SSR Molecular Markers, Primers and Applications Developed Based on the Transcriptome Sequences of Iris barbata
Through high-throughput sequencing technology, 10 SSR molecular markers and their primers were developed, which solved the problem of limited number of SSR markers in the genus Iris in the prior art, and achieved efficient and accurate identification of germplasm of bearded iris and genetic diversity analysis.
Patent Information
- Application Number
- CN202411220876.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-02
- Publication Date
- 2025-06-13
- Estimated Expiration
- 2044-09-02
AI Technical Summary
The number of ISSR and SSR markers developed for Iris in the prior art is limited, and it is difficult to meet the needs of germplasm identification and genetic diversity analysis of bearded iris.
By using high-throughput sequencing technology to obtain transcriptome information with chard iris, 10 SSR molecular markers based on transcriptome sequences and their corresponding primers were developed, and a system for screening and application of molecular marker primers was established.
These SSR molecular markers show good amplability, specificity and stability in germplasm identification, kinship analysis and molecular marker-assisted breeding, which can accurately and efficiently identify varieties and analyze genetic diversity.
Smart Images

Figure CN118895385B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of SSR molecular markers, and in particular to SSR molecular markers, primers and applications developed based on the transcriptome sequence of bearded iris. Background Art
[0002] Bearded Iris belongs to the horticultural hybrid population of Iris in the family Iridaceae, and is named because of the bearded appendages on the hanging petals of the flower. Bearded Iris not only has rich flower colors and high ornamental value, but also the extracted components of its rhizomes have medicinal value, including anti-inflammatory, antioxidant, anti-aging, antibacterial and other effects. The bearded iris population is formed by natural hybridization of parents mainly including Iris pallida and Iris fulva. At present, more than 20,000 horticultural varieties have been registered, and their varieties cannot be determined only by phenotypic observation. Molecular markers have become one of the most important tools for revealing the genetic diversity of species and variety identification. Using molecular marker technology to identify the authenticity and purity of varieties has the advantages of objectivity, accuracy, speed, easy realization of identification automation, and the ability to identify varieties that are difficult or impossible to identify morphologically. However, at present, only a small number of ISSR and SSR markers have been developed for Iris plants, and a large number of SSR molecular markers still need to be developed to meet the needs of genetic diversity analysis and variety identification.
[0003] SSR markers are divided into two types: genomic (Genome) SSR markers and transcriptome SSR markers. Transcriptome SSR markers have the advantages of low development cost, strong interspecific conservation of sequences, and being closely linked to genes with specific functions compared with genomic SSR markers. With the development of high-throughput sequencing (NGS) technology, a large amount of transcriptome data can be obtained at a low cost, and SSR loci developed from the expressed sequences therein have also been widely used.
[0004] Therefore, it is of great significance to obtain the transcriptome information of bearded iris by using high-throughput sequencing technology, develop a large number of SSR molecular markers, and establish a system for screening and applying molecular marker primers for the identification of bearded iris germplasm, analysis of genetic relationships and molecular marker-assisted breeding. Summary of the Invention
[0005] The object of the present invention is to provide SSR molecular markers, primers and applications developed based on the transcriptome sequence of bearded iris. The SSR molecular markers are developed based on the transcriptome sequence of bearded iris and have good amplifiability, specificity and stability in different varieties of bearded iris.
[0006] To achieve the above object, the present invention provides bearded iris SSR molecular markers. There are 10 SSR molecular markers in total, including 1-3 base repeat units, namely IG1212F17, IG1212F18, IG1212F19, IG1212F20, IG0809F4, IG0821F2, IG0821F4, IG1001F12, IG1002F14, and IG1111F15.
[0007] Preferably, the repeat unit of IG1212F17 is A, and the number of repeats is 15; the repeat unit of IG1212F18 is A, and the number of repeats is 12; the repeat unit of IG1212F19 is TGG, and the number of repeats is 5; the repeat unit of IG1212F20 is GAG, and the number of repeats is 5; the repeat unit of IG0809F4 is ACC, and the number of repeats is 5; the repeat unit of IG0821F2 is A, and the number of repeats is 13; the repeat unit of IG0821F4 is TGC, and the number of repeats is 5; the repeat unit of IG1001F12 is GTT, and the number of repeats is 10; the repeat unit of IG1002F14 is T, and the number of repeats is 16; the repeat unit of IG1111F15 is TC, and the number of repeats is 8.
