Application of plasma exosome-derived miRNA in the preparation of products for the diagnosis and / or prognosis assessment of acute myeloid leukemia

Abstract

This invention discloses the use of plasma exosome-derived miRNA in the preparation of products for the diagnosis and / or prognosis assessment of acute myeloid leukemia. This invention can be used as a prognostic indicator or early diagnosis indicator for AML patients and has promising application prospects in predicting the prognosis or early diagnosis of AML patients.

Description

Technical Field

[0001] The present invention relates to the technical field of disease diagnosis and prognosis assessment, and in particular to the use of plasma exosome-derived miRNA in the preparation of products for the diagnosis and / or prognosis assessment of acute myeloid leukemia. Background Art

[0002] Acute myeloid leukemia (AML) is a highly heterogeneous group of malignant clonal diseases originating from myeloid hematopoietic stem cells. Except for acute promyelocytic leukemia, the complete remission (CR) rate for AML remains at 80%, while the long-term disease-free survival (DFS) rate is less than 30%. Many patients still die from refractory AML relapse or treatment-related complications. The incidence of AML increases with age. Approximately 75% of AML patients develop the disease between 55 and 65 years of age, with a median age of diagnosis of approximately 67 years. The incidence of AML continues to rise annually, with the rate of new cases increasing by an average of 1.5% per year. Currently, the mainstay of treatment for AML is the "7+3" regimen, which consists of three days of anthracyclines such as daunorubicin and idarubicin combined with seven days of cytarabine. This regimen achieves a complete remission rate of up to 80% in patients under 60 years of age, but many still face relapse. Data from the International Bone Marrow Transplant Group show that post-transplant relapse is the leading cause of death in patients 100 days after transplantation, accounting for 30%-50% of deaths. Elderly patients, limited by comorbidities and organ dysfunction, are unable to tolerate intensive or standard-dose chemotherapy, resulting in lower CR rates, shorter duration of complete remission, and higher early mortality in this population.

[0003] Exosomes are bilayer lipid membrane vesicles with a diameter ranging from 30 to 100 nm, secreted by a variety of cells. They are ubiquitous in various bodily fluids and can be found in peritoneal fluid, saliva, serum, plasma, breast milk, cerebrospinal fluid, and cell culture medium. After two cell membrane invaginations, the cell membrane forms multivesicular bodies, which contain multiple intraluminal vesicles. After further fusion with the cell membrane, the intraluminal vesicles are secreted from the cell to form exosomes. Exosomes therefore contain proteins (including membrane and cytoplasmic proteins), nucleic acids, metabolites, and other substances from the source cells. Exosomes can be distributed locally or systemically through body fluids, interacting with other cells through membrane protein interactions or membrane fusion, enabling intercellular communication. Exosomes have multiple effects on AML, including: 1. Inhibiting apoptosis. Co-culture with exosomes derived from apoptosis-resistant AML cells upregulated BCL-2 expression and attenuated apoptosis in tumor cells. Exosome-derived miR-125b from AML cells can inhibit apoptosis by suppressing gene expression in the p53 pathway. 2. Influencing anti-tumor immunity. On the one hand, tumor-derived exosomes can influence anti-tumor immunity in cancer patients by inducing T cell apoptosis and upregulating PD-1 on the T cell surface. On the other hand, exosomes promote T cell function through dendritic cells. Exosomal miRNA-155-5p can also promote IFN-γ secretion by NK cells by downregulating the SOCS-1 pathway. Various molecules contained in exosomes can have different effects on T cells. Apoptotic ligands FasL / TRAIL on the exosome membrane induce T cell apoptosis; immune checkpoint ligands PD-L1 and Galectin-9 inhibit T cell activation and anti-tumor function; and TGF-β can induce a regulatory T cell phenotype. Exosomes can also promote T cell activation by preemptively promoting T cell activation through the delivery of MHC class I / II molecules and cancer cell-derived short peptides. Mesenchymal stem cell-derived exosomes (MSC-Exo) can express immunosuppressive molecules such as galectin-1, PD-1, and TGF-β, promoting the generation of CD4+CD25high FoxP3+ Tregs. MSC-Exo carrying miRNA-21 can also activate the TGF-β signaling pathway, further inducing the generation of Tregs. Third, remodeling the bone marrow microenvironment. The bone marrow microenvironment consists of hematopoietic cells and stromal cells. AML-derived exosomes can inhibit bone marrow hematopoiesis and osteogenesis.

[0004] Exosomes contain a variety of RNA molecules that are closely linked to immune regulation and contribute to the mechanisms of refractory tumor recurrence. AML-derived exosomes possess unique characteristics, such as enrichment in proteins like CD33, CD34, CD117, and TGF-β1, which can be used as diagnostic criteria. Furthermore, alterations in miRNA expression profiles may be observed. Plasma- or tumor-cell-derived miRNA-10b, miRNA-155, and miRNA-125b are expressed at elevated levels in AML patients and may serve as early diagnostic markers for AML. Furthermore, AML exosomes are enriched in certain long non-coding RNAs (lncRNAs), such as LINC00265, LINC00467, UCA1, and SNHG1. However, research on the diagnostic value of exosomal miRNAs in AML remains limited, particularly in systematic studies. Summary of the Invention

