A SNP molecular marker combination of poplar, a whole-genome liquid chip prepared therefrom, and applications thereof

Abstract

The present invention discloses a SNP molecular marker combination of poplar, a whole-genome liquid chip prepared therefrom, and applications thereof. The SNP molecular marker combination of poplar includes 60,944 SNP molecular markers, and the physical positions of the 60,944 SNP molecular markers are determined by sequence alignment based on the poplar reference genome GCA_015852605.2. The SNP molecular markers of poplar in the present invention can be used for specific identification of five major sections of poplar species. Using the SNP molecular markers of poplar to prepare a whole-genome liquid chip for poplar tree species can achieve efficient, accurate genotyping detection of low-cost poplar germplasm resource populations, and is specific to the sections of Populus, such as Leuce, Aigeiros, Tacamahaca, Leucoides, and Turanga, and has important application values in multiple fields of poplar biological breeding.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a SNP molecular marker combination of poplar, a whole-genome liquid chip prepared therefrom, and applications thereof. Background Art

[0002] Poplar is a general term for plants of the genus Populus in the family Salicaceae. Generally, poplar plants can be divided into five major sections: Sect. Populus, Sect. Aigeiros, Sect. Tacamahaca, Sect. Leucoides, and Sect. Turanga. Poplar has the characteristics of fast growth, strong adaptability, and easy propagation, and is one of the main afforestation tree species in the world, playing an important role in artificial forests such as industrial timber forests and ecological protection forests.

[0003] Due to the extremely abnormal climate change in recent years. Therefore, it is necessary to cultivate more breakthrough new varieties with multiple resistances and multiple uses to meet the diverse needs in actual production. Abundant germplasm resources are the basis for carrying out poplar breeding work. Conducting genetic diversity evaluation research on specific traits of germplasm resources can better explore and utilize excellent germplasm resources.

[0004] At present, most of the means for selecting superior poplar varieties adopt traditional breeding methods, which are weakly combined with modern molecular technology means. Moreover, the existing liquid chip, 40K of black poplar, is only specific to the Sect. Aigeiros, with low generality and utilization rate in Sect. Populus, Sect. Tacamahaca, Sect. Turanga, and Sect. Leucoides, resulting in problems such as poor breeding effect, low breeding efficiency, and low generality. In the molecular marker research of poplar, in addition to using SSR (simple sequence repeat) markers, a large number of SNPs (single nucleotide polymorphisms) have also been discovered, but their throughput is low and the genomic coverage is narrow, which is not suitable for large-scale breeding work. The whole-genome breeding chip is a breeding tool based on high-throughput molecular marker technology, which can cover SNP sites throughout the genome and has characteristics such as wide coverage, high sensitivity, high detection throughput, and high precision. Using the whole-genome breeding chip to comprehensively evaluate the genotype typing, genetic diversity, and functional gene discovery of germplasm resources of the five major sections of poplar is helpful to improve the efficiency of parental selection in hybrid breeding research, can better utilize and explore excellent germplasm resources of the five major sections of poplar, and promote the transformation of poplar from conventional breeding to molecular design breeding and intelligent breeding. Summary of the Invention

[0005] The present invention aims to solve at least one of the technical problems existing in the above-mentioned prior art. For this purpose, the present invention provides a SNP molecular marker combination of poplar.

[0006] The present invention also provides a whole-genome liquid chip for detecting the above-mentioned poplar SNP molecular marker combination.

[0007] The present invention also provides a kit for detecting the above-mentioned poplar SNP molecular marker combination.

[0008] The present invention also provides a method for screening a poplar SNP molecular marker combination.

[0009] The present invention also provides an application of the above-mentioned poplar SNP molecular marker combination, whole-genome liquid chip or kit.

[0010] The present invention also provides a breeding method for poplar.

