A rapid identification kit for Salmonella pullorum and Salmonella gallinarum based on the mod gene

Through a rapid identification kit based on mod gene and specific PCR detection primers, the problem of identification of chicken dysentery and chicken typhoid Salmonella was solved, and fast, accurate and low-cost batch detection was achieved.

CN118879898BActive Publication Date: 2025-08-29JIANGSU INST OF POULTRY SCI +2
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411247464.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-06
Publication Date
2025-08-29
Estimated Expiration
2044-09-06

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately distinguish between chicken dysentery and chicken typhoid Salmonella, resulting in low detection efficiency and high cost, and cannot meet the batch detection requirements.

Method used

A rapid identification kit based on mod gene was designed. Through specific PCR, primers were detected, and the sequence differences between mod genes of Chicken White Dierma and Chicken Salmonella Typhimurium were used to achieve a single reaction to distinguish the two, and amplify the specific 528bp band.

Benefits of technology

It realizes rapid and accurate identification of chicken dysentery and chicken typhoid Salmonella, reduces detection time and cost, is suitable for batch testing, and has high sensitivity and specificity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118879898B_ABST
    Figure CN118879898B_ABST
Patent Text Reader

Abstract

The present invention discloses a rapid identification kit for Salmonella pullorum and Salmonella gallinarum based on the mod gene. The kit includes detection primers, a positive control, a negative control and a blank control. The positive control is Salmonella pullorum ATCC9184 genomic DNA, the negative control is Salmonella pullorum ATCC10398 genomic DNA, and the blank control is sterile double-distilled water. The primers include: For: 5'-TGTTCGGTCGGTTCTTTATAGGA-3'; Rev: 5'-CGGAGATAATCTGGATGTGTTACG-3'. The present invention also discloses a PCR method for rapidly identifying two biotypes of Salmonella pullorum and Salmonella gallinarum in Salmonella gallinarum serotypes using the mod gene as a detection target. The method of the present invention has the advantages of being rapid, simple, highly specific and highly sensitive. Compared with traditional biochemical identification methods for Salmonella pullorum and Salmonella gallinarum, it has great advantages in detection time and detection cost, and is suitable for clinical batch detection.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of molecular biological detection and relates to a rapid identification kit for Salmonella pullorum and Salmonella gallinarum based on the mod gene. Background Art

[0002] Salmonella is a bacterial disease that seriously threatens the health of poultry farming. It can be categorized by disease type into three categories: pullorum, galliformis, and paratyphoid. Pullorum and galliformis have a significant impact on breeder chicken production and are considered seed-borne diseases that must be eliminated. Pullorum and galliformis are caused by infection with Salmonella pullorum and Salmonella galliformis, respectively. Salmonella pullorum primarily causes an acute systemic disease in chicks, with a mortality rate exceeding 90%. Adult chickens rarely show clinical symptoms, but infection significantly impacts production performance, such as fertility and hatching rate. Salmonella galliformis causes acute or chronic septicemia, primarily affecting adult poultry. Pullorum and galliformis remain persistent ailments in the poultry industry in developing countries, causing significant economic losses.

[0003] Salmonella pullorum and Salmonella gallinarum are highly similar in terms of etiology. For example, both lack flagella and are non-motile, and their colony size on agar plates is significantly smaller than that of other Salmonella serovars. They also share the same bacterial antigen (O antigen), so they are currently classified as Salmonella gallinarum serovars, but are two different biotypes within that serovar (Salmonella pullorum and Salmonella gallinarum). Studies have shown that these two biotypes cannot be distinguished through serological tests, requiring the use of specialized biochemical reagents such as ornithine and dulcitol. However, their application is limited by the inability to meet the requirements of rapid, mass-produced testing. With the rapid development of molecular biology, some molecular detection technologies for identifying Salmonella pullorum and Salmonella gallinarum have been reported. However, some of the above methods require the use of multiple pairs of primers, some require further enzyme digestion and identification of the amplified products, and some methods still have specificity problems. Therefore, it is still necessary to further develop simple and rapid identification methods (Gong Jiansen et al. Validation of molecular typing methods for Salmonella pullorum and Salmonella gallinarum. Chinese Journal of Zoonotic Infectious Diseases. 2021).

