A hybridoma cell line and monoclonal antibody against bovine parainfluenza virus type 3 NP protein and its application in antigen detection

Abstract

The present invention provides a bovine parainfluenza virus type 3 NP protein hybridoma cell line and a monoclonal antibody and the application thereof in detecting antigens, and belongs to the field of immunoassay technology. The present invention provides a bovine parainfluenza virus type 3 NP protein hybridoma cell BPIV3Mab‑NP‑11 strain, which has completed biological preservation and the preservation number is CGMCC No.45943. The present invention also provides a monoclonal antibody using the hybridoma cell BPIV3Mab‑NP‑11 strain, and an indirect immunofluorescence kit for detecting BPIV3 is prepared from the monoclonal antibody and a fluorescently labeled secondary antibody. The monoclonal antibody of the present invention can recognize strains of all genotypes of BPIV3 without cross-reacting with viruses such as bovine viral diarrhea / mucosal disease virus (BVDV), has good specificity, and can be used not only for exogenous virus detection of BPIV3 in live viral vaccines for cattle (cell inspection method), but also for clinical detection and epidemiological surveys of BPIV3.

Description

Technical Field

[0001] The invention relates to the technical field of immune detection, and in particular to a bovine parainfluenza virus type 3 NP protein hybridoma cell line and a monoclonal antibody and applications in detecting antigens. Background Art

[0002] Bovine parainfluenza virus type 3 (BPIV3) is one of the important pathogens that cause acute respiratory tract infection in calves. Infection often leads to a series of clinical symptoms including fever, cough, runny nose, and decreased spirit and appetite. It can also cause tissue damage and immunosuppression, leading to decreased productivity and increased mortality, causing serious harm and great economic losses to the cattle industry. The virus can infect a variety of mammals including yaks, pigs, camels, dolphins and sheep, and is currently prevalent worldwide.

[0003] BPIV3 is an enveloped single-stranded RNA virus belonging to the Paramyxoviridae family with only one serotype. There are many studies on BPIV3 detection methods, from etiological methods to immunological methods to molecular biological detection methods, and the sensitivity of the detection methods varies. In particular, the existing detection methods have shortcomings. Hematocrit and hematocrit adsorption must be detected by collecting guinea pig and chicken red blood cells, which is laborious and costly. Contamination of BPIV3 in vaccines is a potential risk for the spread and epidemic of BPIV3 diseases. Therefore, it is urgent to establish a stable and efficient method for detecting BPIV3 for quality inspection of cattle biological products and diagnosis of BPIV3 diseases. Summary of the invention

[0004] The invention provides a bovine parainfluenza virus type 3 NP protein hybridoma cell line and a monoclonal antibody and use thereof in detecting antigens, which are convenient and efficient, highly operable, and have high specificity and sensitivity.

[0005] The invention provides a bovine parainfluenza virus type 3 NP protein hybridoma cell BPIV3 Mab-NP-11 strain, with a deposit number of CGMCC No.45943.

[0006] The present invention provides a method for preparing the hybridoma cell BPIV3 Mab-NP-11 strain, comprising the following steps: (1) the coding gene of the bovine parainfluenza virus type 3 NP protein is codon-optimized and cloned into a prokaryotic expression vector, transformed into Escherichia coli and induced for expression, and the expression product is separated and purified to obtain an immunogen;

[0007] (2) Immunizing mice with the immunogen described in step (1), and screening out positive monoclonal cell lines that are specific to bovine parainfluenza virus type 3 NP protein based on the monoclonal antibody titer, thereby obtaining the hybridoma cell line BPIV3Mab-NP-11.

[0008] Preferably, the bovine parainfluenza virus type 3 NP protein in step (1) is selected from bovine parainfluenza virus type 3 P06161 strain.

[0009] Preferably, after codon optimization, the nucleotide sequence of the gene encoding the NP protein of the bovine parainfluenza virus type 3 P06161 strain is as shown in SEQ ID No. 1.

[0010] The present invention also provides a monoclonal antibody produced by the hybridoma cell BPIV3 Mab-NP-11 strain.

[0011] The present invention also provides the use of the monoclonal antibody in preparing a reagent for detecting bovine parainfluenza virus type 3.

[0012] The present invention also provides an indirect immunofluorescence kit for detecting bovine parainfluenza virus type 3, comprising the above monoclonal antibody and a secondary antibody labeled with fluorescein.

