A tobacco-specific glycosyltransferase, its preparation method and application

Abstract

This invention discloses a tobacco-specific glycosyltransferase, its preparation method, and its applications. The nucleotide sequence of this tobacco-specific glycosyltransferase is shown in SEQ ID NO.1. The tobacco-specific glycosyltransferase is used to degrade and convert mannosides in tobacco. The glycosyltransferase YJ-32 of this application can effectively degrade mannosides in tobacco, releasing aroma components such as organic acids and lipids, significantly enhancing the aroma of tobacco. The introduction of YJ-32 enzyme simplifies the extraction process of tobacco aroma components, reducing the complexity and cost of traditional processes. The improved tobacco aroma can meet consumers' demand for high-quality tobacco products and enhance the market appeal of the products. Furthermore, compared with traditional chemical treatment methods, the bio-enzymatic method is more environmentally friendly, reducing environmental impact.

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a tobacco-specific glycosyltransferase, its preparation method, and its application. Background Technology

[0002] Glycosides are ubiquitous in tobacco and are important aroma precursors. They are acetal derivatives formed by the dehydration condensation of the hemiacetal hydroxyl groups of sugars and their derivatives with the hydroxyl, sulfhydryl, or amino groups of non-sugar organic compounds. Sugar groups mainly include glucose, fructose, and mannose, while non-sugar groups mainly include terpenes, lipids, organic acids, and heterocyclic compounds, making them diverse and complex. Tobacco glycosides are chemically stable and have little or no aroma on their own. However, some glycosides can degrade, thermally decompose, and transform during the tobacco processing and cigarette combustion to form various cigarette aroma components, significantly enhancing the aroma of tobacco.

[0003] Recent studies have found that the crude tar in cigarette smoke contains various undegraded glycosides, indicating that the glycosides in cigarettes are not fully decomposed and utilized. Prematurely degrading tobacco glycosides to form smaller sugar molecules and organic aroma compounds is an effective way to improve the quality of tobacco with weakened aroma.

[0004] Glycosyltransferases can transfer glycosyl groups to different acceptor molecules, and can also transfer glycosyl groups from existing glycosides, exposing the non-sugar organic compounds of the original glycoside. Therefore, glycosyltransferases can not only synthesize new glycosides, but also degrade glycosides to some extent, exhibiting a dual function of glycoside hydrolysis and transglycoside conversion. Current research on glycosyltransferases mostly focuses on their transglycoside conversion function; studies on the degradation of glycosides using glycosyltransferases are rare, and there are no reports of degradation of tobacco glycosides. Summary of the Invention

[0005] The technical problem to be solved by the present invention is to provide a tobacco-specific glycosyltransferase, its preparation method and application. The glycosyltransferase can degrade and transform mannosides in tobacco to form aroma components and improve tobacco quality.

[0006] The technical problem to be solved by the present invention is achieved through the following technical solution:

[0007] A tobacco-specific glycosyltransferase, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] Preferably, the protein sequence it encodes is shown in SEQ ID NO.2.

[0009] Preferably, the tobacco-specific glycosyltransferase is derived from Enterobacter HNYJ-4, with accession number CGMCC No. 29655, and its nucleotide sequence is shown in SEQ ID NO. 3.

[0010] A method for preparing a tobacco-specific glycosyltransferase includes the following steps:

[0011] (1) Design primers, use PCR cloning to obtain the nucleic acid sequence of the enzyme, introduce it into a vector plasmid with a histidine tag (pET28(a)), transform competent cells E. coli (DE3) to obtain enzyme-producing recombinant bacteria;

[0012] (2) Prepare tobacco alcohol extract and water extract using tobacco leaves, and mix them to form a tobacco induction culture medium;

[0013] (3) Mix the recombinant bacteria with the induction medium at a volume ratio of 1:500-1:50, and induce culture at a low temperature of 10-35℃ for 2-8 days to obtain fermentation broth. The fermentation broth is purified using a nickel column to obtain tobacco-specific glycosyltransferase YJ-32 with a purity ≥95%.

[0014] Preferably, step (2) includes the following steps:

[0015] (21) Pulverize tobacco leaves to obtain tobacco dust, mix tobacco dust with anhydrous ethanol at a mass ratio of 1:2-1:20, reflux extract at 120℃ for 1-10h, cool to 30℃ and filter with 200 mesh gauze, use the filtrate as tobacco alcohol extract, and keep the filter residue for later use.