[0004] In order to quickly, accurately and easily identify the two biotypes of Salmonella pullorum and Gallis typhoid among the serovars of Salmonella Gallis typhoid, the present invention analyzed and screened a detection target based on the mod gene based on the published Salmonella genome sequence, further designed detection primers, and successfully developed a practical technology for rapidly distinguishing Salmonella pullorum and Gallis typhoid. Summary of the Invention

[0005] Aiming at the deficiencies of traditional technology in identifying Salmonella pullorum and Salmonella gallinarum, the present invention provides a molecular kit for specifically identifying Salmonella pullorum and Salmonella gallinarum and a non-diagnostic detection method thereof.

[0006] The technical solutions of the present invention are as follows:

[0007] The present invention provides a kit for rapid identification of Salmonella pullorum and Salmonella gallinarum based on the mod gene and a non-diagnostic detection method thereof. The kit comprises 10× PCR buffer, 2.5 U / μl Taq DNA polymerase, 10 μm dNTPs, PCR detection primers, a positive control, a negative control and a blank control, wherein the positive control is genomic DNA of Salmonella pullorum ATCC10398, the negative control is genomic DNA of Salmonella gallinarum ATCC9184, and the blank control is sterile double-distilled water; the primers of the PCR primer set include:

[0008] For: 5'-TGTTCGGTCGGTTCTTTATAGGA-3'

[0009] Rev: 5'-CGGAGATAATCTGGATGTGTTACG-3'.

[0010] Furthermore, the components of the PCR detection system are as follows: each 25 μl reaction solution includes 2.5 μl of 10×PCR buffer, 2 μl of dNTPs, 0.25 μl of Taq DNA polymerase, 1 μl of detection primer, 1-2 μl of DNA template and an appropriate amount of sterile double-distilled water.

[0011] Furthermore, the preparation method of the PCR detection method is as follows: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds; annealing at 58°C for 30 seconds; extension at 72°C for 40 seconds; a total of 30 cycles, and a final extension at 72°C for 10 minutes.

[0012] Furthermore, the 10× PCR buffer contains 100 mM KCl, 80 mM (NH 4 ) SO 4 , 100 mM Tris-HCl with a pH of 9.0, 15 mM MgCl 2 and 0.5% Tergitol-type NP-40.

[0013] Furthermore, the primer concentration is 10 μM.

[0014] Furthermore, the dNTPs include dATP, dTTP, dCTP, and dGTP, and the concentration of each component is 2.5 mM.

[0015] Furthermore, the kit does not include other primers. Furthermore, a method for performing non-diagnostic detection using a rapid identification kit for Salmonella pullorum and Salmonella gallinarum comprises the following steps:

[0016] S1: Use the boiling method or commercial kit to extract bacterial genomic DNA to obtain the detection template.

[0017] S2: PCR amplification: Add 10× PCR buffer, dNTPs, Taq DNA polymerase, detection primer set, and DNA template to a sterile PCR reaction tube. Add sterile double-distilled water to a total volume of 25 μl. Set up positive, negative, and blank controls. Perform amplification using a PCR instrument. Detect the amplified products using 1.5% agarose gel electrophoresis and analyze the results.

[0018] The primers of the primer set include:

[0019] For: 5'-TGTTCGGTCGGTTCTTTATAGGA-3'

[0020] Rev: 5'-CGGAGATAATCTGGATGTGTTACG-3'.

[0021] Compared with the prior art, the present invention has the following beneficial effects:

[0022] The present invention can rapidly differentiate between Salmonella pullorum and Salmonella gallinarum through a single reaction. The presence of a 528bp band indicates Salmonella gallinarum, while absence of a 528bp band indicates Salmonella pullorum. Compared with traditional biochemical typing and other PCR detection methods, this method offers significant advantages in detection time and cost, making it suitable for batch testing. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The following is a graph showing the gel electrophoresis results of the primer screening experiment for identifying Salmonella pullorum and Salmonella gallinarum in Example 1. In the figure, M represents the DL-2000 marker, lanes 1-3 show the detection results of primer set 1 (Salmonella pullorum ATCC10398, Salmonella gallinarum ATCC9184, and negative control, respectively), lanes 4-6 show the detection results of primer set 2, and lanes 7-9 show the detection results of primer set 3.

