperature to be raised from 30℃ to 38℃ and maintained for 24 hours during the later stages of fermentation to achieve efficient conversion of the tylosin C / A component. The engineered strain SF-3::PtylF-tylF... T36S,V54AThe efficient conversion of tylosin C / A components can be achieved without raising the temperature in the later stage of fermentation (maintaining at 30℃), and the tylosin A production level can reach no less than that of strain SF-3.

[0093] This embodiment provides a detailed implementation method and specific operation process. However, other recombinant Streptomyces freundii strains containing the tylF mutant gene constructed in this invention also exhibit high enzyme activity at lower temperatures when expressing TylF methyltransferase. Other recombinant Streptomyces freundii strains containing the tylF mutant gene also include those expressing tylF... Q138H,F232Y or tylF V54D or tylF V54A or tylF Q138H or tylF F232Y or tylF T36S Recombinant bacteria constructed using genes as an example.

Claims

1. A TylF methyltransferase, characterized in that, The amino acid sequence of the TylF methyltransferase is shown in SEQ ID No. 18 or SEQ ID No.

19.

2. A nucleic acid containing a nucleotide sequence encoding the TylF methyltransferase of claim 1.

3. A recombinant plasmid, characterized in that, The recombinant plasmid is linked with the nucleotide sequence of claim 2 and the nucleotide sequence of the tylF promoter.

4. A recombinant bacterium containing the nucleotide sequence of claim 2 or the recombinant plasmid of claim 3, wherein the recombinant bacterium includes Streptomyces, Escherichia coli, Bacillus, and Streptomyces freundii.

5. The application of the recombinant bacteria of claim 4 in the preparation of tylosin, wherein the recombinant bacteria is Streptomyces.

Citation Information

Patent Citations

  • Tylosin gene engineering strain and application thereof

    CN102690775A

  • Improvements in or relating to antibiotic-producing microorganisms

    CN87102137A