[0008] Preferably, the forward primer sequence of the IG1212F17 marker is as shown in SEQ ID NO.11, the reverse primer sequence is as shown in SEQ ID NO.12, and the fragment size is 220bp; the forward primer sequence of the IG1212F18 marker is as shown in SEQ ID NO.13, the reverse primer sequence is as shown in SEQ ID NO.14, and the fragment size is 178bp; the forward primer sequence of the IG1212F19 marker is as shown in SEQ ID NO.15, the reverse primer sequence is as shown in SEQ ID NO.16, and the fragment size is 171bp; the forward primer sequence of the IG1212F20 marker is as shown in SEQ ID NO.17, the reverse primer sequence is as shown in SEQ ID NO.18, and the fragment size is 236bp; the forward primer sequence of the IG0809F4 marker is as shown in SEQ ID NO.19, the reverse primer sequence is as shown in SEQ ID NO.20, and the fragment size is 223bp; the forward primer sequence of the IG0821F2 marker is as shown in SEQ ID NO.21, the reverse primer sequence is as shown in SEQ ID NO.22, and the fragment size is 104bp; the forward primer sequence of the IG0821F4 marker is as shown in SEQ ID NO.23, the reverse primer sequence is as shown in SEQ ID NO.24, and the fragment size is 257bp; the forward primer sequence of the IG1001F12 marker is as shown in SEQ ID NO.25, the reverse primer sequence is as shown in SEQ ID NO.26, and the fragment size is 165bp; the forward primer sequence of the IG1002F14 marker is as shown in SEQ ID NO.27, the reverse primer sequence is as shown in SEQ ID NO.28, and the fragment size is 106bp; the forward primer sequence of the IG1111F15 marker is as shown in SEQ ID NO.29, the reverse primer sequence is as shown in SEQ IDNO.30, and the fragment size is 166bp.
[0009] Preferably, the PCR reaction system of the SSR molecular marker is: 2μL DNA working solution, 1μL each of the forward primer and the reverse primer, 2μL 10×PCR Buffer, 1μL dNTP, 0.1μL rTaq enzyme, 12.9μL ddH 2 O, the concentration of the DNA working solution is 100mmol / L, the concentration of the forward primer and the reverse primer is 10μmol / L, and the concentration of dNTP is 10mmol / L.
[0010] Preferably, the PCR amplification program of the SSR molecular marker is: pre-denaturation at 94°C for 4 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 1 min, 32 cycles, with the annealing temperature decreasing by 1°C per cycle; extension at 72°C for 10 min.
[0011] Application of the bearded iris SSR molecular marker as described above in germplasm identification, genetic relationship analysis and molecular marker-assisted breeding of bearded iris.
[0012] A product for germplasm identification, genetic relationship analysis and molecular marker-assisted breeding of bearded iris, the product being a reagent or a kit, and the product containing the above SSR molecular marker.
[0013] The method for developing the bearded iris SSR molecular marker as described above, taking the young leaf tissue of bearded iris to extract RNA, constructing a cDNA library, performing sequencing by high-throughput sequencing method, and then using MISA software to analyze the obtained sequencing data to obtain potential SSR loci and the adjacent flanking conserved sequence information, and designing primers for screening according to the obtained potential SSR loci and the adjacent flanking conserved sequence information, so as to obtain SSR molecular markers with good amplifying property, polymorphism and stability.
[0014] Therefore, the SSR molecular markers, primers and applications developed based on the bearded iris transcriptome sequence provided by the present invention have the following specific technical effects:
[0015] (1) The 10 pairs of SSR molecular markers and primers provided by the present invention have clear amplified bands, high polymorphism and good repeatability in various bearded iris varieties, and can be accurately, efficiently and stably used for bearded iris variety identification, genetic diversity analysis and molecular marker-assisted breeding;
[0016] (2) The present invention first provides an SSR molecular marker development system applicable to the bearded iris population, and the efficiency of developing SSR molecular markers is high.