[0024] Figure 2This is a graph showing the gel electrophoresis results of the specificity evaluation experiment in Example 2. In the figure, M is a DL-2000 marker, lanes 1 to 6 contain Salmonella Gallinarum ATCC9184, CVCC79301, CVCC536, CVCC537, CVCC538, and 9R, respectively; lanes 7 to 12 contain Salmonella Pullorum ATCC19945, ATCC10398, CMCC50771, CVCC519, CVCC521, and CVCC526, respectively; and lane 13 is a negative control.

[0025] Figure 3 This is a graph showing the gel electrophoresis results of the sensitivity test experiment in Example 3. In the figure, M is the DL-2000 marker, and lanes 1 to 6 contain the genome of Salmonella Gallinarum ATCC 9184 at concentrations of 97.5 ng / reaction, 9.75 ng / reaction, 0.975 ng / reaction, 97.5 pg / reaction, 9.75 pg / reaction, and 0.975 pg / reaction, respectively; 7: negative control. DETAILED DESCRIPTION

[0026] The present invention will be further described below with reference to the embodiments and accompanying drawings. The following description is merely a preferred embodiment of the present invention and does not limit the present invention in any other form. Any person skilled in the art may utilize the above-disclosed technical content to make equivalent embodiments with equivalent variations. Any simple modification or equivalent variation of the following embodiments made in accordance with the technical essence of the present invention without departing from the content of the present invention shall fall within the scope of protection of the present invention.

[0027] Example 1 Screening of primers for identifying Salmonella pullorum and Salmonella gallinarum and establishment of a rapid identification method

[0028] Salmonella pullorum and Salmonella Gallinarum are two different biotypes of the same serotype. They are highly similar in antigenic structure, biochemical properties, and gene sequence. Analysis of the mod gene sequences of Salmonella pullorum and Salmonella Gallinarum revealed that Salmonella pullorum has one less sequence (114 bp) in the coding region than Salmonella Gallinarum. Based on this finding, we selected three pairs of differential primers (Table 1).

[0029] Table 1. Screening of primers for identification of Salmonella pullorum and Salmonella gallinarum

[0030]

[0031] PCR template preparation: After the reference strains Salmonella pullorum ATCC10398 and Salmonella gallinarum ATCC9184 were enriched in broth overnight, the genomes of the above-mentioned Salmonella standard strains were extracted using a kit and used as templates to be tested.

[0032] PCR amplification reagents include: 10× PCR buffer (its components include 100 mM KCl, 80 mM (NH4)SO4, 100 mM Tris-HCl (pH 9.0), 15 mM MgCl2 and 0.5% Tergitol-type NP-40), dNTPs (including dATP, dTTP, dCTP, dGTP, each component concentration is 2.5 mM), Taq DNA polymerase (2.5 U / μl), and detection primers.

[0033] PCR detection system and amplification procedure: The detection system, in a volume of 25 μl, consisted of 2.5 μl of 10× PCR buffer, 2 μl of dNTPs, 0.25 μl of Taq DNA polymerase, 1 μl of detection primer set, 2 μl of DNA template, and an appropriate amount of sterile double-distilled water. The amplification procedure included 30 cycles of initial denaturation at 95°C for 5 min, denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 40 s, followed by a final extension at 72°C for 10 min. Upon completion of the reaction, the amplified product was removed and stored at 4°C.

[0034] To assess PCR results, take 5 μl of amplified product, add 1 μl of 6× Loading Buffer, mix thoroughly, and apply to a 1.5% agarose gel electrophoresis plate. Run the gel at 120 V for 30 minutes, and photograph the gel using a gel imager. Recover the amplified product, clone it into the pMD-19T vector, select positive clones, and sequence them. Compare the results with known sequences.

[0035] according to Figure 1 Agarose gel electrophoresis reveals that all three designed primer sets can achieve specific amplification (sequencing results are consistent with the original sequence). Among the three primer sets: the two bands of Primer 1 are similar in size, which can easily lead to misjudgment without comparison; primer 3 exhibits primer dimers after amplification; and under the same amplification conditions, the grayscale scan indicates that Primer 2 has the highest amplification efficiency. Therefore, Primer 2 was selected as the amplification primer of the present invention.