[0013] Preferably, the fluorescein-labeled secondary antibody comprises a FITC-labeled goat anti-mouse IgG antibody.

[0014] Preferably, the indirect immunofluorescence kit further comprises a sample diluent and a washing solution, and both the sample diluent and the washing solution are PBS buffer.

[0015] Preferably, whether it is bovine parainfluenza virus type 3 virus is determined based on fluorescence, and when the fluorescent color of the secondary antibody labeling appears, it indicates a positive result.

[0016] Beneficial effects: The present invention provides a bovine parainfluenza virus type 3 NP protein hybridoma cell BPIV3Mab-NP-11 strain, which has completed biological preservation and has a preservation number of CGMCC No. 45943. The present invention also provides a monoclonal antibody using the hybridoma cell BPIV3 Mab-NP-11 strain, and an indirect immunofluorescence kit for detecting BPIV3 is prepared from the monoclonal antibody and a fluorescently labeled secondary antibody.

[0017] The monoclonal antibody of the present invention can recognize strains of all genotypes of BPIV3 without cross-reacting with viruses such as bovine viral diarrhea / mucosal disease virus (BVDV). The kit of the present invention has good specificity. The kit can be used not only for the detection of exogenous viruses of BPIV3 in live viral vaccines for cattle (cell detection method), but also for clinical detection and epidemiological investigation of BPIV3.

[0018] Biological Deposit Description

[0019] The hybridoma cell line BPIV3 Mab-NP-11 was deposited in the General Microbiology Center of the China Culture Collection Administration (CGMCC) on June 14, 2024. The specific deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, and the deposit number is CGMCC No. 45943. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is a protein expression diagram; M in the figure: Marker; 1: BSA; 2: before induction; 3: supernatant after induction; 4: precipitate after induction;

[0021] Figure 2 This is a protein purification diagram, where M: Marker; 1: BSA; 2, 3: purified proteins;

[0022] Figure 3 This is a graph of the detection results of the indirect immunofluorescence kit of the present invention, in which A is infected with BPIV3 (GSY01 strain); B is infected with BVDV (Oregon strain); C is infected with IBRV (BartaNu / 67 strain); and D is infected with BRV (NCDV strain). DETAILED DESCRIPTION

[0023] The invention provides a bovine parainfluenza virus type 3 NP protein hybridoma cell BPIV3 Mab-NP-11 strain, with a deposit number of CGMCC No.45943.

[0024] The present invention preferably compares the reference sequences of different strains of BPIV3, selects the conserved sequence NP protein therein for antigenic epitope analysis, and at the same time selects a 435 bp NP protein as the immunogen based on the NP sequence of BPIV3 P06161 strain according to the secondary structure of the protein sequence, hydrophilicity, antigenicity and other factors. After codon optimization, it is cloned into a prokaryotic expression vector, and then transformed and induced for expression. After purification, it is used as the immunogen for the preparation of BPIV3 monoclonal antibodies.

[0025] The codon-optimized NP sequence of the present invention is preferably as SEQ ID No.1 shows: GAGAATATAACAAAATCAGCTGGGTGGGGCCGTTATCCCCGGGCAAAAAAATACTGTATCTATATTTTGCTCTTGGTCCATCAATAACAGATGACAACGACAAAATGACATTGGCTCTTCTCTTTTTGTCTCATTCTTTAGACAACGAAAAACAGCATGCACAAAGAGCCGGATTTCTAGTTTCTCTGTTATCAATGGCCTATGCCAACCCAGAAT TATATTTAACATCAAACGGTAGTAATGCAGATGTTAAATATGTCATTTATATGATAGAAAAGGACCCAGGAAGACAAAAGTATGGTGGGCTCGTAGTTAAGACCAGAGAGATGGTTTATGAAAAGACAACTGACTGGATGTTCGGGAGTGATCTTGAGTATGATCAAGACAATATGTTGCAAAATGGCAGAAGTACTTCTACAATCGAGGATCTTGTTCAT. The present invention preferably clones the sequence shown in SEQ ID No.1 into the pET-32a prokaryotic expression vector, fuses 6×His and Trx tags, and transforms into the BL21 strain for induced expression. The protein concentration of the purified expression product is >0.5 mg / mL and the purity is >85%, which is used as an immunogen for the preparation of BPIV3 monoclonal antibodies. The present invention adds EcoRⅠ and Xho I restriction sites at the 5' and 3' ends of the sequence shown in SEQ ID No.1 for vector cloning.