[0011] According to one aspect of the present invention, a poplar SNP molecular marker combination is provided, including 60,944 SNP molecular markers. The physical positions of the 60,944 SNP molecular markers are determined by sequence alignment based on the poplar reference genome GCA_015852605.2, and the locus information is shown in Table 1 below.

[0012] Table 1

[0013]

[0014]

[0015]

[0016]

[0017]

[0018]

[0019]

[0020]

[0021]

[0022]

[0023]

[0024]

[0025]

[0026]

[0027]

[0028]

[0029]

[0030]

[0031]

[0032]

[0033]

[0034]

[0035]

[0036]

[0037]

[0038]

[0039]

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047]

[0048]

[0049]

[0050]

[0051]

[0052]

[0053]

[0054]

[0055]

[0056]

[0057]

[0058]

[0059]

[0060]

[0061]

[0062]

[0063]

[0064]

[0065]

[0066]

[0067]

[0068]

[0069]

[0070]

[0071] In some embodiments of the present invention, the SNP molecular marker is 19:17260837T / -, and "-" represents the insertion of TATTTGAAGTTCGTCGAAGCTCCCAGTAAACATGAC.

[0072] In some embodiments of the present invention, the Alt is ".", indicating that it has multiple mutation possibilities.

[0073] In some embodiments of the present invention, when ref is A, Alt is ".", indicating that the mutation can be T, G, C or N; when ref is T, Alt is ".", indicating that the mutation can be A, G, C or N; when ref is G, Alt is ".", indicating that the mutation can be A, T, C or N; when ref is C, Alt is ".", indicating that the mutation can be A, T, G or N, where N represents a deletion.

[0074] In some embodiments of the present invention, the position information of the SNP locus is represented in the form of chromosome number: physical position.

[0075] In the second aspect of the present invention, a whole-genome liquid chip is proposed. The whole-genome liquid chip includes a primer set and / or a probe for detecting the above-mentioned poplar SNP molecular marker combination.

[0076] In the third aspect of the present invention, a kit is proposed. The kit contains a primer set and / or a probe for detecting the above-mentioned poplar SNP molecular marker combination.

[0077] In the fourth aspect of the present invention, a screening method for the above-mentioned poplar SNP molecular marker combination is proposed. The screening method includes the following steps:

[0078] (1) After using Sentieon software to align and detect mutations in the poplar whole-genome sequencing data, perform preliminary hard filtering to obtain a file containing SNP variation information of all samples;

[0079] (2) Mine and screen the file containing SNP variation information of all samples to obtain target-site SNPs; the mining and screening parameters are: MAF≥0.05, SNP locus detection rate≥80%, heterozygosity rate≤50%, sequencing depth≥6X;

[0080] (3) Extract the SNP loci of genes related to poplar growth, resistance, wood formation, flowering regulation, flavonoid metabolism, etc. from the file containing SNP variation information of all samples according to the SNP locus detection rate≥90%, heterozygosity rate≤50%, and sequencing depth≥5X;

[0081] (4) According to the file containing SNP variation information of all samples, calculate the genetic differentiation index between populations for each SNP variation site of different poplar tree species; the parameter is --weir-fst-pop, and filter and design probes according to the threshold of FST>0.5 to screen out different poplar tree species-specific SNP loci;

[0082] (5) Design probes for the SNP of the target site obtained in step (2), the SNP sites of the genes related to poplar growth, resistance, wood formation, flowering regulation, flavonoid metabolism, etc. obtained in step (3), and the combination of different poplar tree species-specific SNP sites obtained in step (4), and screen SNPs that meet the requirements of the probes to obtain a combination of poplar SNP molecular markers.

[0083] In some embodiments of the present invention, the resistance includes drought resistance, salt tolerance, and disease resistance.

[0084] In some embodiments of the present invention, the poplar tree species include at least one of poplar in the Populus section, poplar in the Tacamahaca section, poplar in the Aigeiros section, poplar in the Turanga section, and poplar in the Leucoides section.

