A method for identifying Chinese sweet persimmon genotypes and its application

Abstract

The present invention discloses a method for identifying Chinese persimmon genotypes and its application, belonging to the technical field of genotype identification. The method for identifying Chinese persimmon genotypes provided by the present invention generates a fluorescent signal through a specific hydrolysis reaction between a probe and a target molecule, resulting in smaller errors, more accurate identification results, and higher result stability. Only two reference genomes are required, and identification is easy to perform, which can significantly reduce the workload of Chinese persimmon genotype identification, reduce the consumption of reagents and consumables, and lower the identification cost. The method can significantly shorten the time required for identification and improve identification efficiency. The identification of Chinese persimmon genotypes can provide a reference for the selection of hybrid parents and can also be used for embryo rescue of young plants, greenwood grafting, and marker-assisted selection of hybrid combinations, significantly improving PCNA breeding efficiency and having important significance for the breeding of new persimmon varieties with intellectual property rights and for the improvement of persimmon varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of genotype identification, in particular to a method for identifying Chinese persimmon genotypes and application thereof. Background Art

[0002] Persimmon (Diospyros kaki Thunb., 2n=6x=90; a few varieties have 2n=9x=135), native to my country, is a representative species of the Diospyros genus cultivated as a fruit tree. Its traditional production areas include East Asia, including China, South Korea, and Japan. Based on whether the fruit naturally loses its astringency at maturity and its genetic characteristics, persimmon varieties are divided into fully sweet persimmons (pollination-constant and non-astringent, PCNA), whose sweetness and astringency traits are inherited qualitatively, and non-completely sweet persimmons (non-PCNA), whose sweetness and astringency traits are inherited quantitatively. Persimmon fruits accumulate large amounts of persimmon tannins (persimmon tannins, also known as proanthocyanidins, PAs) within the vacuoles of specialized flesh cells called tannin cells. These PAs have an average molecular weight of 14,000 Da, three to five times that of common plant tannins. Tannins can be divided into two categories based on their solubility in alcoholic solutions: soluble and insoluble tannins. Soluble tannins combine with oral salivary proteins to produce a strong astringent and dry sensation (commonly known as "astringency"). Fully sweet persimmons naturally lose their astringency on the tree when ripe, allowing them to be eaten crisply without any de-astringency treatment. However, partially sweet persimmons require artificial de-astringency after ripening before they can be eaten fresh. Artificial de-astringency not only increases production costs, but also softens the fruit and makes it difficult to transport. Incomplete de-astringency also affects marketability.

[0003] my country possesses the richest persimmon germplasm resources in the world. With the exception of a few Chinese sweet persimmons in the Dabie Mountains, the rest are astringent. Chinese sweet persimmons (Chinese PCNA, C-PCNA) are fully sweet persimmons, naturally losing their astringency during the hard-eating period. This natural astringency removal mechanism is primarily based on the coagulation effect of tannins, unlike the dilution effect of Japanese sweet persimmons. Fully sweet persimmons native to China are rich in genetic diversity, and the genes controlling their natural astringency removal are dominant. In contrast, fully sweet persimmons native to Japan (abbreviated as "Japanese persimmons") are controlled by recessive genes. This means that hybrids of Chinese persimmons can produce fully sweet persimmons, while Japanese persimmons must be hybridized with other Japanese persimmons to produce fully sweet persimmons, but this is subject to inbreeding depression. Therefore, Chinese persimmons hold greater breeding value than Japanese persimmons.

[0004] At present, identifying the genotype of Chinese sweet persimmon can provide a reference for the selection of hybrid parents. Moreover, using the genotype for embryo rescue of young plants, green wood grafting and hybrid combinations of marker-assisted selection will greatly improve the efficiency of PCNA breeding and is of great significance for the breeding of new sweet persimmon varieties with intellectual property rights.