[0017] The technical solutions of the present invention will be further described in detail below through the accompanying drawings and examples. Description of the Drawings
[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present invention, and those of ordinary skill in the art can also obtain other drawings without creative efforts based on these drawings.
[0019] Figure 1This is a photograph of the polyacrylamide gel detection results showing that 10 pairs of SSR primers, namely IG1212F17(A), IG1212F18(B), IG1212F19(C), IG1212F20(D), IG0809F4(E), IG0821F2(F), IG0821F4(G), IG1001F12(H), IG1002F14(I), and IG1111F15(J), exhibited relatively good polymorphic amplification in the tested bearded iris samples. Each lane represents a different bearded iris variety. The leftmost is the Marker, and moving right are C2, C3, C4, C8, C12, C9, C11, C16, C17, C24, C1, C18, C19, C25, C13, C5, C10, C22, C23, C15 in sequence.
[0020] Figure 2 This is the clustering analysis result of 25 bearded iris varieties in Example 3 of the present invention. Detailed implementation manners
[0021] The technical solutions of the present invention will be further described below with reference to the accompanying drawings and examples.
[0022] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and complete, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings and examples. The following detailed descriptions are all descriptions of examples, aiming to provide further detailed descriptions of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meanings as commonly understood by those of ordinary skill in the technical field to which this application belongs.
[0023] The instrument equipment and reagent materials used in the examples were all obtained through commercial channels, and the experimental methods not described were conventional methods in the art.
[0024] Example 1
[0025] Obtain SSR potential loci and design primers for the SSR potential loci. The specific steps are as follows:
[0026] S11. Use the Trizol method to extract the total RNA of the leaves of two bearded iris varieties, 'Immortality' and 'New Moon'. Detect the quality of the obtained RNA by agarose gel electrophoresis, and select the ones with good quality to be sent to the company for library construction and high-throughput sequencing of the transcriptome.
[0027] S12. Use the MIcroSAtellite (MISA) software (http: / / misaweb.ipk - gatersleben.de / ) to analyze the obtained transcriptome data, and a total of 10 SSR potential loci and their adjacent flanking conserved sequences are obtained: Cluster - 7504.0 (the sequence is shown in SEQ ID NO.1), Cluster - 18083.40427 (the sequence is shown in SEQ ID NO.2), Cluster - 26832.0 (the sequence is shown in SEQ ID NO.3), Cluster - 26805.10 (the sequence is shown in SEQ ID NO.4), Cluster - 35587.0 (the sequence is shown in SEQ ID NO.5), Cluster - 10207.3 (the sequence is shown in SEQ ID NO.6), Cluster - 36729.1 (the sequence is shown in SEQ ID NO.7), Cluster - 18083.20798 (the sequence is shown in SEQ ID NO.8), Cluster - 31626.0 (the sequence is shown in SEQ ID NO.9), Cluster - 18083.54182 (the sequence is shown in SEQ ID NO.10)