[0005] The present invention aims to overcome the shortcomings and deficiencies of the prior art by providing the use of plasma exosome-derived miRNA in the preparation of products for the diagnosis and / or prognosis assessment of acute myeloid leukemia. This invention has important implications for the diagnosis of AML, the determination of clinical prognosis, and the adjustment of clinical treatment regimens.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] Application of a substance for detecting the expression level of plasma exosome-derived miRNA in any of the following situations:

[0008] (1) Preparation of diagnostic products for acute myeloid leukemia;

[0009] (2) Prepare a product for the prognosis assessment of acute myeloid leukemia;

[0010] The plasma exosome-derived miRNA is any one or more of the following miRNA combinations: hsa-miRNA-1277-3p, hsa-miRNA-301b-5p, hsa-miRNA-574-3p, hsa-miRNA-411-5p, hsa-miRNA-4753-5p, hsa-miRNA-370-5p, hsa-miRNA-4454, hsa-miRNA-4473, hsa-miRNA-483-5p, hsa-miRNA-493-5p, hsa-miRNA-200a-5p; wherein the sequences (5'-3') of each miRNA are:

[0011] The sequence of hsa-miRNA-1277-3p is: UACGUAGAUAUAUAUGUAUUUU;

[0012] The sequence of hsa-miRNA-301b-5p is: GCUCUGACGAGGUUGCACUACU;

[0013] The sequence of hsa-miRNA-574-3p is: CACGCUCAUGCACACACCCACA;

[0014] The sequence of hsa-miRNA-411-5p is: UAGUAGACCGUAUAGCGUACG;

[0015] The sequence of hsa-miRNA-4753-5p is: CAAGGCCAAAGGAAGAGAACAG;

[0016] The sequence of hsa-miRNA-370-5p is: CAGGUCACGUCUCUGCAGUUAC;

[0017] The sequence of hsa-miRNA-4454 is: GGAUCCGAGUCACGGCACCA;

[0018] The sequence of hsa-miRNA-4473 is: CUAGUGCUCUCCGUUACAAGUA;

[0019] The sequence of hsa-miRNA-483-5p is: AAGACGGGAGGAAAGAAGGGAG;

[0020] The sequence of hsa-miRNA-493-5p is: UUGUACAUGGUAGGCUUUCAUU;

[0021] The sequence of hsa-miRNA-200a-5p is: CAUCUUACCGGACAGUGCUGGA.

[0022] Furthermore, the substance for detecting the expression level of plasma exosome-derived miRNA is: a reagent or instrument for detecting the expression level of plasma exosome-derived miRNA.

[0023] Furthermore, the reagents include: reagents for performing at least one of plasma exosome miRNA extraction, reverse transcription and real-time fluorescence quantitative PCR.

[0024] Furthermore, the reagents include: at least one of an exosome extraction and miRNA separation kit, a reverse transcription kit, and a real-time fluorescence quantitative PCR kit.

[0025] Furthermore, the real-time fluorescence quantitative PCR kit includes primer sets for amplifying hsa-miRNA-1277-3p, hsa-miRNA-301b-5p, hsa-miRNA-574-3p, hsa-miRNA-411-5p, hsa-miRNA-4753-5p, hsa-miRNA-370-5p, hsa-miRNA-4454, hsa-miRNA-4473, hsa-miRNA-483-5p, hsa-miRNA-493-5p, and hsa-miRNA-200a-5p, respectively, wherein:

[0026] The upstream primers used to amplify hsa-miRNA-1277-3p are as follows:

[0027] hsa-miRNA-1277-3p-F: 5'-CGGCCGCTACGTAGATATATATGTATTTT-3'

[0028] The upstream primers used to amplify hsa-miRNA-301b-5p are as follows:

[0029] hsa-miRNA-301b-5p-F: 5'-CGGCTCTGACGAGGTTGCACT-3'

[0030] The upstream primers used to amplify hsa-miRNA-574-3p are as follows:

[0031] hsa-miR-574-3p-F: 5'-CACGCTCATGCACACACCCA-3'

[0032] The upstream primers used to amplify hsa-miRNA-411-5p are as follows:

[0033] hsa-miR-411-5p-F: 5'-GCGGTAGTAGACCGTATAGCGTACG-3'

[0034] The upstream primers used to amplify hsa-miRNA-4753-5p are as follows:

[0035] hsa-miR-4753-5p-F: 5'-GCAAGGCCAAAGGAAGAGAACAG-3'

[0036] The upstream primers used to amplify hsa-miRNA-370-5p are as follows:

[0037] hsa-miR-370-5p-F: 5'-GGCAGGTCACGTCTCTGCAGTTAC-3'

[0038] The upstream primers used to amplify hsa-miRNA-4454 are as follows:

[0039] hsa-miRNA-4454-F: 5'-GGATCCGAGTCACGGCACCA-3'

[0040] The upstream primers used to amplify hsa-miRNA-4473 are as follows:

[0041] hsa-miRNA-4473-F: 5'-GGCCTAGTGCTCTCCGTTACAAGTA-3'

[0042] The upstream primers used to amplify hsa-miRNA-483-5p are as follows:

[0043] hsa-miRNA-483-5p-F: 5'-CAAGACGGGAGGAAAGAAGGGAG-3'

[0044] The upstream primers used to amplify hsa-miRNA-493-5p are as follows:

[0045] hsa-miR-493-5p-F: 5'-GCGGTTGTACATGGTAGGCTTTCA-3'

[0046] The upstream primers used to amplify hsa-miRNA-200a-5p are as follows:

[0047] hsa-miRNA-200a-5p-F: 5'-CATCTTACCGGACAGTGCTGGA-3'

[0048] The upstream primers of the amplified sequence cel-miR-39-3p used as an external reference are as follows:

[0049] The external reference amplified sequence cel-miR-39-3p-F was: 5'-GTCACCGGGTGTAAATCAGCTTG-3'.