[0005] Currently, in practical applications, quantitative identification of naturally astringent-free genes in Chinese sweet persimmons relies on the ability of the SYBR Green I fluorescent dye to nonspecifically bind to double-stranded DNA, emitting fluorescence after binding. The fluorescence intensity of SYBR Green I in the reaction system can be detected to detect the amount of qPCR product amplification. However, in practical applications, primers bind nonspecifically, and the presence of nonspecific amplification products in the qPCR reaction will increase the fluorescence value, affecting the accuracy of the quantitative results. In other words, there is a certain gap between the results obtained by different standard curves. For some materials, it is impossible to obtain completely accurate results, and the standard curves of three reference genes must be used to determine their genotypes. The material consumption is relatively high. The original procedure requires a complete PCR reaction to bind to the double strands before detecting the fluorescence signal, which is time-consuming. Summary of the Invention

[0006] The purpose of the present invention is to provide a method for identifying Chinese persimmon genotypes and its application, so as to solve the problems that the current Chinese persimmon genotype identification method has bias, poor stability and low reliability of the detection results for some persimmon materials, and is time-consuming and labor-intensive. A new and efficient identification method is provided to help cultivate new persimmon varieties with a complete Chinese persimmon genetic background.

[0007] To achieve the above object, the present invention provides a method for identifying Chinese persimmon genotypes, comprising the following steps:

[0008] S1. Extract genomic DNA from a Chinese sweet persimmon standard sample, design specific primers and Taqman specific probes based on the CPCNA region of the natural de-astringency site of Chinese sweet persimmon and the reference gene sequence, and send the specific primer and Taqman specific probe sequence information to the company for synthesis;

[0009] S2. The genomic DNA of the obtained Chinese sweet persimmon standard sample was diluted to different concentrations, and then mixed with the CPCNA region of the natural de-astringency site of Chinese sweet persimmon, reference gene-specific primers, and Taqman specific probe to perform real-time fluorescence quantitative PCR reaction to obtain Ct values ​​at different DNA concentrations;

[0010] S3. Establish a standard curve using the obtained Ct values ​​of the Chinese sweet persimmon standard samples at different DNA concentrations, different specific primers, and Taqman specific probes;

[0011] S4. Extract the genomic DNA of the persimmon material to be tested and dilute it to a determined concentration. Mix it with the CPCNA interval of the natural de-astringency site of Chinese sweet persimmon, reference gene-specific primers and Taqman-specific probe, and then perform real-time fluorescence quantitative PCR reaction to obtain the Ct values ​​under different specific primers and Taqman-specific probes. Substitute the obtained Ct values ​​into the standard curve established in S3 to calculate the genotype of the persimmon material to be tested.

[0012] Preferably, the Chinese persimmon standard sample in S1 is 'small-fruited sweet persimmon', and the reference genes are DkAct and L5R; the upstream primer sequence of the CPCNA interval-specific primer for the natural astringency-removing site of Chinese persimmon is shown in SEQ ID NO.1, the downstream primer sequence is shown in SEQ ID NO.2, and the sequence of the Taqman specific probe is shown in SEQ ID NO.3.

[0013] Preferably, the upstream primer sequence of the specific primer for the DkAct gene in S1 is shown as SEQ ID NO.4, the downstream primer sequence is shown as SEQ ID NO.5, and the Taqman specific probe sequence is shown as SEQ ID NO.6; the upstream sequence of the specific primer for the L5R gene is shown as SEQ ID NO.7, the downstream primer sequence is shown as SEQ ID NO.8, and the Taqman specific probe sequence is shown as SEQ ID NO.9.

[0014] Preferably, the genomic DNA in S2 is diluted to different concentrations in multiple ratios: the maximum concentration is 120 ng·μL -1 , and two-fold dilutions were performed in sequence, with a total of eight DNA concentration gradients set up; the standard curve established in S3 included the standard curve of the CPCNA interval of the natural de-astringency site of Chinese sweet persimmon and the reference gene.

[0015] Preferably, the genotype of the persimmon material to be tested is calculated in S4 using the following formula:

[0016] CPCNA relative allele dosage = relative DNA amount of CPCNA linkage marker / relative DNA amount of reference gene × 6;

[0017] Wherein, the relative DNA dosage of CPCNA-linked marker is: the Ct value obtained by real-time fluorescence quantitative PCR using CPCNA-specific primers and Taqman-specific probes at the natural astringency-removing site of Chinese sweet persimmon is substituted into the value calculated by the standard curve of CPCNA interval at the natural astringency-removing site of Chinese sweet persimmon;

[0018] The relative DNA dosage of the reference gene is: the Ct value obtained by real-time fluorescence quantitative PCR of the persimmon material to be tested using the reference gene specific primers and Taqman specific probe is substituted into the value calculated by the reference gene standard curve.

