A halophilic Bacillus halosaccharovorans H5 and its application

Abstract

The present invention belongs to the field of microbial technology, and specifically relates to a halophilic saccharovorans Bacillus H5 and its application. The technical problem to be solved by the present invention is to provide a new option for the improvement of saline-alkali land. The technical solution of the present invention is halophilic saccharovorans Bacillus H5, which was deposited in the General Microbiological Center of the China Microbiological Culture Collection Committee (CGMCC) on October 26, 2023, with the deposit number CGMCC No. 28785. The strain has the functions of producing ACC deaminase, iron carrier, nitrogen fixation, phosphorus dissolution, and potassium dissolution, and can also regulate soil pH, enrich soil nutrient content, and regulate soil pH to improve the ability of plants to tolerate salt and alkali, promote plant growth, and increase yield.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms, and in particular relates to a halophilic saccharovorans Bacillus Bacillushalosaccharovorans H5 and an application thereof. Background Art

[0002] Soil salinization refers to the accumulation of salt and alkaline substances in the soil, which leads to a significant reduction in soil fertility. This phenomenon not only affects the physical and chemical properties of the soil, but also poses a great challenge to the development of agriculture and animal husbandry. With the global climate change and the intensification of human activities, the salinization problem has become more serious, and effective improvement measures are urgently needed to restore the production capacity of the soil.

[0003] Among the many soil improvement methods, biological improvement is gradually being widely recognized as the most ecologically beneficial improvement method due to its long-lasting desalination effect and positive impact on soil and water conservation and ecological balance. Biological improvement can not only improve the physical and chemical properties of the soil, but also promote plant growth and enhance the ability of plants to adapt to adverse environments, thereby achieving sustainable agricultural development.

[0004] Bacillus is one of the most commonly isolated endophytic groups of rhizosphere growth-promoting bacteria. They promote plant growth through multiple mechanisms, including hormone synthesis, nutrient solubilization, and plant bioprotection. These processes provide plants with a sustainable and environmentally friendly way to promote growth. However, relatively few studies have been conducted on Bacillushalosaccharovorans. The regulatory mechanisms of its metabolites, nitrogen fixation, phosphate solubilization, and potassium solubilization in its salt-tolerant growth promotion have not been fully explored. In-depth research on these aspects will not only help to reveal the mechanism of action of Bacillus in saline-alkali soil improvement, but may also provide a theoretical basis and practical guidance for the development of new biofertilizers and soil conditioners. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a new option for improving saline-alkali land.

[0006] The technical solution of the present invention is a strain of Bacillus halosaccharovorans H5, which was deposited in the General Microbiological Center of China Microorganism Culture Collection Committee (CGMCC) on October 26, 2023, with the deposit number CGMCC No. 28785. The deposit address is: Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101.

[0007] The invention also provides application of the halophilic saccharovorans Bacillus H5 in improving the salt-alkali tolerance of plants.

[0008] Furthermore, the present invention also provides the use of the halophilic saccharovorans Bacillus Bacillushalosaccharovorans H5 in promoting plant growth.

[0009] Particularly, the promoting plant growth is to increase plant height, increase plant stem thickness and / or increase biomass.

[0010] Specifically, the plant is a Solanaceae plant.

[0011] Furthermore, the Solanaceae plant is potato.

[0012] The present invention also provides a microbial preparation for promoting plant growth, comprising Bacillus halosaccharovorans H5, fermentation products of Bacillus halosaccharovorans H5 and / or secretions of Bacillus halosaccharovorans H5.

[0013] Particularly, the promoting plant growth is to increase plant height, increase plant stem thickness and / or increase biomass.

[0014] Specifically, the plant is a Solanaceae plant.

[0015] Furthermore, the Solanaceae plant is potato.

[0016] The invention also provides a microbial preparation for improving the salt-alkali tolerance of plants, comprising halophilic saccharovorans Bacillus H5, fermentation products of halophilic saccharovorans Bacillus H5 and / or secretions of halophilic saccharovorans Bacillus H5.

[0017] The invention also provides application of the halophilic saccharovorans Bacillus H5 in preparing a product for regulating soil pH.