[0050] Furthermore, the product is selected from at least one of a kit and a device.

[0051] A kit comprising the above-mentioned substance for detecting the expression level of plasma exosome-derived miRNA, wherein the function of the kit is any one of the following:

[0052] (1) Diagnosis of acute myeloid leukemia;

[0053] (2) Prognosis assessment of acute myeloid leukemia.

[0054] A device comprising a detection device and a data processing device, wherein the function of the device is any one of the following:

[0055] (1) Diagnosis of acute myeloid leukemia;

[0056] (2) Prognosis assessment of acute myeloid leukemia.

[0057] The detection device is composed of the above-mentioned substances for detecting the expression level of plasma exosome-derived miRNA;

[0058] The data processing device is composed of a data input module, a data recording module, a data comparison module and a conclusion output module;

[0059] The data input module is configured to input the relative expression value of the acute myeloid leukemia plasma exosome-derived miRNA to be tested;

[0060] The data recording module is configured to store the relative expression value and judgment threshold of the acute myeloid leukemia plasma exosome-derived miRNA to be tested;

[0061] The data comparison module is configured to receive the relative expression value of the acute myeloid leukemia plasma exosome-derived miRNA to be tested sent by the data input module, and call the judgment threshold from the data recording module to compare with the relative expression value of the acute myeloid leukemia plasma exosome-derived miRNA to be tested;

[0062] The conclusion output module is configured to receive the comparison result sent by the data comparison module and make a judgment on the comparison result according to a predetermined judgment condition.

[0063] Furthermore, the relative expression value of the miRNA derived from acute myeloid leukemia plasma exosomes is obtained by statistical analysis in combination with the expression level of the external reference gene cel-miR-39-3p; wherein the statistical analysis method is the ΔΔCT method, the expression level of miRNA = 2^(-ΔΔCT), ΔΔCT = ΔCT 临床患者 –ΔCT 正常人 , ΔCT 临床患者 =(CT miRNA -CT cel-miR-39-3p ), ΔCT 正常人 =(CT miRNA -CT cel-miR-39-3p ), CT miRNA and CT cel-miR-39-3p The results were determined by RNA extraction, reverse transcription and real-time fluorescence quantitative PCR.

[0064] Furthermore, the judgment condition is: when the relative expression level of the plasma exosome-derived miRNA is higher than the judgment threshold, it indicates a poor prognosis.

[0065] The present invention has the following advantages and effects compared to the prior art:

[0066] This study demonstrates for the first time that differential expression of exosomal miRNAs in the plasma of AML patients is associated with the onset and prognosis of AML patients. Compared to healthy donors, several miRNAs (hsa-miRNA-1277-3p, hsa-miRNA-301b-5p, hsa-miRNA-574-3p, hsa-miRNA-411-5p, hsa-miRNA-4753-5p, hsa-miRNA-370-5p, hsa-miRNA-4454, hsa-miRNA-4473, hsa-miRNA-483-5p, hsa-miRNA-493-5p, and hsa-miRNA-200a-5p) are highly expressed in the plasma exosomes of AML patients. High expression of these 11 miRNAs is associated with a poor prognosis. Therefore, the expression level of the new exosomal miRNA has important guiding significance for the early diagnosis of the occurrence of AML and the prediction of the prognosis of AML. The present invention is a new solution proposed based on the current problems, which has good innovation and scientific research significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0067] Figure 1 Heatmap and volcano plot of differential analysis of plasma exosome sequencing between AML patients and HI volunteers.

[0068] Figure 2 The figure shows the forest plot of the association between highly expressed miRNAs in AML plasma exosomes and the survival prognosis of TCGA-LAML, as well as the survival analysis of the high-score and low-score groups and AML survival prognosis after ssGSEA comprehensive scoring of the 11 screened miRNAs.

[0069] Figure 3 Real-time fluorescence quantitative PCR was used to validate a profile of 11 highly expressed miRNAs in plasma exosomes from AML patients that were associated with poor prognosis.

[0070] Figure 4 Figure 3 is the ROC curve for predicting the prognosis of AML patients by miRNAs highly expressed in AML plasma exosomes. DETAILED DESCRIPTION

[0071] The present invention will be described in further detail below with reference to the embodiments and drawings, but the embodiments of the present invention are not limited thereto.

[0072] The experimental methods in the following examples are all conventional methods unless otherwise specified; the experimental materials used are all purchased from conventional biochemical reagent manufacturers unless otherwise specified.