[0019] Preferably, when the CPCNA relative allele dose is less than 0.5, the genotype of the persimmon material to be tested is bbbbbb; when the CPCNA relative allele dose is greater than or equal to 0.5 and less than 1.5, the genotype of the persimmon material to be tested is Bbbbbb; when the CPCNA relative allele dose is greater than or equal to 1.5 and less than 2.5, the genotype of the persimmon material to be tested is BBbbbb, and so on. When the CPCNA relative allele dose is greater than or equal to 5.5 and less than 6.5, the genotype of the persimmon material to be tested is BBBBBB.

[0020] Preferably, the concentration of the genomic DNA of the persimmon material to be tested in S4 is 60ng·μL -1 The concentrations of CPCNA region of natural de-astringency site of Chinese sweet persimmon, reference gene-specific primers and Taqman specific probe were the same as those in S2.

[0021] Preferably, the system for real-time fluorescence quantitative PCR in S2 and S4 is: 5 μL Probe qPCR MixMultiPlus, 0.1 μL ROX Reference DyeⅡfor RR393, 0.2 μL each of 10 μM / L upstream primer and downstream primer, 0.25 μL 0.1 μM / L Probe, 1 μL genomic DNA template, and ddH2O supplemented to 10 μL.

[0022] Preferably, in S2 and S4, the genomic DNA is first denatured at 95°C for 10 minutes, and then mixed with the CPCNA region of the natural de-astringency site of Chinese sweet persimmon, reference gene-specific primers and Taqman specific probes, and the program for real-time fluorescence quantitative PCR is as follows: 25°C for 2 minutes, pre-denaturation at 95°C for 20 seconds as the first step, one cycle; 95°C for 1 second, 60°C for 20 seconds, as the second step, 40 cycles, and fluorescence signal detection is performed at the end of extension of each cycle in the second step; the genomic DNA includes the genomic DNA of the Chinese sweet persimmon standard sample and the genomic DNA of the persimmon material to be tested.

[0023] The invention relates to an application of the method for identifying Chinese sweet persimmon genotypes as described above in identifying Chinese sweet persimmon genotypes and breeding new completely sweet persimmon varieties.

[0024] Therefore, the present invention provides a method for identifying Chinese persimmon genotypes and its application, and its specific technical effects are as follows:

[0025] (1) The method for identifying Chinese persimmon genotypes provided by the present invention generates a fluorescent signal through a specific hydrolysis reaction between the probe and the target molecule, which has smaller errors, more accurate identification results, and higher result stability;

[0026] (2) The method for identifying Chinese persimmon genotypes provided by the present invention only requires two reference genomes, and the identification is easy to operate, which can significantly reduce the workload of Chinese persimmon genotype identification, consume less reagents and consumables, and lower the identification cost;

[0027] (3) The method for identifying Chinese persimmon genotypes provided by the present invention can significantly shorten the time required for identification and improve the identification efficiency. The identification of Chinese persimmon genotypes can provide a reference for the selection of hybrid parents. It can also be used for embryo rescue of young plants, green wood grafting and marker-assisted selection of hybrid combinations, significantly improving the PCNA breeding efficiency and having important significance for breeding new persimmon varieties with intellectual property rights and improving persimmon varieties.

[0028] The technical solution of the present invention is further described in detail below through the accompanying drawings and embodiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative labor.

[0030] Figure 1 The amplification results of real-time fluorescence quantitative PCR using different concentrations of genomic DNA of Chinese sweet persimmon 'Small Fruit Sweet Persimmon' as a template in Example 1 of the present invention are shown in Figure 1, wherein A is the amplification curve of different concentrations of standard samples using CPCNA-specific primers and corresponding Taqman probes; B is the amplification curve of different concentrations of standard samples using Act-specific primers and corresponding Taqman probes; C is the amplification curve of different concentrations of standard samples using L5R-specific primers and corresponding Taqman probes;

[0031] Figure 2 This is a standard curve diagram obtained in Example 1 of the present invention;

[0032] Figure 3 These are photos of persimmon fruits of seven sweet persimmon varieties whose genotypes were identified in Example 2 of the present invention. DETAILED DESCRIPTION

[0033] The technical solution of the present invention is further described below with reference to the accompanying drawings and embodiments.

[0034] In order to make the purpose, technical solutions and advantages of the present application clearer, more thorough and more complete, the technical solutions of the present invention are clearly and completely described below through the accompanying drawings and Examples. The following detailed description is an explanation of the embodiments and is intended to provide further details of the present invention. Unless otherwise specified, all technical terms used in the present invention have the same meaning as those generally understood by those skilled in the art to which the application belongs.