[0016] (22) The filter residue and water are mixed in a mass ratio of 1:2-1:20 and extracted by stirring at 30-100℃ for 0.5-12h at a stirring speed of 50rpm. After extraction, the mixture is filtered through 200-mesh gauze and the filtrate is sterilized at 121℃ for 30min to obtain tobacco water extract.

[0017] (23) Mix the tobacco alcohol extract and water extract at a volume ratio of 1:10-1:1, and shake and mix evenly at 90°C to obtain the tobacco induction culture medium.

[0018] Preferably, in step (21), the mass ratio of tobacco powder to anhydrous ethanol is 1:5, and the extraction time is 6h; in step (22), the mass ratio of filter residue to water is 1:10, and the temperature is 60℃ with stirring for 1.5h; in step (23), the volume ratio of tobacco ethanol extract to water extract is 1:4.

[0019] Preferably, in step (3), the enzyme-producing recombinant bacteria and the induction culture medium are in a volume ratio of 1:100, and the low-temperature induction condition is 25℃ for 5 days.

[0020] Application of a tobacco-specific glycosyltransferase in the degradation and conversion of mannosides in tobacco.

[0021] Preferably, the application utilizes glycosyltransferase YJ-32 to improve the aroma quality of tobacco, specifically including the following steps:

[0022] (1) Mix glycosyltransferase YJ-32 with reconstituted tobacco concentrate at a volume ratio of 1:2000-1:50;

[0023] (2) Stir at 30-55℃ for 1-10 hours at 50 rpm;

[0024] (3) Inactivate at 50-100℃ for 1-60 minutes, and then directly apply the concentrated liquid after treatment to the base of the reconstituted tobacco leaf to form flavored reconstituted tobacco leaf.

[0025] Preferably, the volume ratio of glycosyltransferase YJ-32 to the reconstituted tobacco concentrate in step (1) is 1:200, the temperature in step (2) is 40℃ and the stirring time is 6h, and the inactivation time in step (3) is 10min.

[0026] The above-described technical solution of the present invention has the following beneficial effects:

[0027] (1) The glycosyltransferase YJ-32 of this application can effectively degrade mannosides in tobacco, release aroma components such as organic acids and lipids, and significantly enhance the aroma of tobacco.

[0028] (2) The introduction of YJ-32 enzyme simplifies the extraction process of tobacco aroma components and reduces the complexity and cost of traditional processes.

[0029] (3) The improved tobacco aroma can meet consumers' demand for high-quality tobacco products and enhance the market appeal of the products. At the same time, compared with traditional chemical treatment methods, the bio-enzymatic method is more environmentally friendly and reduces the impact on the environment. Detailed Implementation

[0030] Various exemplary embodiments of the present invention will now be described in detail. It should be noted that, unless otherwise specifically stated, the relative arrangement, numerical expressions, and values ​​of the components and steps set forth in these embodiments do not limit the scope of the invention.

[0031] Example 1

[0032] (I) Preparation of glycosyltransferases:

[0033] (1) Design specific primers for the enzyme (Ecor I and Not I were selected as the restriction sites, upstream primer F: TTGCGGCCGCATGTTGGAATTGCTTTATAC, downstream primer R: GGAATTCTTAGTGGCTCCGCTGCGG), obtain the nucleic acid sequence of the enzyme by PCR cloning, digest it with Eco I and Not I, link it with the histidine tag vector plasmid (pET28(a)), transform it into competent E. coli (DE3) cells, and obtain enzyme-producing recombinant bacteria.

[0034] (2) Pulverize tobacco leaves to obtain tobacco dust. Mix tobacco dust with anhydrous ethanol at a mass ratio of 1:2-1:20. Reflux extract at 120℃ for 1-10 hours. After cooling to 30℃, filter through 200-mesh gauze. Use the filtrate as tobacco alcohol extract and keep the filter residue for later use.

[0035] (3) The filter residue and water are mixed at a mass ratio of 1:2-1:20 and extracted by stirring at 30-100℃ for 0.5-12 hours at a stirring speed of 50 rpm. After extraction, the mixture is filtered through 200-mesh gauze and the filtrate is sterilized at 121℃ for 30 minutes to obtain tobacco aqueous extract.

[0036] (4) Mix the tobacco alcohol extract and water extract at a volume ratio of 1:10-1:1, and shake and mix evenly at 90℃ to obtain the tobacco induction culture medium.