[0073] The object of the present invention is to provide the use of plasma exosome-derived miRNA in the preparation of a kit for diagnosing and / or evaluating the prognosis of acute myeloid leukemia.

[0074] In the present invention, the plasma exosome-derived miRNAs are 11 miRNAs highly expressed in the plasma exosomes of AML patients: hsa-miRNA-1277-3p, hsa-miRNA-301b-5p, hsa-miRNA-574-3p, hsa-miRNA-411-5p, hsa-miRNA-4753-5p, hsa-miRNA-370-5p, hsa-miRNA-4454, hsa-miRNA-4473, hsa-miRNA-483-5p, hsa-miRNA-493-5p, and hsa-miRNA-200a-5p.

[0075] In the present embodiment, the expression levels of these 11 miRNAs in exosomes from AML patients were significantly increased compared to healthy donors. This suggests that by detecting the expression of these 11 miRNAs in exosomes, it is possible to determine whether the patient from which the sample was derived is at risk for acute myeloid leukemia. Therefore, the high expression of these 11 miRNAs in plasma exosomes can be used as a detection marker for the onset of acute myeloid leukemia.

[0076] In the present examples, the correlation between high expression of these 11 miRNAs and the prognosis of acute myeloid leukemia was also analyzed. High expression of these 11 miRNAs was associated with a poor prognosis in acute myeloid leukemia. Combining these 11 miRNAs for a comprehensive expression score can better predict the patient's prognosis. Therefore, high expression of these 11 miRNAs can be used as biomarkers for prognostic assessment in acute myeloid leukemia.

[0077] The present invention provides the use of a reagent for detecting AML-related exosomal miRNA in the preparation of a diagnostic kit for acute myeloid leukemia.

[0078] In the present invention, the method for diagnosing acute myeloid leukemia is preferably that when the expression levels of the 11 miRNAs in exosomes are increased, it indicates that there is a risk of developing acute myeloid leukemia.

[0079] The present invention provides the use of a reagent for detecting the expression of exosomal miRNA associated with poor AML prognosis in the preparation of a kit for prognosis assessment of acute myeloid leukemia patients.

[0080] In the present invention, the method for evaluating the prognosis of acute myeloid leukemia patients is preferably that a higher comprehensive expression level of the 11 miRNAs indicates a poor prognosis.

[0081] The detection method includes plasma exosome RNA extraction, reverse transcription and real-time fluorescence quantitative PCR.

[0082] The reagents include an exosome extraction and RNA isolation kit (Runji, EXORNA50A), a reverse transcription kit (Novozymes, MR201), and a real-time fluorescence quantitative PCR kit (Novozymes, Q712).

[0083] The following describes in detail the application of the plasma exosome-derived miRNA provided by the present invention as a marker for detecting acute myeloid leukemia with reference to examples, but they should not be construed as limiting the scope of protection of the present invention.

[0084] Example 1: Screening Method for Marker miRNAs in AML Exosomes

[0085] 1. Experimental Methods

[0086] 1. After the patient signed the informed consent form, fasting venous blood was drawn in the early morning. Peripheral blood samples were collected from 4 AML de novo cases and 4 healthy adults. This part of the research plan has been approved by the ethics committee of our institution. Clinical data such as the clinical efficacy of AML patients were also collected. Among them, the clinical diagnostic criteria for AML are as follows: Diagnostic criteria for de novo AML: Referring to the WHO 2016 classification criteria for hematopoietic and lymphoid tumors, the presence of 20% or more primitive cells in peripheral blood or bone marrow is a necessary condition for the diagnosis of AML. However, when a patient is confirmed to have clonal recurrent cytogenetic abnormalities t(8;21)(q22;q22), inv(16)(p13q22) or t(16;16)(p13;q22) and t(15;17)(q22;q12), even if the primitive cells are <20%, AML should be diagnosed.

[0087] 2. Extraction of plasma exosome RNA for miRNA sequencing

[0088] 1) After enrollment, 2 mL of whole blood was collected from the median cubital vein of AML patients and healthy controls and placed in an anticoagulant tube. The blood was centrifuged at 500 × g for 10 min at 4°C, and the upper yellow plasma was transferred to a new, clean, sterile EP tube. The blood was centrifuged at 2000 × g for 10 min at 4°C, and the supernatant was transferred to a new EP tube. The blood was centrifuged again at 12000 × g for 15 min at 4°C, and the supernatant obtained was the exosome-containing plasma.

[0089] 2) Exosomal RNA extraction: Exosomal RNA was extracted using the Exosome Extraction and RNA Isolation Kit (Runji, EXORNA50A). The bone marrow or peripheral blood samples to be tested were processed to obtain plasma. The specific operation was as follows: centrifugation at 4°C, 500×g for 10 min, and the plasma was transferred to a new, clean, sterile EP tube.

[0090] 3) Centrifuge at 2000×g for 10 min at 4°C and transfer the supernatant to a new EP tube.

[0091] 4) Centrifuge again at 12,000 × g for 15 min at 4°C to obtain the supernatant containing exosomes. Proceed with exosome extraction according to the kit instructions.

[0092] 5) Purification column equilibration: Pipette 500 μl of equilibration buffer and add it to the exosome purification column (already placed in the collection tube). Centrifuge at 500 × g for 2 min, discard the filtrate, and place the exosome purification column back into the collection tube for later use.