[0035] The instruments, equipment, reagents and materials used in the examples were obtained from commercial sources.

[0036] Example 1

[0037] This example uses the Chinese sweet persimmon 'Small Fruit Sweet Persimmon' as a standard sample to establish a method for identifying the genotype of Chinese sweet persimmon. The genome of the 'Small Fruit Sweet Persimmon' has one CPCNA allele, and its genotype is recorded as Bbbbbb. The method specifically includes the following steps:

[0038] (1) The genomic DNA of young leaves of Chinese sweet persimmon 'Small Fruit Sweet Persimmon' was extracted using the modified CTAB method. The specific procedures are as follows:

[0039] ① Weigh 50 mg of young leaves of 'Small Fruit Sweet Persimmon', grind them into powder with liquid nitrogen, and transfer them to a 2 mL centrifuge tube.

[0040] ② Prepare the extract immediately for use, and prepare Liquid A and Liquid B.

[0041] 100mL of solution A contains 10mL of 1mol·L -1 Tris-HCl (PH=8.0), 1mL 0.5mol·L -1 EDTA-Na2, 5mL 5mol·L -1 NaCl, 2 g of pvp-4.0 powder, and finally 84 mL of ultrapure water.

[0042] 100mL of solution B contains 10mL of 1mol·L -1 Tris-HCl (PH=8.0), 10mL 0.5mol·L -1 EDTA-Na2, 30mL 5mol·L -1 NaCl, 2 g of CTAB solid powder, 1 g of pvp-4.0 powder, and finally 50 mL of ultrapure water.

[0043] ③ Add 1 mL of solution A, place on ice for 15 minutes, invert 2-3 times, centrifuge at 12000 g for 10 minutes, and discard the supernatant; add 1 mL of solution A again and repeat this step.

[0044] ④ Preheat solution B in a water bath at 65℃, boil it in a microwave oven, add mercaptoethanol to solution B at a ratio of 1:50, mix well, add 700μL of the mixture of solution B and mercaptoethanol to the centrifuge tube in ③, shake well, and place in a 65℃ water bath for 1 hour, shake well every 15 minutes, and centrifuge at 12000g for 10 minutes.

[0045] ⑤ Transfer the supernatant to a new 2 mL centrifuge tube, add 600 μL of a mixture of chloroform and isoamyl alcohol (volume ratio of 24:1) in a fume hood, mix by inversion for 10 minutes, and centrifuge at 12,000 g for 10 minutes; take a new 2 mL centrifuge tube, aspirate the supernatant of the upper layer (upper, middle, and lower layers), add a mixture of chloroform and isoamyl alcohol (volume ratio of 24:1), and repeat this step.

[0046] ⑥ Pipette the supernatant into a new 1.5mL centrifuge tube, add 500μL isopropanol (pre-cooled at -20℃ 30min in advance), shake well, and precipitate at -20℃ for 1-2h until the precipitate no longer increases. Centrifuge at 11000g for 5min, discard the supernatant, and a transparent white precipitate can be seen at the bottom of the tube. Add 500mL 75% ethanol, shake gently to mix, centrifuge at 11000g for 5min, discard the supernatant, centrifuge for 5-10s, and air-dry in a fume hood.

[0047] ⑦ Add 100 μL of sterile ultrapure water, and the liquid in the centrifuge tube after the precipitate is dissolved is the obtained persimmon genomic DNA. Use 1.0% agarose gel and UV spectrophotometer to detect the quality and concentration of the sample. After the sample passes the test, store it in a -20℃ refrigerator for future use.

[0048] (2) Specific primers for the CPCNA region of the natural astringency removal site of Chinese sweet persimmon were designed. The upstream primer sequence is shown in SEQ ID NO. 1, and the downstream primer sequence is shown in SEQ ID NO. 2. A Taqman specific probe for the CPCNA region of the natural astringency removal site of Chinese sweet persimmon was designed. The sequence of the Taqman specific probe is shown in SEQ ID NO. 3.

[0049] SEQ ID NO.1:CCCTAAACTCCGATATCCTTCTTC

[0050] SEQ ID NO.2:CGAGCTTACCGGCACATTA

[0051] SEQ ID NO.3:FAM-CTTCGCGACTTCCACCTCGCCC-BHQ1

[0052] Specific primers for the DkAct gene were designed, with the upstream primer sequence shown in SEQ ID NO. 4 and the downstream primer sequence shown in SEQ ID NO. 5. Taqman specific probes for the DkAct gene were designed, with the Taqman specific probe sequence shown in SEQ ID NO. 6.