[0026] The present invention provides a method for preparing the hybridoma cell BPIV3 Mab-NP-11 strain, comprising the following steps: (1) the coding gene of the bovine parainfluenza virus type 3 NP protein is codon-optimized and cloned into a prokaryotic expression vector, transformed into Escherichia coli and induced for expression, and the expression product is separated and purified to obtain an immunogen;

[0027] (2) Immunizing mice with the immunogen described in step (1), and screening out positive monoclonal cell lines that are specific to bovine parainfluenza virus type 3 NP protein based on the monoclonal antibody titer, thereby obtaining the hybridoma cell line BPIV3Mab-NP-11.

[0028] The preparation method of the present invention is preferably the same as the above content, which is not repeated here. The immunization of the present invention preferably includes a primary immunization and three booster immunizations, specifically comprising: immunizing Balb / c mice with the immunogen protein, 60 μg / mouse, boosting immunization three times after the primary immunization, each booster immunization dose is 30 μg / mouse, the immunization interval is 14 days, and after three booster immunizations, the plate is coated with the immunogen protein, and the monoclonal antibody titer is detected by ELISA.

[0029] The present invention also provides a monoclonal antibody produced by the hybridoma cell BPIV3 Mab-NP-11 strain.

[0030] The monoclonal antibody described in the present invention is preferably produced using the above-mentioned hybridoma cells. Specifically, mice with high titers are selected for fusion, and the plates are coated with immunogenic proteins. ELISA is used to screen out positive monoclonal cell lines that only target the target protein, and ascites is prepared. Protein-A affinity purification is used to obtain BPIV3 monoclonal antibodies.

[0031] The present invention also provides the use of the monoclonal antibody in preparing a reagent for detecting bovine parainfluenza virus type 3.

[0032] The monoclonal antibody described in the present invention can recognize strains of all genotypes of BPIV3 without cross-reacting with viruses such as bovine viral diarrhea / mucosal disease virus (BVDV), and can be used for the specific detection of BPIV3, such as the detection of exogenous viruses of BPIV3 in live viral vaccines for cattle, and can also be used for clinical detection and epidemiological surveys of BPIV3.

[0033] The present invention also provides an indirect immunofluorescence kit for detecting bovine parainfluenza virus type 3, comprising the above monoclonal antibody and a secondary antibody labeled with fluorescein.

[0034] The fluorescein-labeled secondary antibody of the present invention preferably includes FITC-labeled goat anti-mouse IgG antibody. The indirect immunofluorescence kit of the present invention preferably also includes a sample diluent and a washing solution, and the sample diluent and the washing solution are preferably both PBS buffer with a working concentration of 10 mM and a pH value of 7.2.

[0035] When the kit is used for antigen detection, the present invention preferably includes inoculating the sample to be tested into MDBK cells, fixing it with 80% cold acetone for 20 minutes after a period of time, discarding the acetone, naturally air-drying for 30 minutes to volatilize the acetone, washing it with PBS once, adding diluted anti-BPIV3 monoclonal antibody, reacting at 37°C for 1 hour; after washing with PBS 5 times, adding diluted FITC-labeled goat anti-mouse IgG antibody, reacting at 37°C for 1 hour; after washing with PBS 3 times, observing under an inverted fluorescence microscope. If bright green specific fluorescence appears in the cell, the sample is judged as positive; otherwise, it is judged as negative.

[0036] To further illustrate the present invention, a bovine parainfluenza virus type 3 NP protein hybridoma cell line and monoclonal antibody provided by the present invention and their application in antigen detection are described in detail below in conjunction with the examples, but they should not be construed as limiting the scope of protection of the present invention.

[0037] Example 1

[0038] BPIV3 NP protein sequence analysis

[0039] Different BPIV3 strains have only one serotype. The reference sequences of different BPIV3 strains were downloaded from NCBI (Genbank numbers are MH552577, AB770484.1, AB770485.1, AF178654.1, AF178655.1, EU277658.1, HQ530153.1, JQ063064.1, JX969001.1). Through analysis, it was found that NP protein has high homology in different strains. DNAStar software was used to analyze the secondary structure, hydrophilicity, antigenicity and functional regions of NP protein. The results showed that NP protein is highly conserved, with very low antigenic differences, and can be used as an alternative fragment for expressing protein. According to the secondary structure analysis of protein sequence, hydrophilicity, antigenicity, etc., based on the NP sequence of BPIV3910N strain (Genbank accession number P06161.1), a nucleotide fragment (435 bp) of NP protein was selected for sequence synthesis (SEQ ID No. 1) after codon optimization, and EcoRⅠ and Xho I restriction sites were added at the 5' and 3' ends for vector cloning. Sequence synthesis was carried out at Beijing Liuhe BGI Protein Research and Development Center Co., Ltd.