[0085] In some embodiments of the present invention, using Sentieon software to align and detect mutations in poplar resequencing data specifically includes the following steps:

[0086] (1) Use Sentieon software to align the poplar whole-genome sequencing data to the poplar reference genome GCA_015852605.2, perform position sorting and mark duplicate reads;

[0087] (2) Use Sentieon software to detect mutation sites for each sample to obtain the gVCF of each sample;

[0088] (3) Use Sentieon for joint-calling to perform joint analysis on the gVCF of all samples to obtain the mutation results of each individual in the population.

[0089] In some embodiments of the present invention, the criteria for hard filtering are as follows: QD < 2.0 || FS > 60.0 || MQ < 40.0 || SOR > 3.0 || MQRankSum < -12.5 || ReadPosRankSum < -8.0.

[0090] In some embodiments of the present invention, the length of the probe is 80 - 120 bp.

[0091] In some embodiments of the present invention, the length of the probe is about 100 bp.

[0092] In some embodiments of the present invention, the GC content of the probe is between 20% and 80%.

[0093] In some embodiments of the present invention, screening SNPs that meet the requirements of the probes includes the following steps: sequencing the probes and removing probes that cannot be uniquely aligned to the genome and whose flanking sequences contain repetitive sequences.

[0094] In the fifth aspect of the present invention, there is provided an application of at least one of the above-mentioned poplar SNP molecular marker combinations, whole-genome liquid-phase chips, and kits, and the application is for detecting poplars of the Populus section.

[0095] In some embodiments of the present invention, the application is for detecting poplars of the Tacamahaca section.

[0096] In some embodiments of the present invention, the application is for detecting poplars of the Aigeiros section.

[0097] In some embodiments of the present invention, the application is for detecting poplars of the Turanga section.

[0098] In some embodiments of the present invention, the application is for detecting poplars of the Leucoides section.

[0099] In some embodiments of the present invention, the application is for whole-genome selection breeding of poplars.

[0100] In some embodiments of the present invention, the application is for genome-wide association analysis of poplars.

[0101] In some embodiments of the present invention, the application is for identification of poplar germplasm resources and authenticity of varieties.

[0102] In some embodiments of the present invention, the application is for cluster analysis and identification of genetic relationships of poplars.

[0103] In some embodiments of the present invention, the application is for trait mining and identification of poplars.

[0104] In some embodiments of the present invention, the application is for genotyping detection of poplars.

[0105] In some embodiments of the present invention, the application is for construction of genetic maps and gene mapping of poplars.

[0106] In some embodiments of the present invention, the application is for identification of genetic diversity of poplars.

[0107] In some embodiments of the present invention, the application is for molecular design breeding of poplars.

[0108] In some embodiments of the present invention, the application can be specifically realized by the following method:

[0109] S1. Genotype the sample to be tested using at least one of the poplar SNP molecular marker combinations, whole-genome liquid-phase chips, and kits to obtain the genotype typing results; S2. Analyze the genotype typing results obtained in step S1.

[0110] In the sixth aspect of the present invention, a breeding method for poplar is proposed, including the following steps: Detect the DNA of the poplar to be tested using at least one of the above-mentioned poplar SNP molecular marker combinations, whole-genome liquid-phase chips, and kits, and select suitable poplar tree species for subsequent breeding.

[0111] In some embodiments of the present invention, the poplar tree species include at least one of the poplar species of the Populus sect. Leuce, Populus sect. Tacamahaca, Populus sect. Aigeiros, Populus sect. Turanga, and Populus sect. Leucoides.

[0112] In some embodiments of the present invention, the detection is carried out based on the liquid-phase probe capture sequencing typing technology.