[0018] The present invention also provides a microbial preparation for regulating soil pH, comprising Bacillus halosaccharovorans H5, a fermentation product of Bacillus halosaccharovorans H5 or / and a secretion of Bacillus halosaccharovorans H5.

[0019] Furthermore, the regulating soil pH is to lower the soil pH.

[0020] The present invention also provides the use of the halophilic saccharovorans Bacillus H5 in improving soil nutrient content and / or soil enzyme activity under saline-alkali conditions.

[0021] Specifically, the nutrients are organic matter, total nitrogen, available phosphorus or fast-acting potassium.

[0022] Furthermore, the soil enzyme is phosphatase or catalase.

[0023] The invention also provides the use of the halophilic Bacillus halosaccharovorans H5 in improving plant physiological indicators under saline-alkali conditions.

[0024] Specifically, the physiological indicators are chlorophyll content and POD.

[0025] The present invention also provides a microbial preparation for improving plant physiological indexes under saline-alkali conditions, comprising halophilic saccharovorans Bacillus halosaccharovorans H5, fermentation products of halophilic saccharovorans Bacillus halosaccharovorans H5 or / and secretions of halophilic saccharovorans Bacillus halosaccharovorans H5.

[0026] Specifically, the physiological indicators are chlorophyll content and POD.

[0027] The present invention also provides the use of the halophilic Bacillus halosaccharovorans H5 in preparing ACC deaminase, iron carrier, nitrogen fixation, phosphorus solubilization or / and potassium solubilization products.

[0028] The present invention also provides a microbial preparation with nitrogen fixation, phosphorus solubilization and / or potassium solubilization functions, comprising halophilic saccharovorans Bacillus Bacillus H5, fermentation products of halophilic saccharovorans Bacillus H5 and / or secretions of halophilic saccharovorans Bacillus H5.

[0029] The present invention also provides a microbial preparation containing ACC deaminase and / or iron carrier, comprising Bacillus halosaccharovorans H5, fermentation product of Bacillus halosaccharovorans H5 or / and secretion of Bacillus halosaccharovorans H5.

[0030] The beneficial effects of the present invention are as follows: by screening and identifying salt-alkali tolerant bacteria in saline-alkali soil and exploring its growth-promoting function, a salt-alkali tolerant halophilic saccharovorans Bacillus is obtained, which can survive and reproduce in saline-alkali soil. The strain also has the functions of producing ACC deaminase, siderophore, nitrogen fixation, phosphorus solubility, and potassium solubility; it can regulate soil pH by regulating its own metabolism and improve soil nutrients; it can also improve the ability of plants to tolerate salt and alkali, promote plant growth, and increase yield. It can be seen that the halophilic saccharovorans Bacillus halosaccharovorans H5 of the present invention has utilization potential in all aspects and has broad application prospects. The halophilic saccharovorans Bacillus halosaccharovorans H5 of the present invention was deposited in the General Microbiological Center (CGMCC) of the China Microbiological Culture Collection Administration on October 26, 2023, with the deposit number CGMCC No. 28785. Deposit address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 It is the salt tolerance of H5 bacteria.

[0032] Figure 2 The phosphorus-solubilizing (left picture) and potassium-solubilizing (right picture) capabilities of H5 bacteria.

[0033] Figure 3 This is the electrophoresis detection diagram of the PCR product of H5 bacteria.

[0034] Figure 4 Observation of colony growth on beef extract peptone medium.

[0035] Figure 5 H5 cell morphology after Gram staining.

[0036] Figure 6 This is a growth observation diagram of potato seedlings planted in saline-alkali soil after inoculation with H5.

[0037] Figure 7 This is a graph showing the results of measuring plant height of potato seedlings planted in saline-alkali soil after inoculation with H5.

[0038] Figure 8 This is a graph showing the results of measuring the stem diameter of potato seedlings planted in saline-alkaline soil after inoculation with H5.

[0039] Fig. 9 This is a graph showing the fresh weight of the aboveground part of potato seedlings planted in saline-alkali soil after inoculation with H5.

[0040] Fig.10 This is a graph showing the results of measuring the fresh weight of the underground part of potato seedlings planted in saline-alkali soil after inoculation with H5.

[0041] Fig.11 This is a graph showing the results of measuring chlorophyll content in potato seedlings planted in saline-alkali soil after inoculation with H5.

