Soybean plant height related protein GmZG1 and coding gene and application thereof

Abstract

The application discloses a soybean plant height related protein GmZG1 and an encoding gene and application thereof, and belongs to the field of plant breeding, and relates to the soybean plant height related protein GmZG1 and the encoding gene and application thereof.The protein GmZG1 can regulate plant plant type, and the protein specifically refers to the following: A1) a protein with an amino acid sequence as shown in SEQ ID No.2; A2) a protein obtained by substitution, deletion and / or addition of amino acid residues of the protein of A1) and having more than 80% identity with the protein shown in A1) and having the same function; and A3) a fusion protein obtained by connecting a protein tag to the N terminal or / and C terminal of A1) or A2).Experiments prove that knocking out the protein GmZG1 can change the soybean plant height, and has important theoretical significance for soybean breeding.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of plant breeding, and relates to a protein GmZG1 related to soybean plant height and an encoding gene and application thereof. BACKGROUND

[0002] Soybean is an important food and oil crop for feeding and is playing an important role in ensuring food security and agricultural trade in China. Under the realistic condition of limited soybean planting area in China, how to rapidly and effectively improve soybean varieties through modern biological breeding techniques to increase soybean yield is an important production problem to be solved and a breeding technical bottleneck to be broken through.

[0003] Crop plant type plays a decisive role in the morphological development of individual plants and groups, and is an important factor affecting plant yield, crop production level and economic benefit. Crop plant type includes plant height, branching (tillering), leaf shape and ear type (pod setting habit). Crop plant type domestication or improvement plays a crucial role in achieving major breakthroughs in crop yield. However, the research on the regulation mechanism of soybean plant type and key genes for regulating soybean plant type is still in the exploratory stage, and there are few relevant research reports. The molecular mechanism, key genes and action network affecting the regulation of soybean plant type are not clear and explicit. In particular, due to the limitation of research materials, under field production conditions, which plant type is more conducive to improving soybean yield is also lacking relevant research. Therefore, further mining more plant type regulation genes not only has important theoretical value for discovering excellent soybean plant type regulation genes and cultivating high-yield ideal plant type, but also has important practical application value for realizing breeding application and improving soybean yield through the creation of specific materials to systematically evaluate and select soybean ideal plant type under production conditions. SUMMARY

[0004] The technical problem to be solved by the present application is how to regulate the plant height of plants to improve the yield of plants.

[0005] The present application also provides the use of the protein GmZG1 or the expression material of the regulatory gene or the material for regulating the activity or content of the protein in any of the following:

[0006] U1) the protein or the expression material of the regulatory gene or the material for regulating the activity or content of the protein in regulating the plant height of plants;

[0007] U2) the protein or the expression material of the regulatory gene or the material for regulating the activity or content of the protein in the preparation of a product for regulating the plant height of plants;

[0008] U3) the protein or the expression material of the regulatory gene or the material for regulating the activity or content of the protein in the cultivation of plants with changed plant height.

[0009] U4) Use of the protein or the expression substance of the regulatory gene or the substance regulating the activity or content of the protein in the preparation of a plant product with changed plant height;

[0010] U5) Use of the protein or the expression substance of the regulatory gene or the substance regulating the activity or content of the protein in plant breeding.

[0011] In the present application, the substance regulating the activity and / or content of the protein can be a substance regulating the expression of a gene encoding the protein. The protein can be any one of the following proteins:

[0012] A1) a protein with an amino acid sequence as shown in SEQ ID No. 2;

[0013] A2) a protein with more than 75% identity to the protein as shown in A1) and having the function of regulating the plant height, obtained by substitution, deletion and / or addition of amino acid residues of the protein of A1); for example, one skilled in the art can obtain a protein mutant with the same function as the amino acid sequence as shown in SEQ ID No. 2 by substitution, deletion and / or addition of one or more amino acids without affecting its activity, according to conventional technical means in the art such as the amino acid sequence as shown in SEQ ID No. 2 and conservative substitution of amino acids;

[0014] A3) a fusion protein obtained by connecting a protein tag to the N-terminal or / and C-terminal end of the protein of A1) or A2).

[0015] The protein of A1) above is named GmZG1.

[0016] In order to facilitate the purification or detection of the protein of A1), a tag protein can be connected to the amino-terminal or carboxyl-terminal end of the protein consisting of the amino acid sequence of SEQ ID No. 2 in the sequence listing.