[0113] The present invention has at least the following beneficial effects:

[0114] The poplar SNP molecular marker combination of the present invention can be used for the specific identification of the five major poplar species. When it is used to prepare the whole-genome liquid-phase chip for poplar tree species, it can realize the high-efficiency, accurate typing detection of the genotypes of the low-cost poplar germplasm resource population, and has exclusivity for the Populus sect. Leuce, Populus sect. Aigeiros, Populus sect. Tacamahaca, Populus sect. Leucoides, and Populus sect. Turanga of the genus Populus. It can be applied to the genotype analysis and genetic diversity assessment of poplar germplasm resources, the identification of germplasm resources and variety authenticity, the construction of genetic maps and the localization of functional genes, genome-wide association analysis, molecular design breeding, etc., and has important application value in multiple fields of poplar biological breeding.

[0115] At the same time, the whole-genome liquid-phase chip for poplar tree species of the present invention is based on the principle of liquid-phase chips, with flexible loci, and new marker loci can be added at any time in the later stage. Moreover, this chip also includes 12,287 functional loci and trait-associated loci such as growth, resistance, wood formation, flowering period regulation, and flavonoid metabolism, and 4,438 specific loci for the four major poplar species of the Populus sect. Leuce, Populus sect. Aigeiros, Populus sect. Tacamahaca, and Populus sect. Turanga. The number of loci is large, and the functional loci and trait-associated loci are rich, which is conducive to the development, excavation, and utilization of poplar germplasm resources and the creation of new varieties, provides an important tool for poplar molecular breeding, etc., and plays an important role in the research of poplar genomic selection breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0116] The following further describes the present invention in conjunction with the drawings and embodiments, where:

[0117] Figure 1 It is the chromosomal density distribution diagram of the loci of the 60K cGPS liquid-phase chip for poplar in Example 1 of the present invention;

[0118] Figure 2 This is the MAF distribution map of the 60K cGPS liquid chip for poplar in Example 1 of the present invention;

[0119] Figure 3 This is the schematic diagram of the cGPS liquid chip process detection in Example 2 of the present invention;

[0120] Figure 4 This is the detection result graph of the average consistency rate of genotypes of technical replicate samples in Example 3 of the present invention;

[0121] Figure 5 This is the principal component analysis diagram of the four major sections of poplar in Example 4 of the present invention;

[0122] Figure 6 This is the cluster analysis diagram of the four major sections of poplar in Example 4 of the present invention. Detailed implementation manners

[0123] The following will clearly and completely describe the concept of the present invention and the technical effects generated in combination with the embodiments, so as to fully understand the purpose, features, and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all embodiments. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative efforts shall fall within the scope of protection of the present invention. For those conditions not specified in the embodiments, they shall be carried out according to the conventional conditions or the conditions recommended by the manufacturer. For those reagents or instruments without indicating the manufacturer, they are all conventional products that can be obtained through commercial purchase.

[0124] Example 1

[0125] In this example, a poplar SNP molecular marker combination and a poplar whole-genome liquid chip designed according to the poplar SNP molecular marker combination were prepared.

[0126] 1. The screening process of the poplar SNP molecular marker combination is as follows:

[0127] (1) Collection of poplar germplasm resources

[0128] In order to obtain poplar whole-genome loci with rich genetic information, the resequencing data of 1307 samples of the section Populus alba, 458 samples of the section Tacamahaca, 635 samples of the section Aigeiros, 252 samples of the section Populus euphratica, and 9 samples of the section Leucoides in the existing database, as well as 546 black poplar diversity materials collected from the cooperation base of the Research Institute of Forestry, Chinese Academy of Forestry, were collected and summarized, and the total number of samples was 3,207.

[0129] (2) Poplar whole-genome resequencing and resequencing data analysis

[0130] A total of 546 Populus nigra materials were subjected to whole-genome resequencing. The specific steps are as follows:

[0131] 1) Extract DNA using the magnetic bead method; 2) Adopt the MGI library standard method to construct DNA-seq sequencing libraries for those with qualified quality inspections; 3) After the library passes the quality inspection, sequence it using the BGI sequencing platform (MGI). The sequencing strategy is PE150, the sequencing depth is 20×, and the sequencing volume for each material is 9 Gb.