[0042] Fig.12 This is a graph showing the results of POD activity measurement of potato seedlings planted in saline-alkali soil after inoculation with H5. DETAILED DESCRIPTION

[0043] The present invention separates and identifies microorganisms in saline-alkali soil, and screens out plant rhizosphere growth-promoting bacteria with growth-promoting functions. Mixed salt is used to simulate saline-alkali environment, and a single bacterial agent plant pot test is carried out to detect plant biomass, agronomic trait indicators, and antioxidant enzyme activities of plant leaves, and strains with better growth-promoting effects are screened out. It is expected to provide a reference basis for improving the salt tolerance mechanism of halophytes and rationally using halophytes rhizosphere growth-promoting bacteria to improve saline-alkali land.

[0044] The culture media, reagents and equipment used in the following examples were obtained from the following sources:

[0045] (1) Gibbons medium (1 L): 10 g yeast extract, 5.0 g casein, 2.0 g potassium chloride, 3.0 g sodium citrate, 2.0 g magnesium sulfate heptahydrate, 5.0 g tryptone, about 100.0 g sodium chloride, pH 9.0, autoclave at 121°C for 20 min.

[0046] (2) Beef extract peptone medium (1 L): 10 g pancreatic protein, 5.0 g sodium chloride, 5 g beef extract, adjust the pH to 7.2-7.4, and sterilize at 121°C with high pressure steam for 20 min.

[0047] (3) LB medium (1 L): 10 g tryptone, 5 g yeast extract, 5 g NaCl, 1 mL, adjust the pH to 7.4 with 1 mol / L NaOH, make up to 1 L with deionized water, and sterilize under high pressure at 121°C for 20 min.

[0048] (4) Montana inorganic phosphate medium (1 L): glucose 10 g, (NH4)2SO4 0.5 g, KCl 0.3 g, NaCl 0.3 g, FeSO4·7H2O 0.03 g, MgSO4·7H2O 0.3 g, MnSO4·4H2O 0.03 g, Ca3(PO4)2 10 g, agar powder 20 g, distilled water 1000 mL, pH 7.0-7.5, steam sterilization at 115°C for 20 min.

[0049] (5) Montana organophosphate medium (1 L): glucose 10 g, (NH4)2SO4 0.5 g, KCl 0.3 g, NaCl 0.3 g, FeSO4·7H2O 0.03 g, MgSO4·7H2O 0.3 g, MnSO4·4H2O 0.03 g, CaCO3 5 g, lecithin 0.2 g, agar powder 20 g, distilled water 1000 mL, pH 7.0-7.5, steam sterilization at 115°C for 20 min.

[0050] (6) Silicate medium (1 L): sucrose 5 g, MgSO4 0.5 g, CaCO3 0.1 g, NaHPO4 2 g, FeCl3 0.005 g, glass powder 1 g, agar powder 20 g, pH 7.0; autoclave at 121°C for 20 min.

[0051] (7) Ashubei nitrogen-free medium (1 L): K2HPO4 0.2 g, NaCl 0.2 g, Mg(SO4).7H2O 0.5 g, CaSO4 0.2 g, K2SO4·2H2O 0.2 g, CaCO3 5.0 g, glucose 10.0 g, agar powder 20 g, distilled water 1000 mL, pH 7.0; autoclave at 121°C for 20 min.

[0052] Sources of reagents, instruments and equipment: T6 New Century UV-Vis spectrophotometer (Beijing Puxi General Instrument Co., Ltd.), 16S rRNA gene amplification primers are universal primers 27F / 1492R and bacterial DNA extraction kit (Takara, Japan), 2×Taq Plus PCR Master Mix (Takara); PCR instrument (Bio-Rad); clean bench SW-CJ-2F (Suzhou Antai Air Technology Co., Ltd.), centrifuge H5-I6K (Hunan Kecheng Instrument Equipment Co., Ltd.), electronic balance FA1204B (Shanghai Tianmei Balance Instrument Co., Ltd.).