[0036] Example 2 Specificity evaluation experiment

[0037] The specificity of the rapid identification kit of the present invention was evaluated by the method of Example 1. Six reference strains of Salmonella pullorum (ATCC19945, ATCC10398, CMCC50771, CVCC519, CVCC521, and CVCC526) and six reference strains of Salmonella gallinarum (ATCC9184, CVCC79301, CVCC536, CVCC537, CVCC538, and 9R) were selected. After enrichment in broth, bacterial genomic DNA was extracted from the kit. PCR detection was performed according to the method described in Example 1. The results are shown in FIG. Figure 2 As shown, all Salmonella Gallinarum strains can amplify a specific amplification band of 528 bp, while all Salmonella Pullorum strains do not show an amplification band. The above results show that the method established by the present invention has good specificity.

[0038] Example 3 Sensitivity test experiment

[0039] The sensitivity of the rapid identification method of the present invention was evaluated using the method of Example 1. After culturing Salmonella enterica serovar Gallinarum ATCC9184 in broth overnight, bacterial genomic DNA was extracted using a kit. The original concentration was measured and then 10-fold gradient dilution was performed. The genomic DNA of different dilution gradients was subjected to sensitivity evaluation test. After the reaction was completed, 5 μl of amplified product was taken, 1 μl of 6× Loading buffer was added and mixed, and the product was detected by 1.5% agarose gel electrophoresis. The electrophoresis results are shown in Figure 2. Figure 2 As shown, M is DL-200 marker (2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp and 100 bp, respectively), and the reaction concentrations in lanes 1-6 are 97.5 ng / reaction, 9.75 ng / reaction, 0.975 ng / reaction, 97.5 pg / reaction, 9.75 pg / reaction and 0.975 pg / reaction, respectively. Figure 3 As shown in Figure 2, after the original concentration of 97.5 ng / reaction chicken typhoid genomic DNA was diluted 10,000 times (lane 5), a clear band could still be seen, while after diluting 100,000 times (lane 6), no amplified band could be seen (see Figure 3 ). Therefore, the minimum detection limit of the rapid identification method of the present invention is 9.75 pg / reaction, which has a high detection sensitivity.

[0040] Example 4 Identification of clinical isolates

[0041] 614 clinical isolates of Salmonella pullorum and Salmonella gallinarum, preserved by the research team, were cultured in broth overnight. Genomic DNA was extracted using the boiling method and analyzed according to the identification method of Example 1, with positive and negative controls set up. Two biochemical tests, ornithine and dulcitol, were also used for identification. The results are shown in Table 2. The method of the present invention identified a total of 602 strains of Salmonella pullorum and 12 strains of Salmonella gallinarum. These results were completely consistent with the biochemical identification results of ornithine and dulcitol, demonstrating that the method established in the present invention not only has the advantages of simplicity, speed, and high throughput, but also has good specificity.

[0042] Table 2. Identification results of clinical isolates

[0043]

[0044] Example 5 Assembly of a rapid identification kit for Salmonella pullorum and Salmonella gallinarum

[0045] A kit was used to extract Salmonella Gallinarum ATCC 9184 genomic DNA to obtain a positive control of the present invention; a kit was used to extract Salmonella Pullorum ATCC10398 genomic DNA to obtain a negative control of the present invention, a specific detection primer was synthesized according to the sequence of primer 2 in the table of Example 1, diluted with sterile double distilled water to a concentration of 10 μM, and mixed to obtain a detection primer; PCR amplification reagents: 10×PCR buffer (its components include 100 mM KCl, 80 mM (NH 4 ) SO 4 , 100 mM Tris-HCl with a pH of 9.0, 15 mM MgCl 2 and 0.5% Tergitol-type NP-40), dNTPs (including dATP, dTTP, dCTP, dGTP, each component concentration is 2.5 mM), Taq DNA polymerase (2.5 U / μl), detection primer, positive control (Salmonella Gallinarum ATCC 9184 genomic DNA template), negative control (Salmonella pullorum ATCC10398 genomic DNA template), blank control (sterile double-distilled water).