[0053] SEQ ID NO.4:ATGCTCCAAGGGCAGTTT

[0054] SEQ ID NO.5:GGGCCTCATCACCACATAA

[0055] SEQ ID NO.6:FAM-TAGGCACACAGGTGTTATGGTTGGG-BHQ1

[0056] Specific primers for the L5R gene were designed, with the upstream primer sequence shown in SEQ ID NO. 7 and the downstream primer sequence shown in SEQ ID NO. 8. A Taqman specific probe for the L5R gene was designed, with the Taqman specific probe sequence shown in SEQ ID NO. 9.

[0057] SEQ ID NO.7:TTCTTCGCGTCTCTGGAAC

[0058] SEQ ID NO.8:TGGTTTCCGTCGTTGAAGAT

[0059] SEQ ID NO.9:FAM-CTCTTGCATCCGCATAGCCACTCA-BHQ1

[0060] (3) The genomic DNA solution of the Chinese sweet persimmon 'Small Fruit Sweet Persimmon' obtained in step (1) was diluted to a maximum DNA dilution concentration of about 120 ng·μL -1 , and two-fold dilutions were performed in sequence, setting up a total of eight DNA concentration gradients.

[0061] Real-time fluorescence quantitative PCR was performed using specific primers and Taqman specific probes for the CPCNA region of the natural deastringency site, the DkAct gene, and the L5R gene. The reaction systems for fluorescence quantitative PCR were all shown in Table 1. The DNA template was the concentration gradient dilution solution obtained above. Before preparing the reaction system shown in Table 1, the genomic DNA solution was denatured at 95°C for 10 minutes. The amplification program for fluorescence quantitative PCR was: 25°C for 2 minutes, pre-denaturation at 95°C for 20 seconds as the first step, one cycle; 95°C for 1 second, 60°C for 20 seconds as the second step, 40 cycles. Fluorescence signal detection was performed at the end of each extension cycle in the second step. The results are shown in the figure. Figure 1 shown.

[0062] Table 1

[0063]

[0064]

[0065] (4) The obtained amplification cycle (Ct) value data were analyzed to construct an independent standard curve for the Bbbbbb gene of the 'Small Fruit Sweet Persimmon'. In the analysis, Ct was automatically determined by ABIQuantStudio 7 as the default state. Four replicates of each sample were analyzed for each measurement, and the Ct value of each sample was the average Ct value of the four replicates. The obtained standard curve is shown in Figure 2. Figure 2 As shown, they all have a good linear relationship. The equation of the standard curve based on the CPCNA interval of the natural de-astringency site of Chinese sweet persimmon is: y=-3.3367x+33.839, R 2 =0.9916, the equation of the standard curve based on the DkAct gene is: y=-3.4154x+31.857, R 2 =0.9969, the equation of the standard curve based on the L5R gene is: y=-3.4717x+32.971, R 2 =0.9984.

[0066] (5) The method for extracting genomic DNA from the persimmon material to be tested is the same as step (1). The quality and concentration of the sample are detected using 1.0% agarose gel and UV spectrophotometer. The qualified DNA solution is diluted to 60 ng·μL -1 , using the same specific primers and Taqman specific probe as in step (2), and the same reaction system, amplification procedure, and method as in step (3), real-time fluorescence quantitative PCR was performed to obtain the Ct value of the persimmon material to be tested. The obtained Ct value was substituted into the corresponding standard curve equation as the x value, and the calculated y values ​​were the relative DNA amount of the CPCNA linkage marker, the relative DNA amount of the DkAct gene, and the relative DNA amount of the L5R gene, respectively. Then, the genotype of the Chinese sweet persimmon to be tested was calculated using the following formula:

[0067] CPCNA relative allele dosage = relative DNA amount of CPCNA linkage marker / relative DNA amount of reference gene × 6.

[0068] According to the CPCNA relative allele dosage of the persimmon material to be tested, the genotype of the persimmon material to be tested can be confirmed. Specifically, when the CPCNA relative allele dosage is less than 0.5, the genotype of the persimmon material to be tested is bbbbbb; when the CPCNA relative allele dosage is greater than or equal to 0.5 and less than 1.5, the genotype of the persimmon material to be tested is Bbbbbb; when the CPCNA relative allele dosage is greater than or equal to 1.5 and less than 2.5, the genotype of the persimmon material to be tested is BBbbbb, and so on. When the CPCNA relative allele dosage is greater than or equal to 5.5 and less than 6.5, the genotype of the persimmon material to be tested is BBBBBB.