[0040] Example 2

[0041] Construction and purification of recombinant expression plasmid

[0042] 1. Construction of recombinant expression plasmid

[0043] The synthesized sequence and plasmid pET-32a were double-digested with restriction endonucleases EcoRⅠ and Xho I, respectively. The purified and recovered fragments and the digestion products of the expression vector were connected with DNA Ligation Kit and transformed into competent cells (BL21).

[0044] 2. Expression of Recombinant Protein

[0045] The clones identified as positive by PCR were picked and placed in 1.5 mL of LB liquid medium containing the corresponding resistance, and cultured at 37°C, 200 r / min until OD 600=0.6-0.8, IPTG (0.5 mM) induction, 37 ° C, 200 r / min culture for 2 h, the cultured bacterial solution was transferred to 250 mL of the corresponding resistance LB liquid medium at a ratio of 1:50, 37 ° C shaking, 200 r / min, and cultured until OD 600 =0.6~0.8, IPTG (0.5mM) induced at 37℃ for 3h; harvest bacteria: 8000r / min, centrifuge for 6min. Discard supernatant; ultrasonic disruption: blow away the bacteria with 30ml 10mMTris-HCl (pH 8.0) solution, ultrasonic disruption (500W, 180 times, 5s each time, 5s interval); electrophoresis to determine the expression form: take 100μL of the bacterial suspension after ultrasound, 12000r / min, centrifuge for 10min, take 50μL of supernatant to another EP tube, discard the supernatant and blow away the precipitate with 50μL10 mM Tris-HCl (pH 8.0) solution.

[0046] The supernatant and precipitate were taken for SDS-PAGE detection. Figure 1 As shown, a large amount of target protein was detected in the precipitate, indicating that the expression form of the recombinant bacteria was inclusion body expression.

[0047] The expressed protein was purified as follows: resuspend the precipitate obtained by ultrasonic centrifugation with 20-30 ml 10mM Tris-HCl (pH8.0) solution, let it stand for 10 minutes; centrifuge at 12000 r / min for 10 minutes, transfer the supernatant to another tube for storage; resuspend the precipitate with 20-30 ml 10mM Tris-HCl (pH8.0) solution, let it stand for 10 minutes; centrifuge at 12000 r / min for 10 minutes, and discard the supernatant. Repeat the above resuspension and centrifugation steps once; first add a small amount of 10mM Tris-HCl (pH8.0) solution to resuspend the precipitate, then add 5-10 mL of 10mMTris-HCl (pH8.0) solution containing 8M urea to dissolve the protein, centrifuge at 12000 r / min for 10 minutes, collect the supernatant, and take 50μL sample for SDS-PAGE electrophoresis detection ( Figure 2 ). Using BSA as the standard, the purified protein concentration was estimated to be >0.5 mg / mL and the purity was >85% by SDS-PAGE gel scanning analysis, and was named BPIV3-NP.

[0048] Example 3

[0049] Preparation of monoclonal antibodies

[0050] 1. Immunization of Mice

[0051] After emulsifying the purified protein of BPIV3-NP with Freund's complete adjuvant in a ratio of 1:1, 4 SPF BALB / c female mice were subcutaneously injected with 60 μg protein / mouse (primary immunization). Subcutaneous booster injections were performed 2 weeks, 4 weeks, and 6 weeks after the initial immunization, with an immunization dose of 30 μg / mouse. Ten days after the third booster immunization, blood was collected from the eye sockets and the serum titer was measured by indirect ELISA. Mice with high serum titers were selected and immunized once with 50 μg of the immunogen by intraperitoneal injection. Cell fusion was performed 3 days after immunization.

[0052] 2. Cell fusion assay

[0053] The spleen of the immunized mouse was aseptically obtained to prepare a spleen cell suspension. The immune spleen cells and SP2 / 0 cells were fused using the conventional 50% PEG method. The fused cells were placed in 5 96-well plates and selectively cultured with HAT culture medium (purchased from Sigma).