[0046] The above reagents and products are packaged together and provided with product instructions (including product storage conditions, reaction procedures and result determination methods, etc.) to assemble the pullorum and Salmonella gallinarum rapid identification kit of the present invention.

[0047] The above is a schematic description of the present invention and its embodiments, which is not restrictive. The drawings show only one embodiment of the present invention, and the actual structure is not limited thereto. Therefore, if a person skilled in the art is inspired by this and, without departing from the purpose of the present invention, designs a structure and embodiment similar to this technical solution without inventiveness, they shall fall within the scope of protection of the present invention.

[0048] Salmonella pullorum mod gene sequence:

[0049] TTAATCAAGCTGTTTTAAGCCGATTTCCAGTTCACGAATGGATTCAAGGTCGAAAGAGTA

[0050] GCCGTAAATGACAATGGTCTGAACCGGAAGCTGGTGCGTACCAATGTGGTTGAGAAGAT

[0051] CGCGGGTCTGCTCTGTTCCCCATCGTTCATCAATCAGATACAGGCGCGTATTATCAACATA

[0052] CCTGGCGCAATAGCCGGAAAAATCAATGGTCTGTACGTCAATATCCATTTTATAACCATC

[0053] GGCGACCAGCCATGTCGTTAATAAGGTCTCTTCGCCGCTTGCGCCGCCCGGCACGCCCA

[0054] ATCCTCTGGCGGAAAAAGGATTGATCATGTCGGTAAATCCTGACTCGGTGAAAGCGGCC

[0055] AGTTGACCGCTGGTATTGATAAAATGGCCGGTAGCAATATCGAAGCTATCCAGATCGTCC

[0056] AGCGTCTGCTGTGTCGGAGTGGCAAAACGATAATGTTTAAAACCGAGATCGCTATTGGT

[0057] CGCGGGATTGTTGGCGCGGATCTTCGCCGCAACGCGTGTAATTCGCTCGCGGCTGATTTC

[0058] ATCAATAGTGTTATAACCTGCTTTTTTCGCGATAGTGTTATTGCTTAATGCCTGATCGATAG

[0059] TACACAGAATAAACGTGCGCTGCCCCCCATCTTCTTCATTCAGCGCCATCACCGCATGGG

[0060] CCGTGGTGCCGGAACCGGCAAAAAAGTCCAGAACGACGCCGTCTTTATCGATAGCGAG

[0061] CTTGATGATTTTCTTCAATAATGCGGTCGGTTTCGGCGTATCAAAAACGTTGTCGCCGAA

[0062] GAGATCCAGAATCTCCTTTTTCCCCTCTTTATTCGACGCTACGTTATCCCAGTAATTGGTC

[0063] GTTGGCTGCCCTTTACTGTGGTGCGCGTACATGACTCTCTGGGGAATACCGCCGTTATCT

[0064] TTGCCAAAATAGACCAGATTATCGGCCACCAGTTTTTGGTAACTGGCTTCAGGATAAGCC

[0065] CATAGTCTTTCGTGTACCGTACCGTTCGGCGTGGTAATTTTATAGGTATAGCCGCCGCCGC

[0066] TCAGCCCTTTTGACACCGTTAACGGCACCGGTCGCCATTTCCCTTCTGGAAACTGTTCGG

[0067] TCGGTTCTTTATAGGATTTCTGAATATACTCTTTAGAAAGCGGTTCTAAACGTAAAGCGCC

[0068] CTGACCGGTTTTGGCGTAAACAAGAATGTATTCCCCCTGGATGGAAACGTTATCAGAGTC

[0069] GTTAGAAATCTCTTTTTTGCGCTTCCACATCACATTGGTGACAAATCCGCCTTCGCCAAA

[0070] AATCTCATCCATCATTAATTTAAGATTGGCGTACTCATTATCGTCGATAGAGATAAAAATA

[0071] AATCCGGTATCTTTCAGGAGCTTCCTGGCCAGGAAAAGACGCGGATACATGAAAGATAA

[0072] CCACGCGGAGTGCGTCGATTTACCCTGAATGGATTTTAAACGTGCCAGTTCAGTATCATT

[0073] AAGACCAAACATATCCTGCAACGCCCGATCGCTATATTCAAAATGATCGGGATAGACAAA

[0074] CCCGTCCGATCCGGTGTTATAAGGGGGATCGATATAGATCATATCGACGGTAACGGATTTT

[0075] TCACCCGCCTGTTTTTTTGCGTAATCTTTACCAATAAAATCAATCTGATAACCGCTAGTCA

[0076] GCTCATCAATATTACGCGCTTTCAGCGCGCGCTCAAATCTGGCGAGATCAAATCCGCCTT

[0077] TCGCGATCAGTTCGCCCTGCTCGTTATAGCGATCGGCGGTAAAAAATTCCGGTAATGCAC

[0078] GTTGTAACTCAGACAGAAAGGCGCTATTCGGGGCAACAGACTCGTTGTGTTTTTGTTTAT

[0079] CTTTCAACAT

[0080] Salmonella gallinarum mod gene sequence:

[0081] TTAATAACGCTTCACCAGGTTCACTTTTTGATCAAGCTGTTTTAAGCCGATTTCCAGTTCA

[0082] CGAATGGATTCAAGGTCGAAAGAGTAGCCGTAAATGACAATGGTCTGAACCGGAAGCT

[0083] GGTGCGTACCAATGTGGTTGAGAAGATCGCGGGTCTGCTCTGTTCCCCATCGTTCATCAA

[0084] TCAGATACAGGCGCGTATTATCAACATACCTGGCGCAATAGCCGGAAAAATCAATGGTCT

[0085] GTACGTCAATATCCATTTTATAACCATCGGCGACCAGCCATGTCGTTAATAAGGTCTCTTC

[0086] GCCGCTTGCGCCGCCCGGCACGCCCAATCCTCTGGCGGAAAAAGGATTGATCATGTCGG

[0087] TAAATCCTGACTCGGTGAAAGCGGCCAGTTGACCGCTGGTATTGATAAAATGGCCGGTA

[0088] GCAATATCGAAGCTATCCAGATCGTCCAGCGTCTGCTGTGTCGGAGTGGCAAAACGATA

[0089] ATGTTTAAAACCGAGATCGCTATTGGTCGCGGGATTGTTGGCGCGGATCTTCGCCGCAAC

[0090] GCGTGTAATTCGCTCGCGGCTGATTTCATCAATAGTGTTATAACCTGCTTTTTTCGCGATA

[0091] GTGTTATTGCTTAATGCCTGATCGATAGTACACAGAATAAACGTGCGCTGCCCCCCCATC

[0092] TTCTTCATTCAGCGCCATCACCGCATGGGCCGTGGTGCCGGAACCGGCAAAAAAGTCCA

[0093] GAACGACGCCGTCTTTATCGATAGCGAGCTTGATGATTTTCTTCAATAATGCGGTCGGTTT

[0094] CGGCGTATCAAAAACGTTGTCGCCGAAGAGATCCAGAATCTCCTTTTTCCCCTCTTTATT

[0095] CGACGCTACGTTATCCCAGTAATTGGTCGTTGGCTGCCCTTTACTGTGGTGCGCGTACAT

[0096] GACTCTCTGGGGAATACCGCCGTTATCTTTGCCAAAATAGACCAGATTATCGGCCACCAG

[0097] TTTTTGGTAACTGGCTTCAGGATAAGCCCATAGTCTTTCGTGTACCGTACCGTTCGGCGT

[0098] GGTAATTTTATAGGCATAGCCGCCGCCGCTCAGCCCTTTTGACACCGTTAACGGCACCGG

[0099] TCGCCATTTCCCTTCTGGAAACTGTTCGGTCGGTTCTTTATAGGATTTCTGAATATACTCT

[0100] TTAGAAAGCGGTTCTAAACGTAAAGCGCCCTGACCGGTTTTGGCGTAAACAAGAATGTA

[0101] TTCCCCCTGGATGGAAACGTTATCAGAGTCGTTAGAAATCTCTTTTTTGCGCTTCCACAT

[0102] CACATTGGTGACAAATCCGCCTTCGCCAAAAATCTCATCCATCATTAATTTAAGATTGGC

[0103] GTACTCATTATCGTCGATAGAGATAAAAATAAATCCGGTATCTTTCAGGAGCTTCCTGGCC

[0104] AGGAAAAGACGCGGATACATGAAAGATAACCACGCGGAGTGCGTCGATTTACCCTGAAT

[0105] GGATTTTAAACGTGCCAGTTCAGTATCATTAAGACCAAACATATCCTGCAACGCCCGATC

[0106] GCTATATTCAAAATGATCGGGATAGACAAACCCGTCCGATCCGGTGTTATAAGGGGGATC

[0107] GATATAGATCATATCGACGGTATCGGCGTAATTATTTTGCAGATGGCGTAACACATCCAGA

[0108] TTATCTCCGGTCAGAAAAAGATTATGGCTGTTTTTATTTTCTGCCAGAGTATTGTGTTCCA

[0109] CGTCAATAACGGTAACGGATTTTTCACCCGCCTGTTTTTTTGCGTAATCTTTACCAATAAA

[0110] ATCAATCTGATAACCGCTAGTCAGCTCATCAATATTACGCGCTTTCAGCGCGCGCTCAAA

[0111] TCTGGCGAGATCAAATCCGCCTTTCACGATCAGTTCGCCCTGCTCGTTATAGCGATCGGC

[0112] GGTAAAAAATTCCGGTAATGCACGTTGTAACTCAGACAGAAAGGCGCTATTCGGGGCAA

[0113] CAGACTCGTTGTGTTTTTGGTTATCTTTCAACAT

Claims