[0053] Example 1 Strain screening and identification

[0054] Isolation process of salt-alkali tolerant strains: Collect saline-alkali soil from Shebiy Village, Hohhot City, weigh 5g of saline-alkali soil sample, dissolve in 45mL of sterile water, shake at 30℃ and 180r / min for 30min, and let stand to obtain soil stock solution. Absorb the supernatant and dilute it to 10 -4 ~10 -7 After the culture was doubled, it was spread on beef extract peptone medium and Gibbons medium with a pH of 9 in turn, and inverted and cultured at 30°C for 5 days. After 5 days, several single colonies grew on the solid culture medium, and different types of single colonies were picked and repeatedly streaked for purification until the purified strains of each single colony were obtained. The pure strains picked and purified were inoculated into 10mL LB liquid culture medium and cultured overnight. The LB culture medium with the strains was mixed with 80% glycerol in a ratio of 2:1 in a 1.5mL centrifuge tube, and the tubes were numbered and stored in a -80°C refrigerator. After the remaining strains were cultured at 30°C for 2 days on the slant culture medium, they were stored in a 4°C refrigerator for subsequent experiments.

[0055] Screening by increasing the salt concentration (NaCl) of the culture medium: Add NaCl to the LB liquid culture medium and adjust its concentration to 8 gradients of 1%, 2%, 3%, 4%, 5%, 6%, 7%, and 8%. The activated strains were inoculated in LB liquid culture medium of different concentrations in sequence, with 3 replicates for each strain. After inoculation, the culture medium was placed on a shaker at 180r / min and cultured overnight at 30°C. The bacterial solution was transferred to a 96-well plate, and its absorbance at 620nm was measured with an ELISA reader every 4 hours. The growth curve was drawn to reveal the effect of NaCl concentration on the growth of the strain.

[0056] Determination of nitrogen fixation ability of strains: The isolated strains were inoculated on the Axubei medium by streak inoculation method and incubated upside down at 30℃. "+" represents the nitrogen fixation ability of the strain. The growth was observed and recorded from the second day of streaking. The growth of colonies was recorded as "+++++". A "+" was reduced for one day of delay. The nitrogen fixation ability of the strain was observed for 7 days.

[0057] Determination of phosphate-solubilizing ability of strains: The isolated strains were inoculated onto Mengjinna organic phosphorus medium and Mengjinna inorganic phosphorus medium respectively. After culturing at 30 °C for 5 days, the bacteria that could decompose both organic phosphorus and inorganic phosphorus were screened out by observation. They were inoculated onto Mengjinna medium with toothpicks and cultured in an inverted position at 30 °C until the phosphate-solubilizing circle showed no obvious change. Observe and measure the size of the phosphate-solubilizing circle, record the diameter of the phosphate-solubilizing circle (D) and the diameter of the colony (d), calculate D / d, and judge the strength of the phosphate-solubilizing ability. Strains that grew but did not produce a clear zone were recorded as "+"; strains with a ratio of the diameter of the clear zone to the diameter of the colony of 1 < D / d < 1.5 were recorded as "++"; strains with a ratio ≥ 1.5 were recorded as "+++"; non-growing strains were excluded.

[0058] Determination of potassium-solubilizing ability of strains: The strains were inoculated onto silicate medium with toothpicks. After culturing at 30 °C for 5 days, observe whether a clear potassium-solubilizing circle is produced around the colony to judge whether it has the function of potassium solubilization. If the strain grew but did not produce a clear potassium-solubilizing circle, it was marked as "+"; if the ratio of the diameter of the clear circle to the diameter of the colony was 1 < D / d < 1.5, it was marked as "++"; if the ratio D / d ≥ 1.5, it was marked as "+++".

[0059] Determination of ACC deaminase production ability of strains: The target strains were inoculated onto LB solid medium and cultured for 24 hours under the environmental condition of a constant temperature of 28 °C. After the culturing was completed, single colonies were carefully selected from the LB plate and inoculated onto DF solid medium again. The DF medium was used as an intermediate transition medium and was also cultured for 24 hours under the constant temperature condition of 28 °C. Subsequently, the strains with good growth conditions on the DF plate were further transferred onto ADF solid medium, and three biological replicates were set up for each transfer process. Under the constant temperature culturing condition of 28 °C, the culturing was continued for 72 hours. Finally, strains that could grow using 1-aminocyclopropane-1-carboxylic acid as the sole nitrogen source in the ADF solid medium were determined as positive strains (marked as "+") and would be used as the objects for subsequent research.