[0069] Example 2

[0070] The method for identifying the genotype of Chinese sweet persimmon established in Example 1 was used to identify the genotypes of 16 Diospyros materials. Since some hybrid offspring had not yet borne fruit, the offspring of the male plant material did not bear fruit. The fruit photos of 7 Diospyros varieties were as follows: Figure 3 The variety names are shown in Table 2.

[0071] The identification results using the method described in Example 1 are shown in Table 2.

[0072] Table 2

[0073]

[0074] Note: H8-2 is the offspring of "Huashi No. 1 × Male Plant No. 8"; H13-1 is the offspring of "Eshi No. 1 × Taiqiu"; H19-3 and H19-5 are the offspring of "Small Fruit Sweet Persimmon × Male Plant No. 2"; H20-3, H20-13 and H20-19 are the offspring of "Small Fruit Sweet Persimmon × Male Plant No. 8"

[0075] The identification results for the 12 samples in Table 2 are completely consistent with the marker identification results of You et al. (2024). However, due to the large error in the fluorescent dye method used in You et al. (2024), the genotypes of four samples ('Bao Gai Shi', '90-1-15', 'H8-2', and 'H13-1') could not be accurately identified. The number of CPCNA genes fluctuated due to this error. The identification results of these four samples disclosed by You et al. (2024) were Bbbbbb or BBbbbb, indicating that they may contain one or two CPCNA genes. The identification method provided by the present invention greatly reduced the experimental error to as low as 0.01, allowing accurate and stable genotyping of these four samples. The present invention accurately identified the genotypes of 'Bao Gai Shi', '90-1-15', 'H8-2', and 'H13-1' as Bbbbbb. These results demonstrate that the identification method provided by the present invention has greater stability and accuracy.

[0076] Therefore, the method for identifying the genotype of Chinese persimmon provided by the present invention generates a fluorescent signal through a specific hydrolysis reaction between the probe and the target molecule, with smaller errors, more accurate identification results, and higher result stability; only two reference genomes are required, and the identification is easy to operate, which can greatly reduce the workload of Chinese persimmon genotype identification, consume less reagents and consumables, and lower the identification cost; in addition, the PCR procedure of the present invention is shorter (about 45 minutes) than the procedure reported by You et al. (2024) (about 1 hour 45 minutes), which can significantly improve the identification efficiency. The identification of Chinese persimmon genotypes can provide a reference for the selection of hybrid parents, and can also be used for embryo rescue of young plants, green wood grafting, and marker-assisted selection of hybrid combinations, greatly improving the PCNA breeding efficiency, which is of great significance for the breeding of new persimmon varieties with intellectual property rights and the improvement of persimmon varieties.