[0093] 6) Exosome Binding: Pipette 500 μl of treated serum or plasma into a 5.0 ml centrifuge tube, add 1.5 ml of binding buffer, mix thoroughly by inversion, and let stand for 2 min. Then, add the mixture three times (approximately 700 μl each time) to the equilibrated exosome purification column (which has been placed in the collection tube) and centrifuge at 500 × g for 2 min, discarding the filtrate each time.

[0094] 7) Exosome washing: Pipette 0.5 ml of washing buffer and add it to the exosome purification column (which has been placed in the collection tube). Centrifuge at 500 × g for 2 min, then centrifuge at 1500 × g for 4 min. Discard the filtrate and collection tube.

[0095] 8) Note: Lysis Buffer A should be returned to room temperature before use. To improve extraction efficiency, it is recommended to heat Lysis Buffer A in a 37°C water bath for 10 minutes before use.

[0096] 9) Exosome RNA release: Place the exosome purification column in a new 2.0 ml RNase-free centrifuge tube, add 600 μl of lysis buffer A, centrifuge at 150 × g for 2 min, then centrifuge at 5000 × g for 2 min. Discard the exosome purification column, vortex the filtrate for 30 s, and let it stand at room temperature for 5 min to completely separate the nucleic acid-protein complex.

[0097] 10) Add 150 μl of Lysis Buffer B to the resulting lysate, cap the tube, shake vigorously for 30 seconds, and let it stand at room temperature for 5 minutes. Centrifuge at 120,000 × g for 15 minutes at room temperature. The sample will separate into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. RNA is primarily present in the aqueous phase (the upper layer). Transfer the aqueous phase (avoid pipetting the intermediate layer) to a fresh 1.5 ml RNase-free centrifuge tube and proceed to the next step.

[0098] 11) Measure the volume of transfer buffer and slowly add 1.5 times the volume of pre-cooled anhydrous ethanol, for example, add 600 μl of anhydrous ethanol to 400 μl of transfer buffer. Invert to mix (precipitation may occur at this time) and let it stand at room temperature for 5-10 minutes.

[0099] 12) Exosome RNA Binding: Transfer the resulting solution and precipitate to an RNA adsorption column (already placed in a collection tube. The volume loaded onto the column should not exceed 700 μl per column and can be completed in two steps). Allow to stand at room temperature for 2 minutes. Centrifuge at 8,000 × g for 30 seconds at room temperature. Discard the filtrate after centrifugation and retain the RNA adsorption column. Exosome RNA Washing: Add 500 μl of Wash Buffer A to the RNA adsorption column. Allow to stand at room temperature for 2 minutes. Centrifuge at 8,000 × g for 30 seconds at room temperature. Discard the filtrate from the collection tube and place the column back into the collection tube. Repeat the wash cycle once. Centrifuge the empty column again at 12,000 × g for 2 minutes at room temperature to remove any residual liquid. Open the cap of the RNA adsorption column and allow it to stand at room temperature for 5-10 minutes to completely dry any residual wash buffer from the adsorption material.

[0100] 13) Exosomal RNA Elution: Transfer the RNA adsorption column to a new RNase-free 1.5 ml centrifuge tube. Suspend 50 μl of Elution Buffer A in the middle of the RNA adsorption column and incubate at room temperature for 2 minutes. Centrifuge at 12,000 × g for 2 minutes. Add the resulting solution to the adsorption column and incubate at room temperature for 2 minutes. Centrifuge at 12,000 × g for 2 minutes. The final liquid in the centrifuge tube contains the extracted exosomal RNA and is stored at -80°C until sequencing.

[0101] (1) Exosomal miRNA library construction and sequencing: Library construction and sequencing were completed by Guangzhou Carbon Code Technology Co., Ltd. according to conventional methods; rRNAs in total RNA were removed using the rRNA removal kit (Qiagen); the rRNA-removed RNA was pretreated using the TruSeq Stranded Total RNA Library Prep kit to construct the sequencing library; library quality control and quantification were performed using the BioAnalyzer 2100; the library was denatured into single-stranded DNA molecules, captured on the Illumina flowcel, and sequenced on the sequencer using a paired-end mode; the reads were removed using the cutadapt software and the reads were collected; the reads were aligned to the human reference genome using the hisat2 software, and the TPM of the gene-level RNA was obtained under the guidance of the annotation file. The transcriptome expression profile information was obtained.

[0102] (2) Sequencing data analysis: Differential analysis of exosome sequencing data was performed using R language version 4.2.2. The exosome count data were divided into two groups, AML patients and HI controls, and differential expression analysis was performed using the "DESeq2" package. Genes were defined as up-regulated and down-regulated according to the criteria of corrected P value < 0.05 and log2FoldChange > 1 or < -1, respectively.

[0103] 2. Experimental Results

[0104] 1. Expression of plasma exosome miRNA in patients with newly diagnosed AML

[0105] The sequencing data of plasma exosomes from 8 cases were analyzed using R language version 4.2.2. The differential analysis of miRNA was performed using the "DESeq2" package.