[0054] 3. Cloning and screening of hybridoma cells

[0055] The culture in the above 96-well plate was screened by ELISA plate coated with BPIV3-NP protein and tag protein. The screening method is as follows:

[0056] (1) Coat the ELISA plate with purified BPIV3-NP protein diluted with sodium carbonate-sodium bicarbonate buffer at pH 9.6 to a final concentration of 2 μg / mL, 100 μL / well, at 4°C, overnight; then wash three times with PBST (PBS containing 0.05% Tween).

[0057] (2) Blocking The cells were blocked with PBS containing 2% milk, 200 μL / well, incubated at 37°C for 2 h, and then washed three times with PBST (PBS containing 0.05% Tween).

[0058] (3) Incubation of primary antibody: Hybridoma cell culture supernatant, negative control (SP2 / 0 culture supernatant), blank control (PBS), and positive control (positive serum diluted 1000 times with PBS) were added as primary antibody, all at 100 μL / well, incubated at 37°C for 1 h.

[0059] (4) Washing Wash three times with PBST (PBS containing 0.05% Tween).

[0060] (5) Incubation with secondary antibody: Add goat anti-mouse IgG / HRP diluted 20,000-fold with PBS as the secondary antibody, 100 μL / well, incubate at 37°C for 1 h.

[0061] (6) Washing Wash three times with PBST (PBS containing 0.05% Tween).

[0062] (7) Color Development: Add 100 μL / well of color development solution (citrate buffer containing 1% solution A and 10% solution B, solution A: 1% TMB in DMSO; solution B: 0.1% H2O2) and color development time is about 5 min.

[0063] (8) Add 50 μL of stop solution (containing 2 M sulfuric acid) to each well to stop the reaction.

[0064] (9) Read the absorbance at dual wavelengths (450 and 630 nm) and record the data.

[0065] After testing, three ELISA-positive hybridoma cell lines, 11#, 14#, and 38#, were selected for further screening. The test results are shown in Table 1:

[0066] Table 1 ELISA screening results of hybridoma cell lines

[0067]

[0068] 4. Indirect Immunofluorescence Detection

[0069] The supernatants of the three positive hybridoma cell lines (No. 11, 14 and 38) obtained by ELISA screening were used as primary antibodies, and a cell line with good reactivity to the BPIV3 whole virus was screened by indirect immunofluorescence. This cell line was named BPIV3 NP protein hybridoma cell BPIV3 Mab-NP-11. Cell lines that were positive in immunofluorescence detection were selected and subcloned by limiting dilution method until the cell clone antibody positivity rate reached 100%. The positive cell lines with a positivity rate of 100% after subcloning were expanded and cultured and stored in liquid nitrogen. The indirect immunofluorescence detection method is as follows:

[0070] Preparation of positive virus plate: BPIV3 was diluted to 100 TCID in MEM medium containing 2% fetal bovine serum. 50 / 0.1ml, inoculate the sample to be tested with MDBK cells / MA104 cells, 100μL / well, and set up a blank control. After a period of time, fix it with 80% cold acetone for 20 minutes and perform fluorescent staining. The virus strain BPIV-3GSY01 shown in Table 2 was isolated and identified by Jinyu Baoling Biological Pharmaceutical Co., Ltd. and was published in the article (Liu Guoying. Preliminary study on culturing BPIV-3 with MDBK suspension cells. Experimental research. Issue 4, 2021); the remaining strains are from the Veterinary Microbiology Center of the China Microbiological Culture Collection Administration (please see the China Veterinary Drug Supervision Institute, the Veterinary Microbiology Center of the China Microbiological Culture Collection Administration, China Veterinary Species Catalog, China Agricultural Science and Technology Press, pages 139, 136 and 144).

[0071] Table 2 Information of BPIV3 and control strains

[0072]

[0073] (2) Dyeing

[0074] 1) Fix and discard the cell culture medium in the 96-well plate, add about 250 μL PBS to each well, gently wash the cell surface once, discard the PBS as much as possible, then add 100 μL 80% cold acetone to each well, set aside for 20 minutes, discard the acetone, and air-dry for 30 minutes.

[0075] 2) Add primary antibody (monoclonal antibody) and wash the cell surface once with PBS (pH 7.2). Dilute the supernatant of the monoclonal cell line to be tested 10 times with PBS and add it to the positive virus plate (washed once with PBS before use), 50 μL per well, and incubate at 37°C in the dark for 1 hour.