[0017] The above-mentioned protein can be artificially synthesized or obtained by first synthesizing its encoding gene and then performing biological expression.

[0018] The tag protein includes but is not limited to: a GST (glutathione S-transferase) tag protein, a His6 tag protein (His-tag), a MBP (maltose binding protein) tag protein, a Flag tag protein, a SUMO tag protein, a HA tag protein, a Myc tag protein, an eGFP (enhanced green fluorescent protein), an eCFP (enhanced cyan fluorescent protein), an eYFP (enhanced yellow green fluorescent protein), an mCherry (monomeric red fluorescent protein) or an AviTag tag protein.

[0019] The nucleotide sequence encoding the protein GmZG1 of the present application can be easily mutated by those skilled in the art using known methods, such as methods of directed evolution or point mutation. Those nucleotides which are artificially modified and have 75% or more identity with the nucleotide sequence of the protein GmZG1 isolated in the present application are derived from the nucleotide sequence of the present application and equivalent to the sequence of the present application, as long as they encode the protein GmZG1 and have the function of the protein GmZG1.

[0020] The 75% or more identity described above can be 80%, 85%, 90% or 95% or more identity.

[0021] Herein, the identity refers to the identity of the amino acid sequence or the nucleotide sequence. The identity of the amino acid sequence or the nucleotide sequence can be determined using the homology search site on the internet, such as the BLAST page of the NCBI homepage. For example, the identity (%) of a pair of amino acid sequences or nucleotide sequences can be calculated by searching using blastp as the program, setting the Expect value to 10, setting all Filters to OFF, using BLOSUM62 as the Matrix, setting Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values), respectively, in the Advanced BLAST 2.1.

[0022] Herein, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0023] Herein, the 90% or more identity can be at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

[0024] In the above, the protein is derived from Glycine max (L.) Merr.

[0025] Herein, the substance which regulates the expression of the gene can be a substance which performs at least one of the following 6 kinds of regulation:

[0026] 1) regulation at the transcription level of the gene;

[0027] 2) regulation after the transcription of the gene (that is, regulation of the splicing or processing of the primary transcript of the gene);

[0028] 3) Regulation of RNA transport of the gene (that is, regulation of the transport of mRNA of the gene from the nucleus to the cytoplasm);

[0029] 4) Regulation of the translation of the aforementioned genes;

[0030] 5) Regulation of mRNA degradation of the aforementioned gene;

[0031] 6) Post-translational regulation of the gene (i.e., regulation of the activity of the protein translated from the gene).

[0032] In the above applications, the substance regulating gene expression or the substance regulating protein activity or content can specifically be a biological material related to the protein, and the biological material can be any of the following:

[0033] B1) Nucleic acid molecules that encode the proteins described above;

[0034] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0035] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0036] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0037] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0038] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0039] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0040] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;

[0041] C2) expresses the gene encoding the nucleic acid molecule described in C1);

[0042] C3) contains an expression cassette encoding the gene described in C2);

[0043] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);

[0044] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0045] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0046] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0047] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0048] In the above method, regulating the activity and / or content of the protein GmZG1 in the target plant, or / and the expression level of the gene encoding the protein, includes introducing the gene encoding the protein GmZG1 to the recipient plant to inhibit, reduce, or silence the protein, thereby obtaining a target plant with altered plant height; the gene encoding the GmZG1 encodes the protein GmZG1.

[0049] The importation refers to the importation through recombination methods, including but not limited to Agrobacterium-mediated transformation, bio-projectile methods, electroporation, in-planta technology, and so on.

[0050] The aforementioned protein GmZG1 also falls within the scope of protection of this invention.

[0051] The present invention also provides biomaterials related to the above-mentioned proteins, said biomaterials may be any of the following:

[0052] B1) Nucleic acid molecules that encode the proteins described above;

[0053] B2) An expression cassette containing the nucleic acid molecule described in B1);

[0054] B3) A recombinant vector containing the nucleic acid molecule described in B1), or a recombinant vector containing the expression cassette described in B2);

[0055] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);

[0056] B5) A transgenic plant cell line containing the nucleic acid molecule described in B1), or a transgenic plant cell line containing the expression cassette described in B2);

[0057] B6) Transgenic plant tissue containing the nucleic acid molecules described in B1), or transgenic plant tissue containing the expression cassette described in B2);