[0060] Determination of the ability of strains to produce iron carriers: The target strain was inoculated on CAS solid culture medium, and an appropriate amount of bacteria was picked up with a sterile pipette tip and inoculated on the CAS plate. Three replicates were set for each strain, and cultured at 28°C for 48 hours. On the CAS detection plate, an obvious orange iron carrier halo will appear around the bacterial colonies that secrete iron carriers. Record the presence or absence of orange halos on the plate, and measure the ratio of the diameter of the orange iron carrier halo of a single colony to the colony diameter. Strains that produce orange halos and the ratio of the diameter of the orange halo to the colony diameter is less than 1 are marked with "+"; Strains with a ratio of the diameter of the orange halo to the colony diameter greater than 1 and less than 1.5 are marked with "++"; Strains with a ratio greater than 1.5 are marked with "+++"; The more "+"s, the stronger the ability of the strain to produce iron carriers, and strains that do not produce orange halos around the strains are marked with "-", indicating that they do not produce iron carriers.

[0061] From the 80 bacteria isolated from the soil, the bacterial strains with salt-alkali tolerance and growth-promoting ability were screened by increasing the salt concentration (NaCl) of the culture medium, and 30 salt-alkali tolerant bacteria were screened. After further verification of their nitrogen fixation, phosphorus solubilization, and potassium solubilization abilities, a strain was obtained that could grow on a culture medium with a pH value of 9.0 and a salt concentration of 8% ( Figure 1 ) with nitrogen-fixing, phosphate-solubilizing and potassium-solubilizing bacteria H5 ( Figure 2 , Table 1). Bacterial DNA was extracted, sequenced after PCR identification (Shanghai Shenggong Company) and the phylogenetic tree results showed that the bacterium was halophilic saccharotrophic Bacillus Bacillus halosaccharovorans .

[0062] Table 1 Bacteria H5 has the ability to fix nitrogen, solubilize phosphorus and potassium, produce ACC deaminase, and act as an iron carrier

[0063] .

[0064] PCR identification of strains: Nucleic acid extraction was completed using the TGuide S96 magnetic bead soil genomic DNA extraction kit. Detection method: The concentration of nucleic acid was detected using an ELISA reader (manufacturer: Gene Compang Limited, model synergyHTX), and the detection amplification was performed according to the test. After amplification, the PCR product was electrophoresed using 1% agarose to detect integrity (such as Figure 3The full length of 16S rRNA of the strain was amplified using primers 27F (SEQ ID No.1, AGAGTTTGATCTTGGCTCAG) and 1492R (SEQ ID No.2, GGTTACCTTGTTACGACTT). The amplified sequence (SEQID No.3) was compared with the NCBI database to obtain species sequences with high homology. The selected sequences were subjected to maximum likelihood analysis (ML) and a phylogenetic tree was constructed using the software MEGA 11. The results showed that strain H5 was similar to Bacillus halosaccharovorans The highest genetic similarity is 98.38%.

[0065] SEQ ID No.3 16s rRNA

[0066]

[0067] The H5 was cultured on beef extract peptone medium at 30°C for 4 days, and the colonies were milky white, with smooth, moist, sticky, raised surfaces and neat edges ( Figure 4 ). The cell morphology after Gram staining is as follows Figure 5 shown.

[0068] In addition, the ability of H5 strain to regulate soil pH was further tested. The specific operation is as follows:

[0069] Treatment group: Natural saline-alkali soil collected from Shebiy Village, Hohhot, and flower nutrient soil were mixed in a pot at a ratio of 2:1. The pH value of the planting material (potato) and before the bacterial solution treatment was measured. After the planting material was treated with the bacterial solution three times (irrigated once every 10 days), the plants were allowed to grow for 30 days, and the pH value of the potted soil was measured 60 days after planting. The soil pH value determination method was carried out according to the "Soil Science Experiment" written by Lv Yizhong et al.

[0070] Control group: Natural saline-alkali soil collected from Shebiy Village, Hohhot and flower nutrient soil were mixed in a ratio of 2:1 in a flower pot. The pH value was measured before planting the material (potato) (same as above). Only water was used for irrigation in the later stage. The pH value of the pot soil was measured 60 days after the material was planted. The results are shown in Table 2.