[0037] (5) The enzyme-producing recombinant bacteria and the induction medium are mixed at a volume ratio of 1:500-1:50 and induced at a low temperature of 10-35℃ for 2-8 days. After fermentation, the fermentation broth is obtained.

[0038] The crude enzyme solution was loaded onto a nickel column pre-equilibrated with cell disruption buffer using a peristaltic pump. The elution buffer for contaminating proteins was 20 mM Tris-HCl pH 7.3, 300 mM NaCl, and 20 mM imidazole. Ultraviolet light was used for detection, and the OD280 was adjusted to its minimum and the baseline leveled off. Finally, the target protein was eluted with a gradient of 200 mM imidazole solution, and the single largest elution peak was collected to obtain a glycosyltransferase with a purity of over 95%, named glycosyltransferase YJ-32.

[0039] (II) Sequence and characteristics of glycosyltransferases:

[0040] The nucleic acid and protein sequences of glycosyltransferase YJ-32 are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0041] The glycosyltransferase YJ-32 was derived from Enterobacter sp. HNYJ-4, a strain found on the surface of tobacco leaves. It was deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences. The accession number is CGMCC No. 29655, and the deposit date was January 18, 2024. The nucleotide sequence is shown in SEQ ID NO. 3.

[0042] The enzyme has the following enzymatic characteristics: it has high enzyme activity at temperatures of 30-55℃, and its half-life can reach 110 min at 55℃. At temperatures below 45℃, the half-life can be maintained for more than 10 h. It also has high enzyme activity in the pH range of 5.5-8.0, and within this pH range, the enzyme activity can be maintained at more than 90% of the maximum enzyme activity.

[0043] This enzyme can degrade many glycosides in tobacco, which are composed of mannose and non-sugar organic compounds, especially glycosides composed of mannose and some organic acids and lipids, thereby releasing the corresponding organic acids and lipids that make up the tobacco aroma, effectively improving the aroma quality of tobacco.

[0044] (III) Application in reconstituted tobacco concentrate:

[0045] In the production of reconstituted tobacco, the glycosyltransferase YJ-32 prepared in step (I) is mixed evenly with the reconstituted tobacco concentrate at a volume ratio of 1:2000-1:50. The mixture is then stirred for 1-10 hours at 50 rpm in a temporary storage tank at a temperature of 30-55℃. After treatment, the concentrate is inactivated at 50-100℃ for 1-60 minutes. The treated concentrate is then directly coated onto the base of the reconstituted tobacco leaves to form flavor-enhanced reconstituted tobacco.

[0046] Example 2

[0047] (I) Preparation of glycosyltransferases:

[0048] (1) Design specific primers for the enzyme (Ecor I and Not I were selected as the restriction sites, upstream primer F: TTGCGGCCGCATGTTGGAATTGCTTTATAC, downstream primer R: GGAATTCTTAGTGGCTCCGCTGCGG), obtain the nucleic acid sequence of the enzyme by PCR cloning, digest it with Eco I and Not I, link it with the histidine tag vector plasmid (pET28(a)), transform it into competent E. coli (DE3) cells, and obtain enzyme-producing recombinant bacteria.

[0049] (2) The tobacco leaves were crushed to obtain tobacco dust. The tobacco dust was mixed with anhydrous ethanol at a mass ratio of 1:5. The mixture was refluxed at 120°C for 6 hours. After cooling to 30°C, it was filtered through 200-mesh gauze. The filtrate was used as the tobacco alcohol extract, and the filter residue was kept for later use.

[0050] (3) The filter residue and water were mixed at a mass ratio of 1:10 and extracted by stirring at 60°C for 1.5 h at a stirring speed of 50 rpm. After extraction, the mixture was filtered through 200-mesh gauze and the filtrate was sterilized at 121°C for 30 min to obtain tobacco aqueous extract.

[0051] (4) Mix the tobacco alcohol extract and water extract at a volume ratio of 1:4, and shake and mix evenly at 90°C to obtain the tobacco induction culture medium.

[0052] (5) The enzyme-producing recombinant bacteria and the induction medium were mixed at a volume ratio of 1:100 and induced at 25°C for 5 days. After fermentation, the fermentation broth was obtained.

[0053] The crude enzyme solution was loaded onto a nickel column pre-equilibrated with cell disruption buffer using a peristaltic pump. The elution buffer for contaminating proteins was 20 mM Tris-HCl pH 7.3, 300 mM NaCl, and 20 mM imidazole. Ultraviolet light was used for detection, and the OD280 was adjusted to its minimum and the baseline leveled off. Finally, the target protein was eluted with a gradient of 200 mM imidazole solution, and the single largest elution peak was collected to obtain a glycosyltransferase with a purity of over 95%, named glycosyltransferase YJ-32.