[0058] B7) Transgenic plant organs containing the nucleic acid molecules described in B1), or transgenic plant organs containing the expression cassette described in B2);

[0059] C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the genes encoding the proteins described above;

[0060] C2) expresses the gene encoding the nucleic acid molecule described in C1);

[0061] C3) contains an expression cassette encoding the gene described in C2);

[0062] C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3);

[0063] C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4);

[0064] C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4);

[0065] C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4);

[0066] C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

[0067] In the above-mentioned biological materials, the nucleic acid molecule described in B1) may be a gene as shown in E1) or E2) below:

[0068] E1) The coding sequence is the cDNA molecule or DNA molecule of SEQ ID No. 3;

[0069] The nucleotides encoding the E2) chain are the cDNA or DNA molecules of SEQ ID No. 1.

[0070] The DNA molecule shown in SEQ ID No. 3 (the GmZG1 gene that regulates plant height) encodes the protein GmZG1 of SEQ ID No. 2, which has the same amino acid sequence.

[0071] The nucleotide sequence shown in SEQ ID No. 3 is the nucleotide sequence of the gene encoding protein GmZG1 (CDS).

[0072] The GmZG1 gene described in this invention can be any nucleotide sequence capable of encoding the protein GmZG1. Considering codon degeneracy and the codon preferences of different species, those skilled in the art can use codons suitable for expression in specific species as needed.

[0073] B1) The nucleic acid molecule may also include nucleic acid molecules obtained by codon preference modification based on the nucleotide sequence shown in SEQ ID No.3.

[0074] B1) The nucleic acid molecule may also include nucleic acid molecules that have a nucleotide sequence identity of more than 95% with that shown in SEQ ID No. 3 and originate from the same species.

[0075] The nucleic acid molecules mentioned in this article can be DNA, such as cDNA, genomic DNA, or recombinant DNA; the nucleic acid molecules can also be RNA, such as gRNA, mRNA, siRNA, shRNA, sgRNA, miRNA, or antisense RNA.

[0076] The vectors described herein are well-known to those skilled in the art and include, but are not limited to: plasmids, bacteriophages (such as λ phage or M13 filamentous phage), granules (i.e., Cosmids), Ti plasmids, or viral vectors. Specifically, it may be the vector cas9 / gRNA.

[0077] Recombinant expression vectors containing the GmZG1 gene can be constructed using existing plant expression vectors. These plant expression vectors include, but are not limited to, binary Agrobacterium vectors and vectors suitable for plant microbombardment. The plant expression vectors may also contain the 3' untranslated region of the exogenous gene, i.e., containing a polyadenylate signal and any other DNA fragment involved in mRNA processing or gene expression. The polyadenylate signal can guide the addition of polyadenylate to the 3' end of the mRNA precursor; similar functions exist for the untranslated regions transcribed at the 3' end of genes including, but not limited to, Agrobacterium crown gall-inducing (Ti) plasmids (such as the Nos gene for lipase synthesis) and plant genes (such as the soybean storage protein gene).

[0078] When constructing a recombinant plant expression vector using the GmZG1 gene, any enhancing or constitutive promoter can be added before its transcription initiation nucleotide, including but not limited to the cauliflower mosaic virus (CAMV) 35S promoter and the maize ubiquitin promoter. These can be used alone or in combination with other plant promoters. Furthermore, when constructing a plant expression vector using the gene of this invention, enhancers, including translational enhancers or transcriptional enhancers, can also be used. These enhancer regions can be ATG start codons or adjacent region start codons, but they must be identical to the reading frame of the coding sequence to ensure correct translation of the entire sequence. The sources of the translation control signals and start codons are wide-ranging; they can be natural or synthetic. The translation initiation region can originate from the transcription initiation region or structural genes.

[0079] To facilitate the identification and screening of transgenic plant cells or plants, the plant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color changes (GUS genes, luciferase genes, etc.), antibiotic resistance markers (gentamicin markers, kanamycin markers, etc.), or chemical reagent resistance marker genes (such as herbicide resistance genes). From a safety perspective, transgenic plants can be screened directly under stress without adding any selective marker genes.

[0080] In a specific embodiment, the recombinant vector C4) can be GmZG1-sgRNA, and the structure of the recombinant vector GmZG1-sgRNA is described as follows: a recombinant expression vector is obtained by inserting a DNA molecule with the sequence 5'-AATCTTGTGAAAAGGTTGGA-3' into the cas9 / gRNA vector through homologous recombination, while keeping other sequences of the cas9 / gRNA vector unchanged.