[0071] Soil nutrient content determination: 90 days after potato planting, 3 soil samples were collected from each treatment, and the organic matter, total nitrogen content, available phosphorus and available potassium content were determined using the detection methods in "Soil Agrochemical Analysis" edited by Bao Shidan. The results are shown in Table 3.

[0072] Soil enzyme activity determination: 90 days after potato planting, 3 soil samples were collected from each treatment, and phosphatase was determined by colorimetry, and catalase was determined by potassium permanganate titration. The specific methods refer to "Soil Enzymes and Their Research Methods" compiled by Guan Songyin et al. The results are shown in Table 3.

[0073] Table 2 Soil pH determination

[0074] .

[0075] Table 3 Soil nutrient content

[0076] .

[0077] Note: a and b in the table represent statistically significant differences (p<0.05).

[0078] Example 2 Effect of H5 on potato growth

[0079] Potted experiment: Potato seeds with uniform germination were sown in pots with a saline-alkali soil to nutrient soil ratio of 2:1. After 10 days, 20 seedlings with uniform growth were selected for the experiment.

[0080] Preparation of bacterial solution: Inoculate the strain into 5mL LB liquid medium, shake and culture at 30℃ and 180r / min for 12h, inoculate into 20mL LB liquid medium at 1% inoculation, culture for 12h, centrifuge at 4000rpm for 10min, pour off the supernatant and dilute to 20mL with sterile water. Inoculate 2mL bacterial solution per seedling, and the control is not treated specially. Set up 5 parallels for each treatment, and replenish the bacterial solution every 10d for a total of three times.

[0081] Determination of morphological indicators: 60 days after potato planting, plant height, above-ground fresh / dry weight, and underground fresh / dry weight were measured.

[0082] Determination of plant physiological indicators: The peroxidase (POD) activity of the plants was determined by referring to pages 88-89 of "Plant Physiology Experiment Guide (5th Edition)" by Li Xiaofang and Zhang Zhiliang, and the chlorophyll content was determined by referring to pages 52-53 of "Plant Physiology Experiment Guide" by Zhang Zhiliang et al.

[0083] Basic data collation and analysis: Excel 2021 was used for data statistics and chart production, and SPSS 27.0 was used for single-factor ANOVA test variance analysis between different materials in the same treatment. Figures 6 to 12 As shown. In the saline-alkali soil growth environment, the potato plants treated with the bacterial solution of the strain have a significantly better growth than those treated with control water. Potatoes were treated with the bacterial solution of H5, and compared with the blank control, the plant height, fresh weight, chlorophyll content, and POD activity of potatoes were significantly improved compared with the blank control. This shows that the strain H5 can significantly improve the tolerance of plant potatoes to saline-alkali stress. Therefore, the strain H5 can promote the growth and development of potatoes under saline-alkali stress, thereby increasing its biomass and improving the utilization rate of saline-alkali soil.

Claims

1. A strain of Bacillus halosaccharovorans H5, with the accession number being CGMCC No.28785.

2. The use of Bacillus halosaccharovorans H5 according to claim 1, characterized in that: The application has at least one of the following characteristics: a. Application in improving the salt-alkali tolerance of potatoes; b. Application in promoting potato growth under saline-alkali stress environment; c. Application in nitrogen fixation; d. Application in phosphorus dissolution; e. Application in potassium solution; f. Application in reducing pH of saline-alkali soil; g. Application in increasing potato chlorophyll content and POD activity under saline-alkali conditions; h. Application in the production of ACC deaminase; i. Application in the production of siderophores; j. Application in improving the nutrients of saline-alkali soil, wherein the nutrients are organic matter, total nitrogen, available phosphorus or quick-acting potassium; k. Application in improving enzyme activity in saline-alkali soil, wherein the soil enzyme is phosphatase or catalase.

3. The application according to claim 2, characterized in that: When used in promoting potato growth under saline-alkali stress environment, the promoting potato growth is to increase plant height, increase stem thickness and / or increase biomass.

4. A microbial preparation, characterized in that: The invention comprises the Bacillushalosaccharovorans H5 as claimed in claim 1.

Images