[0106] Figure 1 Heatmap and volcano plots of differential analysis of plasma exosome sequencing between AML patients and HI volunteers. The results showed that among the 2423 miRNAs measured, 156 were differentially expressed in AML plasma-derived exosomes compared with healthy donors, including 110 with high expression (adjusted P value < 0.05, log2FoldChange > 1) and 46 with low expression (adjusted P value < 0.05, log2FoldChange < -1).

[0107] Example 2: Correlation between differentially expressed miRNAs and survival prognosis of AML patients

[0108] 1. Experimental Methods

[0109] (1) The miRNA sequencing data and clinical information of 175 AML patient bone marrow samples from TCGA-LAML were obtained by downloading the “TCGABiolinks” package;

[0110] (2) After data cleaning and organization, the “survminer” and “survival” packages were used to perform survival analysis and draw graphs on patients grouped according to the expression levels of specific genes and miRNAs.

[0111] (3) The 175 samples from TCGA were scored using the “GSVA” package based on the expression levels of differentially expressed miRNAs related to survival. The samples were divided into high-score group and low-score group, and survival analysis was performed.

[0112] 2. Experimental Results

[0113] 1. We obtained miRNA sequencing data from mononuclear cells of bone marrow samples from 175 AML patients from the TCGA-L AML database. Patients were divided into high-expression and low-expression groups according to the expression of specific miRNAs. The overall survival of these two groups was analyzed. The 108 prognostic miRNAs obtained were intersected with the exosomal differential miRNAs (high expression in AML exosomes and high expression in TCGA-LAML was associated with poor prognosis, or low expression in AML exosomes and low expression in TCGA-LAML was associated with good prognosis). As a result, 11 target miRNAs were screened (hsa-miRNA-1277-3p (P < 0.001), hsa-miRNA-301b -5p (P<0.001), hsa-miRNA-574-3p (P=0.025), hsa-miRNA-411-5p (P<0.001), hsa-miRNA-4753-5p (P=0.048), hsa-miRNA-370-5p (P=0.004), hsa-m iRNA-4454 (P=0.004), hsa-miRNA-4473 (P<0.001), hsa-miRNA-483-5p (P=0.003), hsa-miRNA-493-5p (P=0.024), hsa-miRNA-200a-5p (P<0.021)).

[0114] 2. These differential miRNAs were not only expressed at higher levels in exosomes of patients than in healthy controls, but were also associated with poor survival prognosis in patients in the TCGA database. The risk evaluation of the differential miRNAs was as follows: hsa-miRNA-1277-3p (Logrank P < 0.001, HR = 2.323), hsa-miRNA-301b-5p (Logrank P = 0.001, HR = 1.969), hsa-miRNA-574-3p (Logrank P = 0.004, HR = 1.769), hsa-miRNA-411-5p (Logrank P = 0.006, HR = 1.837), hsa-miRNA-4753-5p (Logrank P = 0.009, HR = 1.678), hsa-miRNA-370-5p (Logrank P = 0.010, HR = 1.682), hsa-miRNA-4454-3p (Logrank P = 0.013, HR = 1.8 P=0.010, HR=1.815), hsa-miRNA-4473 (Logrank P=0.021, HR=1.606), hsa-miRNA-483-5p (Logrank P=0.022, HR=1.543), hsa-miRNA-493-5p (Logrank P=0.028, HR=1.61), hsa-miRNA-200a-5p (Logrank P=0.035, HR=1.512) (Table)

[0115] 3. TCGA-derived sequencing samples were scored using ssGSEA based on the expression levels of 11 differentially expressed miRNAs associated with poor prognosis. The 175 samples were divided into a high-score group and a low-score group, and survival analysis and immune infiltration scores were performed on the two groups of samples.

[0116] Figure 2 Figure 2 shows a forest plot of miRNAs highly expressed in AML plasma exosomes and their association with TCGA-LAML survival prognosis, as well as a survival analysis of the 11 miRNAs screened using ssGSEA comprehensive scoring, showing high and low scores and AML survival prognosis. The results showed that the high score group was significantly associated with a poor prognosis (Logrank P < 0.001, HR = 2.7).

[0117] Example 3: Correlation between differentially expressed miRNAs and survival prognosis of AML patients

[0118] 1. Experimental Methods

[0119] 1) RNA was extracted using the Exosome Extraction and RNA Isolation Kit (Runji, EXORNA50A): 2 mL of whole blood was collected from the median cubital vein of AML patients and healthy controls after enrollment and placed in an anticoagulant tube. The blood was centrifuged at 500 × g at 4°C for 10 min, and the upper yellow plasma was transferred to a new, clean, sterile EP tube. The blood was centrifuged at 2000 × g at 4°C for 10 min, and the supernatant was transferred to a new EP tube. The blood was centrifuged again at 12000 × g at 4°C for 15 min to obtain the supernatant containing exosomes.

[0120] 2) Exosomal RNA extraction: Exosomal RNA was extracted using the Exosome Extraction and RNA Isolation Kit (Runji, EXORNA50A). The bone marrow or peripheral blood samples to be tested were processed to obtain plasma. The specific operation was as follows: centrifugation at 4°C, 500×g for 10 min, and the plasma was transferred to a new, clean, sterile EP tube.

[0121] 3) Centrifuge at 2000×g for 10 min at 4°C and transfer the supernatant to a new EP tube.