[0081] The microorganisms mentioned in C5 of this article can be yeast, bacteria, algae, or fungi. Among them, bacteria can be from the genera *Escherichia*, *Erwinia*, *Agrobacterium*, *Flavobacterium*, *Alcaligenes*, *Pseudomonas*, *Bacillus*, etc. Specifically, it can be *Agrobacterium tumefaciens* EHA105.

[0082] In one specific embodiment, the recombinant microorganism may be recombinant Agrobacterium EHA105 / GmZG1-sgRNA.

[0083] The recombinant Agrobacterium EHA105 / GmZG1-sgRNA is a recombinant bacterium obtained by introducing the recombinant vector GmZG1-sgRNA into Agrobacterium tumefaciens EHA105.

[0084] The present invention first provides a method for regulating plant height, including regulating the activity and / or content of the protein GmZG1 in the target plant, and / or the expression level of the gene encoding the protein GmZG1, to regulate plant height.

[0085] In this article, regulating the expression of the gene encoding the protein can be achieved by inhibiting, reducing, or downregulating the expression of the gene. Inhibition, reduction, or downregulation of the gene expression can be achieved through gene knockout or gene silencing.

[0086] Gene knockout refers to the phenomenon of inactivating a specific target gene through gene editing technology. Gene knockout is achieved by altering the DNA sequence to inactivate a specific target gene.

[0087] In this invention, the purpose of plant breeding includes cultivating plants with increased / decreased plant height.

[0088] This invention also provides a method for cultivating plants with altered plant height, comprising:

[0089] 1) Inhibit, reduce or silence the expression level of the coding gene of the protein mentioned above in the target plant, or / and inhibit, reduce or silence the activity and / or content of the coding gene of the protein mentioned above, to obtain a plant with reduced plant height.

[0090] 2) Increase, enhance, or upregulate the expression level of the coding genes of the proteins mentioned above in the target plant, or / and increase, enhance, or upregulate the activity and / or content of the coding genes of the proteins mentioned above, to obtain plants with increased plant height.

[0091] In one specific embodiment, a method for cultivating plants with altered plant height includes the following steps: inhibiting the expression of nucleic acid molecules encoding GmZG1 protein in the target plant to obtain transgenic plants with altered plant height. Specifically, the inhibition of nucleic acid molecule expression encoding GmZG1 protein in the target plant can be achieved by introducing a knockout vector targeting the nucleic acid molecule encoding GmZG1 protein into the target plant.

[0092] The knockout vector may be a gene editing vector. Specifically, the gene editing vector is a vector based on Cas9 gene editing technology. Specifically, the gene editing vector expresses sgRNA and Cas9 protein.

[0093] As one embodiment of the present invention, the method for cultivating plants with altered plant height includes the following steps:

[0094] (1) Construct the gene editing vector of SEQ ID No. 4 that inhibits the expression of the GmZG1 gene;

[0095] (2) Introduce the gene editing vector constructed in step (1) into plants;

[0096] (3) Plants whose plant height has been altered were obtained through screening and identification.

[0097] The sgRNA targets the nucleic acid molecule encoding the GmZG1 protein. Specifically, the target of the sgRNA is: 5'-AATCTTGTGAAAAGGTTGGA-3'.

[0098] In the above method, the target site for gene editing by the CRISPR / Cas9 system is positions 386-405 of SEQ ID No. 1, which corresponds to positions 154-173 of SEQ ID No. 3 (coding sequence).

[0099] In the above method, the CRISPR / Cas9 system gene editing can be performed by mutating the gene encoding the protein GmZG1 in the soybean genome as follows: deleting the nucleotide “5'-GGTTGGAAGGA-3'” at positions 389-398 of SEQ ID No. 1 (corresponding to positions 157-166 of SEQ ID No. 3 (coding sequence CDS)), causing a frameshift mutation in the GmZG1 protein; thereby knocking out the gene encoding the GmZG1 protein.

[0100] In the above applications and methods, the regulation can be to increase, enhance, or upregulate.

[0101] In the above applications and methods, the regulation can be suppression, reduction, or silencing.