[0076] 3) Wash and discard the monoclonal antibody in the wells, wash 5 times with PBS, add 0.3 mL of washing solution to each well each time, and wash with slight shaking.

[0077] 4) For fluorescent secondary antibody staining, discard the washing solution as much as possible, add 50 μL of fluorescently labeled goat anti-mouse IgG appropriately diluted with PBS (1:100-1:200) to each well and incubate at 37°C in the dark for 1 hour.

[0078] 5) Washing method is the same as 3).

[0079] 6) Observation and result determination: The cells were observed under a fluorescent inverted microscope with blue excitation light (wavelength 490 nm), and the cells had complete cell morphology. When specific green fluorescence appeared in the field of view of the inoculated well, the BPIV3 test was determined to be positive. When the specific green fluorescence did not appear in the inoculated well, the field of view was dark, proving that the cells were not infected, and the BPIV3 test in the well was determined to be negative.

[0080] 5. Identification of hybridoma cells

[0081] (1) Culture characteristics

[0082] Use IMDM culture medium containing 15% fetal bovine serum, culture in a 37°C, 5% CO2 incubator, and examine the cell morphology of the hybridoma cell line under a microscope. The cell morphology should be consistent.

[0083] (2) Purity test

[0084] Sterility test, mycoplasma test and exogenous virus test are carried out according to the appendix methods of the current "Chinese Pharmacopoeia of Veterinary Medicine" (compiled by the Chinese Pharmacopoeia Committee, Pharmacopoeia of Veterinary Medicine of the People's Republic of China, 2020 edition, China Agriculture Press, 2020, referred to as "Chinese Pharmacopoeia" in this invention).

[0085] (3) Cytological examination

[0086] The hybridoma cells cultured for 24 hours were examined for chromosome number using the colchicine method to observe whether the chromosome characteristics were consistent with the staining characteristics of the hybridoma cells.

[0087] (4) Preparation of Ascites 8-10 week old BALB / C mice were intraperitoneally injected with 0.5 ml of pristane per mouse. 7-10 days later, the mice were intraperitoneally injected with 10 hybridoma cells. 6 ~10 7 Observe the mice after 7-10 days. When the abdomen of the mice is obviously swollen and the mice have difficulty in moving, extract the ascites of the mice, centrifuge at 3000r / min for 10min, take the supernatant, and store at -40℃. If ascites is produced again after 2-3 days, collect it again. This ascites is the mouse anti-BPIV3 monoclonal antibody.

[0088] (5) Ascites titer determination

[0089] The ascites of each monoclonal antibody was diluted from 1:100 to 1:16000, and the fluorescent antibody titer of the ascites was determined according to the indirect immunofluorescence detection method in Example 3, which was 1:2000.

[0090] Example 4

[0091] Assembly and application of indirect immunofluorescence kit for detecting BPIV3

[0092] The kit comprises anti-BPIV3 monoclonal antibody, commercial FITC-labeled goat anti-mouse antibody (purchased from Sigma), sample diluent and washing solution.

[0093] The steps and criteria for detecting bovine parainfluenza virus type 3 by this kit are as follows:

[0094] 1. Sample Inoculation

[0095] 100 μL of the treated sample was inoculated into confluent MDBK cells and cultured for 2 to 3 days.

[0096] 2. Fluorescence staining and result determination

[0097] (1) Fixation: Discard the cell culture medium in the 96-well plate, add about 0.3 mL of PBS (pH 7.2) to each well, gently wash the cell surface once, discard the PBS as much as possible, then add 0.1 mL of 80% cold acetone to each well, fix at 2-8°C for 20 min, discard the acetone, and air-dry naturally (30 min).

[0098] (2) Adding primary antibody: After natural drying, wash the cell surface once with PBS (pH 7.2), then add 50 μL of BPIV3 monoclonal antibody appropriately diluted with PBS (pH 7.2) to each well and incubate at 37°C for 1 h.

[0099] (3) Washing: Discard the BPIV3 monoclonal antibody and wash five times with PBS (pH 7.2), adding 0.3 ml of washing solution to each well each time and gently shaking for washing.

[0100] (4) Fluorescent secondary antibody staining: Discard the washing solution as much as possible, add 50 μL of FITC-labeled goat anti-mouse IgG appropriately diluted in PBS (pH 7.2) to each well, and incubate at 37°C for 1 h.

[0101] (5) Washing: Same as (3).