1. A method based on mod A kit for rapid identification of Salmonella pullorum and Salmonella gallinarum containing a gene, characterized by: It includes PCR detection primers, positive control, negative control and blank control, and the PCR detection primers are: For: 5'- TGTTCGGTCGGTTCTTTATAGGA -3' Rev: 5'- CGGAGATAATCTGGATGTGTTACG -3'; The positive control was Salmonella Gallinarum ATCC9184 genomic DNA, the negative control was Salmonella Pullorum ATCC10398 genomic DNA, and the blank control was sterile double-distilled water.

2. The method according to claim 1 mod A kit for rapid identification of Salmonella pullorum and Salmonella gallinarum containing a gene, characterized by: The components of the PCR detection system are as follows: each 25 μl reaction solution includes 2.5 μl of 10×PCR buffer, 0.25 μl of Taq DNA polymerase, 2 μl of dNTPs, 1 μl of detection primer set, 1 μl of DNA template and an appropriate amount of sterile double-distilled water.

3. The method according to claim 1 mod A kit for rapid identification of Salmonella pullorum and Salmonella gallinarum containing a gene, characterized by: The concentration of the PCR detection primer is 10 μM.

4. The method according to claim 2 mod A kit for rapid identification of Salmonella pullorum and Salmonella gallinarum containing a gene, characterized by: The dNTPs include dATP, dTTP, dCTP, and dGTP, and the concentration of each component is 2.5 mM.

5. The method according to any one of claims 1 to 4. mod A kit for rapid identification of Salmonella pullorum and Salmonella gallinarum containing a gene, characterized by: The kit does not include other primers.

6. A method for non-diagnostic detection using the rapid identification kit for Salmonella pullorum and Salmonella gallinarum according to any one of claims 1 to 5, comprising the following steps: S1: Extract bacterial genomic DNA using a commercial kit or boiling method to obtain a detection template; S2: PCR amplification: Add PCR buffer, Taq DNA polymerase, dNTPs, PCR detection primer set, and DNA template to a sterile PCR reaction tube, add sterile double-distilled water, set up positive, negative, and blank controls, and perform amplification using a PCR instrument; perform electrophoresis on the amplified products using agarose gel electrophoresis and analyze the results; the primers of the PCR detection primer set are: For: 5'- TGTTCGGTCGGTTCTTTATAGGA -3' Rev: 5' - CGGAGATAATCTGGATGTGTTACG -3'.

Citation Information

Patent Citations

  • PCR detection kit for rapidly identifying Salmonella Pullorum / Salmonella Gullinarum

    CN108330176A