[0028] SEQ ID NO.1:
[0029] AATCCGGACCTCAACCAGTGCCCGAGCCCCGACAGCTCAGACGCCGAGGACTGAGACCACGACCACCACCACCACCACGACCGCGACCGCGACGGTGATTTTATTAAGCGAGTTATATATTTGTCCTTTTTTTTTCTTTTTTCTTTTTCGTAACTTTTTTTTAGTTACTCTAGACTCGTAAAGTGTAAATCTAAATTGGTCTGGTCCCAAGTATTCGATCGGTA
[0030] SEQ ID NO.2:
[0031] TCGGTTCGGTTTAAGGTCGGTTCGGTTTTATGAAGTAAAACCTAGCCTAACGTCT TTTTTGGAAAAAAAAAAAAATACTAGGCACACAGCATGCACATGGGAAC
[0032] SEQ ID NO.3:
[0033] AAGTTGGAGGAGGAGGTGGTGGTGGAGGATGAATGACGTACCCCTGCCCGTCGAAGTCATAGCCCCGGCCAGCGCCACCGTGCTGCCACATCGGCTGCCACGGCGGTTGCTGCTGCTGCTGCATGTACACTCCTGGGTCCATCGCCGGCTGCCCCATCATCAACCCCTGCCCCGCAGGAGGGTAGTAGTACGGCACACCTGCAGCAGCAGCGGCTGCGCCCGGCATCAATCCGATTCCGCTCGCCTCCTCCTTTAT
[0034] SEQ ID NO.4:
[0035] TGCACTGCGACATCAACTCTTCGTCGGAGAGACTCAAGTAGTTGTTGTTGTTGTTGTTGTTGTTGTTGATATTATTATTAGTGGTGATGCTGGAAGAGCTTGTAGAGAAGAAGAAAGGTTTAATAGGAGAGAAGAGCTGACGATGTGTTCTGCTGAGAAGAGGTGGTGGTGGT
[0036] SEQ ID NO.5:
[0037] TCCCCCTTCATTTCTTCGGCTTCTGCTTGCTTGCTTCTTCTTTTTTTCCAACATAATTTTTTTTTTTTTTTTACAAAGTTGAAGTTGTTGGATGGAAAAGCTGCC
[0038] SEQ ID NO.6:
[0039] TCCTTCCCGTCTACCTCCTGCTGCTGCCGGCGCCGGCGCTGCGTTTGTCGTTCGGCACCGGCGCCGGCGCCTCTGCTGCTCTGTTGCTGGCGGCTGTTCTCTCTCTCTCTCTCTTTTGCGTTGTGTCTGCGGCGGCTAGGTAAAGCAAGAGTGAAGAGACGGGGGT
[0040] SEQ ID NO.7:
[0041] CCTGCCACTCTTCACACCAACACAACACTTTGCTTAAAAAAAAAAAAAAATTCCTCCTCCTCCATATTTACTACTGTTGAGTTCTCCTCCTTATGAATGGAGTCTCCTGTTCCTGCTGCTGCTCCAGCTGTCTGCAAGTACTGACTGACTGAACAACTCTTCAGTTCCTTCCAAGCTTTCTGCATCAGCATCAGCATACTTTGTTAGTTGGAGTGGCGCT
[0042] SEQ ID NO.8:
[0043] CCTCCCTCTCCTCACTCTCCTATGCTTAAAAAAAAAAAATCATAGTTCCTAGTAGGGTGAGCATTCGGTTTATTCGGTTTCAACATGACGGAAAATCAAATTGAATAAACCGAATTTCTAAAATTCCAAGATCGAACCCGAATCGAAATTAGTCAAAAATGAAACCGAACCGAACCGA
[0044] SEQ ID NO.9:
[0045] CCCTTCCGTTCTTCTCGTCCACCGTAGCGTAGCCGGCATAGTGGCGGAACCCCACGCTAGGCTGCCCAGGCAGTTGGGTCACGAGGTCTTGGTGCAATGGCTCCGCATCATGTCGTCTGGTGGTGGTGGTGGTGCAAGAGGCTGGGCACGCAAGAAGAGCACAGGCAGCA
[0046] SEQ ID NO.10:
[0047] TCCATCTCAGCTTCCTCGGAGCTCGACGAGGAGAGAAGAACTGGAGGCCGCCGCCATGCCGCCTTGTGGCGAGCGAAATCGGAACCTCAACCCTATCCCTAGGTTTCGGTCGGCGAAGGAGGAGAGGGGCCGGCGGTGGTTGAGCCAGGCACCGCCAGACGCCGGTCATGGAGAGGAGGAGGAGG
[0048] S13. Design primers using Primer5 based on the flanking sequences of the potential SSR loci. The length of a single strand is between 18 - 24 bp, the size of the PCR product is between 100 - 400 bp, and the optimal Tm value is approximately 60°C. At the same time, pay attention to following the primer design principles. The primers designed for 10 SSRs are shown in Table 1.
[0049] Table 1
[0050]
[0051]
[0052] Example 2
[0053] Investigate the amplifiability and polymorphism of the SSRs and primers obtained in Example 1. The specific steps are as follows:
[0054] S21. Use 25 bearded irises shown in Table 2 as test materials. Randomly select 3 well - growing plants from each variety, take the young and tender leaves from the middle part, extract DNA using the improved CTAB method, and perform PCR amplification using the above primers.