[0132] Use Sentieon to align and detect variations in the resequencing data of 3,207 samples. The analysis process is as follows:

[0133] 1) Use Sentieon to align the reads to the Populus reference genome (GCA_015852605.2), sort the positions, and mark the duplicate reads; 2) Use Sentieon to detect variant sites for each sample to obtain the gVCF of each sample; 3) Use Sentieon for joint-calling to jointly analyze the gVCF of all samples to obtain the variant results of each individual in the population. To ensure the accuracy of SNPs, perform preliminary hard filtering on the SNP sites obtained after joint analysis (SNP hard filtering criteria: "QD < 2.0 || FS > 60.0 || MQ < 40.0 || SOR > 3.0 || MQRankSum < -12.5 || ReadPosRankSum < -8.0").

[0134] After filtering, a.vcf file containing SNP variation information for all samples was obtained, with a total of 49,998,887 SNP sites.

[0135] (3) Site screening

[0136] (1) Whole-genome sites

[0137] Calculate and statistically analyze the MAF value, detection rate, heterozygosity rate, and sequencing depth of the sites from the.vcf file containing SNP variation information for all samples. According to MAF ≥ 0.2, SNP site detection rate ≥ 80%, heterozygosity rate ≤ 50%, and sequencing depth ≥ 6X, 419,970 candidate site sets of the five major sections of Populus were screened.

[0138] Design probes for the screened target site set. The principle of probe design is to design probes within 100 bp on both sides of all target sites. The probe length is generally 100 bp, and the GC content is between 20% and 80%. According to the probe design results, remove the probes that cannot be uniquely aligned on the genome and those with repetitive sequences in the flanking sequences. Based on the principle of uniform distribution, 30,704 SNP sites were preferably selected as whole-genome sites.

[0139] (2) Important functional sites

[0140] Collect and summarize the functional genes reported to be related to important economic traits such as poplar growth, resistance, wood formation, flowering period regulation, and flavonoid metabolism. Extract all site information of these functional genes from the.vcf file of all sample SNP variation information obtained in (3) according to the SNP site detection rate ≥ 90%, heterozygosity rate ≤ 50%, and sequencing depth ≥ 5X. Select SNP sites with higher MAF values as candidate sites. According to the probe design results, remove the probes that cannot be uniquely aligned on the genome and those containing repetitive sequences in the flanking sequences. Finally, 12,404 SNP sites are obtained (shown in Table 2).

[0141] Table 2

[0142]

[0143]

[0144] (3) Specific sites of the four major groups of tree species

[0145] The genetic differentiation index (FST) between populations is a measure of population differentiation and genetic distance. The larger the differentiation index, the greater the difference. Fst ranges from 0 to 1. The closer it is to 1, the greater the degree of differentiation between the two populations and the higher the degree of selection. The closer it is to 0, the smaller the degree of differentiation between the two populations and the lower the degree of selection. Calculate (single-point calculation) for all sample SNP variation information in the.vcf file obtained in (3), a total of 49,998,887 SNP sites, with the parameter --weir-fst-pop. Finally, filter and design probes according to the threshold of FST > 0.5, and a total of 4,438 specific sites of the four major groups of tree species are obtained (shown in Table 3).

[0146] Table 3 FST site statistics table

[0147]

[0148] Finally, after summarizing all the target sites, it is found that there are gap regions. Fill the gap regions based on the principle of uniform distribution on the chromosome. Fill according to the indicators of MAF ≥ 0.05, SNP site detection rate ≥ 80%, heterozygosity rate ≤ 50%, and sequencing depth ≥ 6X. Finally, a 60K liquid chip of poplar genome is constructed for probe synthesis. The number of sites is 60,944 in total, and the average spacing is 6.8Kb (as Figure 1 shown), the site information is shown in Table 1, and the MAF distribution map is shown in Figure 2 (MAF value is not considered for functional sites).