[0102] (6) Observation and determination: Under an inverted fluorescence microscope, cells were observed with blue excitation light (wavelength 490 nm). The cells had complete cell morphology. When specific green fluorescence appeared in the field of view of the inoculated well, the BPIV3 test in that well was determined to be positive. When specific green fluorescence did not appear in the inoculated well, the field of view was dark, indicating that the cells were not infected, and the BPIV3 test in that well was determined to be negative.

[0103] 3. Specificity test of the kit:

[0104] According to the established indirect immunofluorescence operation method, different BPIV3, bovine viral diarrhea / mucosal disease virus (BVDV), and infectious bovine rhinotracheitis virus (IBRV) were detected using an indirect immunofluorescence kit, and the coloring of virus-infected cells was observed to determine the specificity of the indirect immunofluorescence method.

[0105] The test results showed that (see Figure 3 ), this method can specifically identify and detect BPIV3 GSY01 strain, and the reaction result is positive, while it is different from BVDV (see Figure 3 B), IBRV (see Figure 3 C), BRV (see Figure 3 Middle D) There was no cross-reaction, which proved that the established method had good specificity and the indirect immunofluorescence kit could be applied to the specific detection of BPIV3.

[0106] 4. Kit sensitivity test: BPIV3 (GSY01 strain) was diluted to 80 TCID50 / 100 μL, and then doubled diluted to 0.625 TCID 50 / 100 μL, the above 8 dilution samples were inoculated into the MDBK cells that had grown monolayers, 100 μL / well, and 4 replicates were made for each sample. MEM culture medium was set as a negative control. The detection was carried out according to the steps and criteria for detecting BPIV3 in Example 4.

[0107] Results: The results of BPIV3 detection at each dose gradient were as follows: when the infection dose was greater than or equal to 5TCID 50 The above results show that the minimum detection limit of BPIV3 contamination of this kit is 5TCID 50 .

[0108] 5. Initial application of the kit:

[0109] This kit is used for the detection of exogenous viruses in cattle virus strains and cattle sera. Three common cattle products, including one cattle seed virus and two cattle sera, were selected in this test. BPIV3 was detected using the kit described in the present invention, and the three selected cattle products were tested for exogenous viruses contaminated by BPIV3 according to the 2020 edition (Part III) of the "Pharmacopoeia of the People's Republic of China on Veterinary Medicine". At the same time, PBS was set as a negative control, and the BPIV3 NGM strain was used as a positive control. The results showed that the results of the red blood cell adsorption and red blood cell agglutination tests were consistent with those of the test kit. The selected seed viruses and sera were not contaminated with BPIV3. The negative control was negative for BPIV3 detection, and the positive control was positive for BPIV3 detection. See Table 3 for seed virus and serum information:

[0110] Table 3 Results of testing the virus and serum using the kit of the present invention

[0111]

[0112]

[0113] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A bovine parainfluenza virus type 3 NP protein hybridoma cell BPIV3 Mab-NP-11 strain, characterized in that: The deposit number is CGMCC No.45943.

2. The method for preparing the hybridoma cell BPIV3 Mab-NP-11 strain according to claim 1, characterized in that: The following steps are involved: (1) The coding gene of bovine parainfluenza virus type 3 NP protein is codon-optimized and cloned into a prokaryotic expression vector, transformed into Escherichia coli and induced for expression, and the expression product is separated and purified to obtain an immunogen; the nucleotide sequence of the codon-optimized sequence is shown in SEQ ID No. 1; (2) Immunizing mice with the immunogen described in step (1), and screening out positive monoclonal cell lines that are specific to bovine parainfluenza virus type 3 NP protein based on the monoclonal antibody titer, thereby obtaining the hybridoma cell line BPIV3Mab-NP-11.

3. The monoclonal antibody produced by the hybridoma cell line BPIV3 Mab-NP-11 of claim 1.

4. Use of the monoclonal antibody according to claim 3 in the preparation of a reagent for detecting bovine parainfluenza virus type 3.

5. An indirect immunofluorescence kit for detecting bovine parainfluenza virus type 3, characterized in that: Comprising the monoclonal antibody according to claim 3 and a secondary antibody labeled with fluorescein; The fluorescein-labeled secondary antibody includes a FITC-labeled goat anti-mouse IgG antibody; The indirect immunofluorescence kit also includes a sample diluent and a washing solution, and both the sample diluent and the washing solution are PBS buffer.

Images