[0055] The amplification system is: 20 μL: 2 μL DNA working solution, 1 μL each of the forward primer (10 μmol / L) and reverse primer (10 μmol / L), 2 μL 10×PCR Buffer, 1 μL dNTP (10 mmol / L), 0.1 μL rTaq enzyme, 12.9 μL ddH 2 O. The amplification program is: pre - denaturation at 94°C for 4 min, denaturation at 94°C for 30 s, annealing at 55°C for 30 s (decreasing 1°C per cycle), extension at 72°C for 1 min, for 32 cycles; extension at 72°C for 10 min, and finally store at 4°C.
[0056] S22. Detect the amplified products by electrophoresis on an 8% polyacrylamide gel.
[0057] Preparation of the gel (taking 1 gel as an example): Prepare 30% acrylamide solution, 10×TBE electrophoresis buffer, 10% ammonium persulfate solution. Add 11 mL of 30% acrylamide solution, 4 mL of 10×TBE solution, and 25 mL of ddH 2 O to a conical flask. Use a pipette to add 280 μL of 10% ammonium persulfate solution and 30 μL of PAGE gel accelerator. Stir the mixture with a glass rod. Tilt the vertical support by 30°, use the glass rod to drain and pour the gel. After that, insert the sample comb and wait for the gel to solidify.
[0058] Gel electrophoresis detection: After loading the samples, insert the glass plate into the electrophoresis tank, pour in 500 mL of 1×TBE electrophoresis buffer, connect the power supply, adjust the voltage to 220 V, and perform electrophoresis for 2 h 30 min. After completion, remove the gel.
[0059] S23. Stain the gel using the modified Bassam silver staining method
[0060] The silver staining procedure is as follows: (1) Rinse the gel twice with distilled water; (2) Silver stain with the staining solution (0.1% AgNO 3 solution) for 10 min; (3) Rinse the stained gel twice with distilled water; (4) Pour in the developing solution (component concentration: 2% NaOH, 0.04% Na 2 CO 3 , 0.4% of 37% CH 2 O), gently shake until bands appear; (5) Fix in the fixing solution (10% CH 3 COOH solution); (6) Wash the gel with distilled water.
[0061] The PCR test results of some varieties are as Figure 1 shown. All 10 pairs of SSR primers can obtain clear and polymorphic bands, which can be used for the identification of bearded iris germplasm resources.
[0062] Table 2
[0063]
[0064]
[0065] Example 3
[0066] Use the 10 SSR molecular markers developed in Example 1 to perform a cluster analysis on the genetic relationships of the 25 bearded iris varieties shown in Table 2. The specific steps are as follows:
[0067] Use the 10 pairs of polymorphic primers developed in Example 1 to detect the DNA of 25 bearded iris samples. According to the band sequence information, use NTSYS-pc software (version 2.2) to perform UPGMA cluster analysis. Using a similarity coefficient of 0.6 as the threshold, the 25 varieties are divided into 4 groups ( Figure 2) Among them, the first group has 15 samples, which is the group with the largest number. Varieties with the same male parent are grouped together, such as C3 and C4, C5 and C17. The two samples C18 and C19 with Iris pallida as the parent are also grouped together. Combining the analysis of the morphological characteristics of the samples, it can be seen that samples with similar flower colors show a relatively high similarity coefficient in the clustering diagram. For example, the pink cultivars C7 and C14 are clustered together. Therefore, based on the polymorphism analysis of bearded iris shown by the SSR molecular marker system, different bearded iris varieties can be effectively distinguished and identified through cluster analysis.
[0068] Therefore, the present invention is the first SSR molecular marker development system applicable to the bearded iris population. The 10 pairs of SSR molecular marker primers and the corresponding molecular marker sequences in the invention are developed based on the sequences of the bearded iris transcriptome; by performing PCR amplification on the DNA of different bearded iris varieties, it is verified that the developed SSR molecular markers are stable and effective and are specific molecular markers in bearded iris varieties; using the above molecular marker primers to perform cluster analysis on the genetic relationships of 25 bearded iris varieties and using the above molecular markers to identify the authenticity of hybrid offspring, the results show that the 10 pairs of SSR primers and molecular markers provided by the present invention can be applied to related fields such as the identification of germplasm resources of bearded iris, genetic diversity analysis, molecular assisted breeding, and the identification of functional genes for the biosynthesis of active ingredients.