[0149] 2. Poplar whole-genome liquid chip

[0150] Based on the 60,944 SNP sites obtained by screening, liquid-phase capture probes were synthesized by Huazhi Biotechnology Co., Ltd., and a system for poplar liquid-phase chips was formed using the accurate positioning sequencing genotyping technology (cGPS) based on liquid-phase capture of target-region genomic sequences, and a poplar whole-genome liquid-phase chip was prepared.

[0151] Based on an optimized thermodynamic stability algorithm model, cGPS designs probes for genomic sequences of different target regions, uses synthetic specific probes to perform liquid-phase hybridization capture and enrichment on multiple different target sequences located at different genomic positions, and then constructs a sequencing library and performs high-throughput sequencing on the captured and enriched target genomic sequences, so as to obtain the genotypes of all SNP / InDel sites within the target region, as Figure 3 shown.

[0152] Example 2

[0153] This example provides a method for using the poplar whole-genome liquid-phase chip in Example 1 above to identify poplars, which specifically includes the following content:

[0154] 1. Extraction and detection of poplar gDNA

[0155] Twenty-three samples were selected as verification samples for the 60,944 SNP liquid-phase chip development system. Fresh leaves of 8 Populus tomentosa, 7 Populus simonii, and 8 Populus nigra were collected, and gDNA was extracted from the tissues using the magnetic bead method. The integrity and purity of gDNA were analyzed by 1% agarose gel electrophoresis, and the concentration was accurately quantified using Qubit.

[0156] 2. cGPS experimental procedure

[0157] (1) Take 200 ng of quantitatively qualified gDNA for quality inspection. After digesting the DNA into fragments sized 100 - 500 bp using restriction enzymes, add Taq enzyme for end repair; (2) Use T4 ligase to ligate adapter fragments to both ends of the DNA. Use fragment sorting magnetic beads to purify and amplify the library of the ligation product to complete library construction; (3) Place the library passing quality inspection, blocking reagent, RNA enzyme inhibitor Rnase Block, and 60K liquid chip probes on a PCR instrument for hybridization reaction, and incubate at 55 °C overnight (16 - 24 h); (4) Capture the hybridization product using streptavidin, amplify and enrich the captured library, and perform PE150 sequencing using the BGI sequencing platform; (5) The raw data after high-throughput sequencing is processed through quality control filtering, etc. Use the fastp software to remove Reads contaminated with adapters and low-quality Reads. Align with the target genome using the BWA software, and then use the GATK software to analyze the variant sites of the sequencing results to obtain the genotype typing results of the target sites. The process schematic diagram is as shown in Figure 3 shown.

[0158] Example 3 Evaluation of the Genotyping Effect of the Poplar Whole Genome Liquid Chip

[0159] To verify the genotyping effect of the poplar whole genome liquid chip, use the poplar whole genome liquid chip obtained in Example 1 to perform genotyping detection on 30 different poplar materials (including 7 replicate samples) (for the specific operation method, see Example 2).

[0160] Table 4 Locus Detection Rates of 30 Poplar Samples

[0161]

[0162]

[0163] As shown in Table 4 and Figure 4 shown, it can be seen from Table 4 that through sequencing and data analysis, the locus detection rate of Populus tomentosa is between 80.39% - 83.85%, and the average detection rate is 82.31%; the locus detection rate of Populus simonii is between 87.41% - 89.53%, and the average detection rate is 88.02%; the locus detection rate of Populus nigra is between 98.33% - 99.18%, and the average detection rate is 98.68%; it can be seen from Figure 4 that for the comparison of the genotype results of 7 replicate samples, the consistency rate is between 98.84% - 99.47%, and the average consistency rate is 99.17%. The evaluation results of the genotyping effect of 60,944 SNP liquid chips show that the highest detection rate is Populus nigra, followed by Populus simonii and Populus tomentosa. The average genotype consistency rate is high, and the genotyping results are accurate and reliable.