[0122] 4) Centrifuge again at 12,000 × g for 15 min at 4°C to obtain the supernatant containing exosomes. Proceed with exosome extraction according to the kit instructions.

[0123] 5) Purification column equilibration: Pipette 500 μl of equilibration buffer and add it to the exosome purification column (already placed in the collection tube). Centrifuge at 500 × g for 2 min, discard the filtrate, and place the exosome purification column back into the collection tube for later use.

[0124] 6) Exosome Binding: Pipette 500 μl of treated serum or plasma into a 5.0 ml centrifuge tube, add 1.5 ml of binding buffer, mix thoroughly by inversion, and let stand for 2 min. Then, add the mixture three times (approximately 700 μl each time) to the equilibrated exosome purification column (which has been placed in the collection tube) and centrifuge at 500 × g for 2 min. Discard the filtrate each time.

[0125] 7) Exosome washing: Pipette 0.5 ml of washing buffer and add it to the exosome purification column (which has been placed in the collection tube). Centrifuge at 500 × g for 2 min, then centrifuge at 1500 × g for 4 min. Discard the filtrate and collection tube.

[0126] 8) Note: Lysis Buffer A should be returned to room temperature before use. To improve extraction efficiency, it is recommended to heat Lysis Buffer A in a 37°C water bath for 10 minutes before use.

[0127] 9) Exosome RNA release: Place the exosome purification column in a new 2.0 ml RNase-free centrifuge tube, add 600 μl of lysis buffer A, centrifuge at 150 × g for 2 min, then centrifuge at 5000 × g for 2 min. Discard the exosome purification column, vortex the filtrate for 30 s, and let it stand at room temperature for 5 min to completely separate the nucleic acid-protein complex.

[0128] 10) Add 150 μl of Lysis Buffer B to the resulting lysate, cap the tube, shake vigorously for 30 seconds, and let it stand at room temperature for 5 minutes. Centrifuge at 120,000 × g for 15 minutes at room temperature. The sample will separate into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. The RNA is primarily in the aqueous phase (the upper layer). Transfer the aqueous phase (avoid aspirating the intermediate layer) to a fresh 1.5 ml RNase-free centrifuge tube and proceed to the next step.

[0129] 11) Measure the volume of transfer buffer and slowly add 1.5 times the volume of pre-cooled anhydrous ethanol, for example, add 600 μl of anhydrous ethanol to 400 μl of transfer buffer. Invert to mix (precipitation may occur at this time) and let it stand at room temperature for 5-10 minutes.

[0130] 12) Exosome RNA Binding: Transfer the resulting solution and precipitate to an RNA adsorption column (already placed in a collection tube. The volume loaded onto the column should not exceed 700 μl per column and can be completed in two steps). Allow to stand at room temperature for 2 minutes. Centrifuge at 8,000 × g for 30 seconds at room temperature. Discard the filtrate after centrifugation and retain the RNA adsorption column. Exosome RNA Washing: Add 500 μl of Wash Buffer A to the RNA adsorption column. Allow to stand at room temperature for 2 minutes. Centrifuge at 8,000 × g for 30 seconds at room temperature. Discard the filtrate from the collection tube and place the column back into the collection tube. Repeat the wash cycle once. Centrifuge the empty column again at 12,000 × g for 2 minutes at room temperature to remove any residual liquid. Open the cap of the RNA adsorption column and allow it to stand at room temperature for 5-10 minutes to completely dry any residual wash buffer from the adsorption material.

[0131] 13) Exosome RNA elution: Transfer the RNA adsorption column to a new RNase-free 1.5 ml centrifuge tube. Suspend 50 μl of Elution Buffer A in the middle of the RNA adsorption column and incubate at room temperature for 2 minutes. Centrifuge at 12,000 × g for 2 minutes. Add the resulting solution to the adsorption column, incubate at room temperature for 2 minutes, and centrifuge at 12,000 × g for 2 minutes. The final liquid in the centrifuge tube is the extracted exosome RNA and is stored at -80°C until use.

[0132] 14) Perform reverse transcription using a reverse transcription kit (Novozyme, MR201): Add the external reference cel-miR-39-3p: Prepare a 100 μM stock solution by diluting 4.62 nmol of cel-miR-39-3p powder with ultrapure water. Dilute the stock solution 10,000-fold with ultrapure water to create a working solution. Add 1 μL of cel-miR-39-3p working solution to every 100 ng of RNA. For each sample of exosomal RNA, prepare the reverse transcription system as follows:

[0133]

[0134] Place the prepared reverse transcription system in a PCR instrument and incubate at 37°C for 60 minutes, then at 85°C for 5 minutes to stop the reaction, then maintain at 4°C. Dilute the synthesized cDNA sample with 30 μL of RNase-free ddH2O and store at -20°C until miRNA expression is detected by quantitative PCR.

[0135] (1) Real-time fluorescence quantitative PCR:

[0136] Prepare the cDNA mixture according to the following scheme:

[0137]

[0138] Quantitative PCR was performed under the following conditions: 3 min pre-denaturation at 95°C, 10 s denaturation at 95°C, 30 s extension at 60°C, 40 cycles. Melting curve: 65°C to 95°C, increasing by 0.5°C every 0.5 s. cel-miR-39-3p was used as an external reference. -ΔΔCt Corrected miRNA expression levels.