[0069] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit them. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that they can still modify or equivalently replace the technical solutions of the present invention, and these modifications or equivalent replacements cannot make the modified technical solutions deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. Application of amplification primers of SSR molecular markers of bearded iris in germplasm identification and phylogenetic analysis of bearded iris, characterized in that: There are 10 SSR molecular markers in bearded iris, namely IG1212F17, IG1212F18, IG1212F19, IG1212F20, IG0809F4, IG0821F2, IG0821F4, IG1001F12, IG1002F14 and IG1111F15; The repeating unit of IG1212F17 is A; the repeating unit of IG1212F18 is A; the repeating unit of IG1212F19 is TGG; the repeating unit of IG1212F20 is GAG; the repeating unit of IG0809F4 is ACC; the repeating unit of IG0821F2 is A; the repeating unit of IG0821F4 is TGC; the repeating unit of IG1001F12 is GTT; the repeating unit of IG1002F14 is T; the repeating unit of IG1111F15 is TC; The forward primer sequence of IG1212F17 is shown in SEQ ID NO.11, and the reverse primer sequence is shown in SEQ ID NO.12; the forward primer sequence of IG1212F18 is shown in SEQ ID NO.13, and the reverse primer sequence is shown in SEQ ID NO.14; the forward primer sequence of IG1212F19 is shown in SEQ ID NO.15, and the reverse primer sequence is shown in SEQ ID NO.16; the forward primer sequence of IG1212F20 is shown in SEQ ID NO.17, and the reverse primer sequence is shown in SEQ ID NO.18; the forward primer sequence of IG0809F4 is shown in SEQ ID NO.19, and the reverse primer sequence is shown in SEQ ID NO.20; the forward primer sequence of IG0821F2 is shown in SEQ ID NO.21, and the reverse primer sequence is shown in SEQ ID NO.22; the forward primer sequence of IG0821F4 is shown in SEQ ID NO. The forward primer sequence is shown in SEQ ID NO.23, and the reverse primer sequence is shown in SEQ ID NO.24; the forward primer sequence labeled with IG1001F12 is shown in SEQ ID NO.25, and the reverse primer sequence is shown in SEQ ID NO.26; the forward primer sequence labeled with IG1002F14 is shown in SEQ ID NO.27, and the reverse primer sequence is shown in SEQ ID NO.28; the forward primer sequence labeled with IG1111F15 is shown in SEQ ID NO.29, and the reverse primer sequence is shown in SEQ ID NO.
30.
2. A product for identification of bearded iris germplasm and analysis of genetic relationships, characterized in that: The product is a reagent or a kit, and the product comprises the amplification primers of the SSR molecular marker described in claim 1; the forward primer sequence of the IG1212F17 marker is shown in SEQ ID NO.11, and the reverse primer sequence is shown in SEQ ID NO.12; the forward primer sequence of the IG1212F18 marker is shown in SEQ ID NO.13, and the reverse primer sequence is shown in SEQ ID NO.14; the forward primer sequence of the IG1212F19 marker is shown in SEQ ID NO.15, and the reverse primer sequence is shown in SEQ ID NO.16; the forward primer sequence of the IG1212F20 marker is shown in SEQ ID NO.17, and the reverse primer sequence is shown in SEQ ID NO.18; the forward primer sequence of the IG0809F4 marker is shown in SEQ ID NO.19, and the reverse primer sequence is shown in SEQ ID NO.20; the forward primer sequence of the IG0821F2 marker is shown in SEQ ID NO.21, and the reverse primer sequence is shown in SEQ ID NO. NO.22; the forward primer sequence of IG0821F4 is shown in SEQ ID NO.23, and the reverse primer sequence is shown in SEQ ID NO.24; the forward primer sequence of IG1001F12 is shown in SEQ ID NO.25, and the reverse primer sequence is shown in SEQ ID NO.26; the forward primer sequence of IG1002F14 is shown in SEQ ID NO.27, and the reverse primer sequence is shown in SEQ ID NO.28; the forward primer sequence of IG1111F15 is shown in SEQ ID NO.29, and the reverse primer sequence is shown in SEQ ID NO.30.