[0077] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit the same. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that they can still modify or replace the technical solutions of the present invention with equivalents, and these modifications or equivalent replacements cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A method for identifying Chinese persimmon genotypes, characterized in that: The following steps are involved: S1. Extract genomic DNA of Chinese sweet persimmon standard samples and analyze the natural astringency sites of Chinese sweet persimmon. CPCNA Design specific primers and Taqman specific probes based on the interval and reference gene sequences, and send the specific primers and Taqman specific probe sequence information to the company for synthesis; S2. The genomic DNA of the obtained Chinese sweet persimmon standard sample was diluted into different concentrations, and then compared with the natural de-astringency site of Chinese sweet persimmon. CPCNA The interval and reference gene specific primers and Taqman specific probes were mixed to perform real-time fluorescence quantitative PCR reaction and obtain the Ct values ​​at different DNA concentrations; S3. Establish a standard curve using the obtained Ct values ​​of the Chinese sweet persimmon standard samples at different DNA concentrations, different specific primers, and Taqman specific probes; S4. Extract the genomic DNA of the persimmon material to be tested, dilute it to a certain concentration, and compare it with the natural astringency removal site of Chinese sweet persimmon. CPCNA After mixing the interval and reference gene specific primers and Taqman specific probes, a real-time fluorescence quantitative PCR reaction is performed to obtain the Ct values ​​under different specific primers and Taqman specific probes. The obtained Ct values ​​are respectively substituted into the standard curve established in S3 to calculate the genotype of the persimmon material to be tested; The Chinese sweet persimmon standard sample in S1 is 'small-fruit sweet persimmon', and the reference gene is DkAct 、 L5R ; Natural de-astringency site of Chinese sweet persimmon CPCNA The upstream primer sequence of the interval-specific primer is shown in SEQ ID NO.1, the downstream primer sequence is shown in SEQ ID NO.2, and the sequence of the Taqman specific probe is shown in SEQ ID NO.3; DkAct The upstream primer sequence of the gene-specific primer is shown in SEQ ID NO.4, the downstream primer sequence is shown in SEQ ID NO.5, and the Taqman specific probe sequence is shown in SEQ ID NO.6; L5R The upstream sequence of the gene-specific primer is shown in SEQ ID NO.7, the downstream primer sequence is shown in SEQ ID NO.8, and the Taqman specific probe sequence is shown in SEQ ID NO.9; In S4, the genotype of the persimmon material to be tested is calculated using the following formula: CPCNA Relative allele dosage = CPCNA Relative DNA amount of linked marker / relative DNA amount of reference gene × 6; Where, CPCNA The relative DNA dosage of the linked marker is as follows: the persimmon material to be tested is the natural astringency-free site of Chinese sweet persimmon. CPCNA The Ct value obtained by real-time fluorescence quantitative PCR using specific primers and Taqman specific probes was substituted into the natural astringency removal site of Chinese sweet persimmon. CPCNA The value calculated from the interval standard curve; The relative DNA dosage of the reference gene is calculated by substituting the Ct value obtained by real-time fluorescence quantitative PCR of the persimmon material to be tested using the reference gene specific primers and Taqman specific probe into the value calculated by the reference gene standard curve; when CPCNA When the relative allele dosage is less than 0.5, the genotype of the persimmon material to be tested is bbbbbb; CPCNA When the relative allele dosage is greater than or equal to 0.5 and less than 1.5, the genotype of the persimmon material to be tested is Bbbbbb; when CPCNA When the relative allele dosage is greater than or equal to 1.5 and less than 2.5, the genotype of the persimmon material to be tested is BBbbbb, and so on. CPCNA When the relative allele dosage is greater than or equal to 5.5 and less than 6.5, the genotype of the persimmon material to be tested is BBBBBB.

2. The method for identifying Chinese persimmon genotypes according to claim 1, wherein: The system for real-time fluorescence quantitative PCR in S2 and S4 is as follows: 5 μL Probe qPCR Mix MultiPlus, 0.1 μL ROX ReferenceDye II, 0.2 μL each of 10 μM / L upstream primer and downstream primer, 0.25 μL 0.1 μM / L probe, 1 μL genomic DNA template, and ddH2O to 10 μL; In the above S2 and S4, the genomic DNA was first denatured at 95°C for 10 min, and then the genomic DNA was mixed with the natural astringency removal site of Chinese sweet persimmon. CPCNA The interval and reference gene specific primers and Taqman specific probes are mixed, and the program for real-time fluorescence quantitative PCR is as follows: 25°C for 2 minutes, 95°C pre-denaturation for 20 seconds as the first step, one cycle; 95°C for 1 second, 60°C for 20 seconds, as the second step, 40 cycles, and fluorescence signal detection is performed at the end of extension of each cycle in the second step; the genomic DNA includes the genomic DNA of the Chinese sweet persimmon standard sample and the genomic DNA of the persimmon material to be tested.

3. The method for identifying Chinese persimmon genotypes according to claim 1, wherein: The genomic DNA in S2 was diluted to different concentrations: the maximum concentration was 120 ng·μL -1 , and two-fold dilution was performed in sequence, with a total of eight DNA concentration gradients set up; the standard curve established in S3 includes the natural de-astringency site of Chinese sweet persimmon CPCNA Standard curves for interval and reference genes.

4. The method for identifying Chinese persimmon genotypes according to claim 1, wherein: The concentration of the genomic DNA of the persimmon material to be tested in S4 is 60ng·μL -1 , the natural astringency removal site of Chinese sweet persimmon CPCNA The concentrations of the interval- and reference gene-specific primers and Taqman-specific probes were the same as those in S2.

5. Use of the method for identifying Chinese persimmon genotypes according to any one of claims 1 to 4 in identifying Chinese persimmon genotypes.

Images