[0139] 2. Experimental Results

[0140] Subsequently, clinical samples from healthy volunteers and AML patients were collected to validate miRNA expression levels. We collected peripheral blood plasma from 30 AML patients and 12 healthy volunteers of similar age and gender composition as a control group (Table 1). Exosome RNA was extracted from peripheral blood plasma, cDNA was synthesized, and the expression levels of miRNAs in exosomes were measured by real-time fluorescence quantitative PCR.

[0141] Figure 3Real-time fluorescence quantitative PCR was used to validate 11 highly expressed miRNAs in plasma exosomes of AML patients that were associated with poor prognosis. The results showed that the expression levels of 10 miRNAs, including hsa-miRNA-301b-5p (P=0.002), hsa-miRNA-493-5p (P<0.001), hsa-miRNA-4753-5p (P<0.001), hsa-miRNA-574-3p (P=0.001), hsa-miRNA-370-5p (P=0.017), hsa-miRNA-4454 (P=0.014), hsa-miRNA-411-5p (P=0.014), hsa-miRNA-4473 (P<0.001), hsa-miRNA-200a-5p (P<0.001), and hsa-miRNA-483-5p (P=0.005), were significantly higher in the plasma exosomes of AML patients than in the plasma exosomes of healthy controls.

[0142] Figure 4 Figure 2 shows the receiver operating characteristic (ROC) curve for predicting the prognosis of AML patients using highly expressed miRNAs in AML plasma exosomes. The ROC curve demonstrates the accuracy of these plasma exosome-derived miRNAs as prognostic markers for AML patients.

[0143] Table 1. Clinical information of patients with acute myeloid leukemia and healthy volunteers

[0144]

[0145] *FAB: French, American, and British classification systems.

[0146] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be considered as equivalent replacement methods and are included in the scope of protection of the present invention.

Claims

1. Use of a substance for detecting the expression level of plasma exosome-derived miRNA in any of the following situations: (1) Preparation of diagnostic products for acute myeloid leukemia; (2) Preparation of products for prognosis assessment of acute myeloid leukemia; The plasma exosome-derived miRNA is hsa-miRNA-1277-3p; the sequence of hsa-miRNA-1277-3p is: UACGUAGAUAUAUAUGUAUUUU.

2. The use according to claim 1, characterized in that: The substance for detecting the expression level of plasma exosome-derived miRNA is: a reagent or instrument for detecting the expression level of plasma exosome-derived miRNA.

3. The use according to claim 2, characterized in that: The reagents include: reagents for performing at least one of plasma exosome RNA extraction, reverse transcription and real-time fluorescence quantitative PCR.

4. The use according to claim 3, characterized in that: The reagents include: at least one of an exosome extraction and RNA isolation kit, a reverse transcription kit, and a real-time fluorescence quantitative PCR kit.

5. The use according to claim 4, characterized in that: The real-time fluorescence quantitative PCR kit includes an hsa-miRNA-1277-3p primer set for amplification, wherein: The upstream primers used to amplify hsa-miRNA-1277-3p are as follows: hsa-miRNA-1277-3p-F: 5'-CGGCCGCTACGTAGATATATATGTATTTT-3'.

6. The use according to any one of claims 1 to 5, characterized in that: The product is selected from at least one of a kit and a device.

7. A device for diagnosing and / or evaluating the prognosis of acute myeloid leukemia, characterized in that: It includes a detection device and a data processing device; The detection device is composed of the substance for detecting the expression level of plasma exosome-derived miRNA according to any one of claims 1 to 5; The data processing device is composed of a data input module, a data recording module, a data comparison module and a conclusion output module; The data input module is configured to input the relative expression value of the acute myeloid leukemia plasma exosome-derived miRNA to be tested; The data recording module is configured to store the relative expression value and judgment threshold of the acute myeloid leukemia plasma exosome-derived miRNA to be tested; The data comparison module is configured to receive the relative expression value of the acute myeloid leukemia plasma exosome-derived miRNA to be tested sent by the data input module, and call the judgment threshold from the data recording module to compare with the relative expression value of the acute myeloid leukemia plasma exosome-derived miRNA to be tested; The conclusion output module is configured to receive the comparison result sent by the data comparison module and make a judgment on the comparison result according to a predetermined judgment condition.

8. The device according to claim 7, characterized in that: The relative expression value of the acute myeloid leukemia plasma exosome-derived miRNA is obtained by statistical analysis in combination with the expression level of the external reference gene cel-miR-39-3p; wherein the statistical analysis method is the ΔΔCT method, miRNA expression level = 2^(-ΔΔCT), ΔΔCT = ΔCT 临床患者 –ΔCT 正常人 , ΔCT 临床患者 =(CT miRNA -CT cel-miR-39-3p ), ΔCT 正常人 =(CT miRNA -CT cel-miR-39-3p ), CT miRNA and CT cel-miR-39-3p The results were determined by RNA extraction, reverse transcription and real-time fluorescence quantitative PCR.

9. The device according to claim 7, characterized in that: The judgment condition is: when the relative expression level of the plasma exosome-derived miRNA is higher than the judgment threshold, it indicates a poor prognosis.

Images