[0102] To facilitate the identification and screening of transgenic cells or plants, the recombinant expression vectors used can be processed, such as by adding genes that can be expressed in plants, encoding enzymes or luminescent compounds that produce color reactions, antibiotic resistance markers, or chemical reagent resistance marker genes. Alternatively, without adding any selective marker genes, transformed plants can be directly screened for resistance under stress.

[0103] The plants obtained by the above methods can be transgenic plants or plants obtained through conventional breeding techniques such as hybridization. In the above methods, the transgenic plants are understood to include not only first- and second-generation transgenic plants, but also their progeny. For transgenic plants, the gene can be propagated within the species, or it can be transferred into other varieties of the same species using conventional breeding techniques, particularly commercial varieties. The transgenic plants include seeds, callus tissue, complete plants, and cells.

[0104] In this article, plant type traits may include plant height, number of pods per plant, number of seeds per plant and / or number of branches.

[0105] In the above applications or methods, the plant is any one of the following:

[0106] N1) Dicotyledons:

[0107] N2) Leguminosae;

[0108] N3) Leguminosae (family legumes);

[0109] N4) Plants of the genus *Glycine*;

[0110] N5) soybeans.

[0111] This invention identifies a soybean plant height-related protein, GmZG1, encoded by the GmZG1 gene. Gene knockout experiments demonstrated that this gene positively regulates soybean plant height. The discovery of the soybean plant height-related protein GmZG1 provides an important candidate gene and breeding method for expanding the planting areas of soybean varieties, and has significant theoretical implications for soybean breeding. Attached Figure Description

[0112] Figure 1 This is the mutation type of the gmzg1 mutant.

[0113] Figure 2 This is the strain type of the gmzg1 mutant. Detailed Implementation

[0114] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0115] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0116] Unless otherwise specified, all quantitative experiments in the following examples are performed in triplicate.

[0117] The culture medium preparation method used in this invention is as follows:

[0118] 1) YEP solid medium consists of a solvent and a solute; the solutes and their concentrations in YEP solid medium are: NaCl 5g / L, yeast extract 5g / L, tryptone 10g / L, and agar 15g / L; the solvent is water. The pH of YEP solid medium is 7.0.

[0119] 1) Germination medium (pH 5.8): 3.12 g / L B5 salt, 1 ml / L B5 organic, 20 g / L sucrose, 7.5 g / L agar, with the remainder being water.

[0120] 2) Liquid culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 3.9 mg / L 2-morpholinoethanesulfonic acid, with the remainder being water.

[0121] 3) Co-culture medium (pH 5.4): 0.43 g / L MS salt, 1 ml / L B5 organic, 40 mg / L acetylsuccinone, 150 mg / L dithiothreitol, 100 mg / L L-cysteine, 30 g / L sucrose, 7.5 g / L agar, 3.9 mg / L 2-morpholinoethanesulfonic acid, with the remainder being water.

[0122] 4) Recovery medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 0.98 g / L 2-morpholinoethanesulfonic acid, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.

[0123] 5) Screening medium (pH 5.4): 3.1 g / L B5 salt, 1 ml / L B5 organic, 0.98 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.

[0124] 6) Elongation medium (pH 5.6): 4.0 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 30 g / L sucrose, 150 mg / L cephalosporin, 150 mg / L termethin, 0.1 mg / L IAA, 0.5 mg / L GA, 1 mg / L 6-BA, 6 mg / L glufosinate, 7.5 g / L agar, 4 ml / L Fe salt (200×), 50 mg / L L-asparagine, 50 mg / L L-glutamine, balance water.

[0125] 7) Rooting medium (pH 5.7): 2.165 g / L MS salt, 1 ml / L B5 organic, 0.6 g / L 2-morpholinoethanesulfonic acid, 20 g / L sucrose, 7.5 g / L agar, 50 mg / L L-asparagine, 50 mg / L L-glutamine, with the remainder being water.

[0126] MS salt in the following examples: PhytoTech, catalog number: M524; MS organic: PhytoTech, catalog number: M533; B5 organic: Phytotech, catalog number: G219; B5 salt: Phytotech, catalog number: G768.

[0127] The cultivated soybean Jack in the following examples has been described in: Chen L, Cai Y, Liu X, Yao W, Guo C, Sun S, Wu C, Jiang B, Han T, Hou W (2018), Improvement of soybean Agrobacterium-mediated transformation efficiency by adding glutamine and asparagine into the culture media. International Journal of Molecular Sciences 19, 3039. This biological material is available to the public from the applicant and is intended solely for the purpose of replicating the experiments of this invention and shall not be used for any other purpose.