[0164] Population Structure Analysis of Poplar Whole Genome Liquid Chip in Example 4

[0165] The genotypes of 720 poplar samples of different factions (including 139 white poplars, 230 black poplars, 191 Cathay poplars and 160 Euphrates poplars) were identified using the poplar whole genome liquid chip prepared in Example 1. The PCA components of the test materials were analyzed using Plink software to construct a PCA scatter plot. Each locus in the scatter plot represents a sample. The farther the distance between two samples in the figure, the greater the difference in their genetic backgrounds. Individuals with similar genetic backgrounds will cluster together in the figure.

[0166] The results are as Figure 5 shown. It was statistically found that the poplar materials were divided into 4 distinct populations, which was consistent with the species grouping.

[0167] Meanwhile, the genetic distance matrix was calculated using the IBS method in Plink software, and cluster analysis and phylogenetic tree construction were carried out. The results are as Figure 6 shown. It can be seen from the figure that the 60K liquid chip of poplar can effectively distinguish poplar tree species of different factions, and the classification effect is consistent with the actual classification.

[0168] The above has described the embodiments of the present invention in detail. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those of ordinary skill in the art, various changes can be made without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A whole-genome liquid chip, characterized in that, The whole-genome liquid chip includes probes for detecting the SNP molecular marker combination of poplar; the SNP molecular marker combination of poplar consists of 60,944 SNP molecular markers, and the physical positions of the 60,944 SNP molecular markers are determined by sequence alignment based on the poplar reference genome GCA_015852605.2, and the locus information is specifically shown in Table 1 of the specification; The SNP molecular marker 19:17260837T / - in Table 1, where "-" represents the insertion of TATTTGAAGTTCGTCGAAGCTCCCAGTAAACATGAC; The Alt is ".", indicating that it has multiple mutation possibilities; When ref is A, Alt is ".", indicating that the mutation can be T, G, C or N; when ref is T, Alt is ".", indicating that the mutation can be A, G, C or N; when ref is G, Alt is ".", indicating that the mutation can be A, T, C or N; when ref is C, Alt is ".", indicating that the mutation can be A, T, G or N, where N is a deletion.

2. A kit, characterized in that, The kit contains probes for detecting the SNP molecular marker combination of poplar, or primer sets and probes; the SNP molecular marker combination of poplar consists of 60,944 SNP molecular markers, and the physical positions of the 60,944 SNP molecular markers are determined by sequence alignment based on the poplar reference genome GCA_015852605.2, and the locus information is specifically shown in Table 1 of the specification; The SNP molecular marker 19:17260837T / - in Table 1, where "-" represents the insertion of TATTTGAAGTTCGTCGAAGCTCCCAGTAAACATGAC; The Alt is ".", indicating that it has multiple mutation possibilities; When ref is A, Alt is ".", indicating that the mutation can be T, G, C or N; when ref is T, Alt is ".", indicating that the mutation can be A, G, C or N; when ref is G, Alt is ".", indicating that the mutation can be A, T, C or N; when ref is C, Alt is ".", indicating that the mutation can be A, T, G or N, where N is a deletion.

3. Use of one of the whole-genome liquid chip according to claim 1 and the kit according to claim 2 in any one of the following: (1) Detecting section Populus; (2) Detecting section Tacamahaca; (3) Detecting section Aigeiros; (4) Detecting section Turanga; (5) Whole-genome selection breeding of poplar; (6) Whole-genome association analysis of poplar; (7) Identification of poplar germplasm resources and variety authenticity; (8) Cluster analysis and genetic relationship identification of poplar; (9) Construction of poplar genetic map and gene mapping; (10) Identification of poplar genetic diversity; (11) Molecular design breeding of poplar.

4. A breeding method for poplar trees, characterized in that, It includes the following steps: using one of the whole-genome liquid chip according to claim 1 and the kit according to claim 2 to detect the DNA of the poplar to be tested, and selecting poplar for subsequent breeding.

Images