[0054] (II) Sequence and characteristics of glycosyltransferases:

[0055] The nucleic acid and protein sequences of glycosyltransferase YJ-32 are shown in SEQ ID NO.1 and SEQ ID NO.2.

[0056] The enzyme has the following enzymatic characteristics: it has high enzyme activity at 40℃, a half-life of 110 min at 55℃, and a half-life of more than 10 h at temperatures below 45℃; it has high enzyme activity at pH 7.0, and within this pH range, the enzyme activity can be maintained at more than 90% of the maximum enzyme activity.

[0057] This enzyme can degrade many glycosides in tobacco, which are composed of mannose and non-sugar organic compounds, especially glycosides composed of mannose and some organic acids and lipids, thereby releasing the corresponding organic acids and lipids that make up the tobacco aroma, effectively improving the aroma quality of tobacco.

[0058] (III) Application in reconstituted tobacco concentrate:

[0059] In the production of reconstituted tobacco, the glycosyltransferase YJ-32 prepared in step (I) is mixed evenly with the reconstituted tobacco concentrate at a volume ratio of 1:200. The mixture is then stirred for 6 hours at 40℃ and 50 rpm in a temporary storage tank for the concentrate. After treatment, the concentrate is inactivated at 70℃ for 10 minutes. The treated concentrate is then directly coated onto the base of the reconstituted tobacco leaves to form flavor-enhanced reconstituted tobacco.

[0060] Application Example 1

[0061] The TS-001 (strong aroma) thin film concentrate from Henan China Tobacco Xuchang Thin Film Company was selected as the test sample. The thin film concentrate without enzyme treatment was designated as CK, and the thin film concentrate treated with glycosyltransferase YJ-32 was designated as T. (The treatment method is as described in Example 2).

[0062] Changes in aroma components before and after treatment with reconstituted tobacco concentrate were detected by GC-MS.

[0063] result

[0064] (1) Table 1 lists the six aroma components with the largest increase, indicating that after treatment with glycosyltransferase YJ-32, some fatty acids and lipids are released, the aroma of the reconstituted tobacco concentrate is sweeter and the aroma style is more prominent.

[0065] Table 1. Changes in aroma components before and after treatment with reconstituted tobacco concentrate (unit: μg / mL)

[0066]

[0067]

[0068] Sensory evaluation showed that after treatment with glycosyltransferase, the aroma and smoky flavor of the flakes were significantly enhanced, the dryness was slightly improved, and the total score increased by 1.01 points, which verified that glycosyltransferase can increase the aroma component content of the flakes.

[0069] Table 2 Sensory evaluation before and after slice processing

[0070]

[0071] Although the present invention has been disclosed above with reference to embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various different choices and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention is defined by the claims and their equivalents.

Claims

1. A tobacco-specific glycosyltransferase, characterized in that, The nucleotide sequence of the tobacco-specific glycosyltransferase is shown as SEQ ID NO.

1.

2. The tobacco-specific glycosyltransferase of claim 1, wherein, The protein sequence encoded thereby is shown as SEQ ID NO.

2.

3. The tobacco-specific glycosyltransferase of claim 1, wherein, The tobacco-specific glycosyltransferase is derived from Enterobacter HNYJ-4, and the preservation number is CGMCC No. 29655.

4. The tobacco-specific glycosyltransferase according to any one of claims 1-3 for use in degrading and converting the mannose glycoside substances in tobacco.

5. Use according to claim 4, characterized in that, The use is to improve the aroma quality of tobacco by using the tobacco-specific glycosyltransferase, which specifically comprises the following steps: (1) mixing the glycosyltransferase with the reconstituted tobacco concentrate at a volume ratio of 1:2000-1:50; (2) stirring at 30-55℃ for 1-10 hours at a stirring speed of 50 rpm; (3) inactivating at 50-100℃ for 1-60 minutes, and directly coating the treated concentrate to the base of the reconstituted tobacco to form the aroma-enhanced reconstituted tobacco.

6. Use according to claim 5, characterized in that, The volume ratio of the tobacco-specific glycosyltransferase to the reconstituted tobacco concentrate in step (1) is 1:200, the temperature in step (2) is 40℃, the stirring time in step (2) is 6 hours, and the inactivation time in step (3) is 10 minutes.

Images