[0128] The Agrobacterium tumefaciens EHA105 in the following examples has been described in: Cai Y, Chen L, Liu X, Guo C, Sun S, Wu C, Jiang B, Han T and Hou W (2018a), CRISPR / Cas9-mediated targeted mutationnesis of GmFT2a delays flowering time in soya bean. Plant Biotechnol J16, 176-185. This biological material is available to the public from the applicant and is intended solely for the purpose of repeating experiments of this invention and shall not be used for any other purpose.

[0129] The Cas9 / gRNA vector used in the following examples was purchased from Beijing Weishang Lide Biotechnology Co., Ltd., catalog number: VK005-15. This vector contains Cas9 protein expression units.

[0130] The data in the following examples were processed using SPSS 11.5 statistical software. The experimental results are expressed as mean ± standard deviation. One-way ANOVA was used, and P < 0.05 (*) indicates a significant difference, and P < 0.01 (**) indicates a highly significant difference.

[0131] Example 1: Construction of the CRISPR vector for GmZG1 gene editing

[0132] Using the soybean variety Jack as a reference genome, the gene for soybean protein GmZG1 is located on soybean chromosome 4. The genomic sequence of the GmZG1 gene is SEQ ID No. 1, the coding sequence of the GmZG1 gene is SEQ ID No. 3, and the protein GmZG1 with the amino acid sequence SEQ ID No. 2 is encoded.

[0133] 1. Obtaining sgRNA

[0134] The target sequence for GmZG1 sgRNA was selected using the online CRISPR-P tool (http: / / cbi.hzau.edu.cn / cgi-bin / CRISPR). The target site is located in the first exon region of GmZG1, and the target sequence is 5'-AATCTTGTGAAAAGGTTGGA-3' (i.e., positions 386-405 of SEQ ID No. 1, corresponding to positions 154-173 of SEQ ID No. 3 (coding sequence)). After the target site was designed, the sgRNA was integrated into the vector.

[0135] First, the target primers for synthesizing sgRNA are as follows:

[0136] GmZG1-F:5'-TTG AATCTTGTGAAAAGGTTGGA -3';

[0137] GmZG1-R:5'-AAC TCCAACCTTTTCACAAGATT -3';

[0138] (The underlined sequence is a 20bp sgRNA)

[0139] Add 5 μL each of GmZG1-F and GmZG1-R primers and 15 μL of water to a 25 μL system. Anneal at 95 °C for 3 min, then anneal at 0.1 °C / s to 16 °C and hold at 16 °C for 10 min to complete the annealing process, and obtain the gRNA annealed product with sticky ends.

[0140] 2. Preparation of GmZG1 gene editing expression vector GmZG1-sgRNA

[0141] Take 1 μL of the gRNA annealing product with sticky ends obtained in step 2 above and perform T4 ligation with the cas9 / gRNA vector to obtain the recombinant vector Cas9-sgRNA. This vector expresses sgRNA. The sequence of the target sequence binding region in the sgRNA is positions 386-405 of SEQ ID No. 1, which corresponds to positions 154-173 of SEQ ID No. 3 (coding sequence).

[0142] The prepared recombinant vector Cas9-sgRNA was transformed into *E. coli* DH5α and plated on LB+Kan solid medium. Single clones were picked, plasmids were extracted, and sequenced. Sequencing primer SQ: 5'-GATGAAGTGGACGGAAGGAAGGAG-3'. The plasmid with the correctly inserted fragment was named the recombinant vector GmZG1-sgRNA.

[0143] The structure of the recombinant vector GmZG1-sgRNA is described as follows: A DNA molecule with the sequence 5'-AATCTTGTGAAAAGGTTGGA-3' is inserted into the cas9 / gRNA vector through homologous recombination, while keeping other sequences of the cas9 / gRNA vector unchanged, to obtain the recombinant expression vector.

[0144] The recombinant vector GmZG1-sgRNA contains an sgRNA gene expression cassette with nucleotide sequences from positions 35 to 582 of SEQ ID No. 4. The sgRNA gene is shown as nucleotides from positions 480 to 499 of SEQ ID No. 4 in the sequence listing. Nucleotides 35-479 are the promoter for initiating sgRNA gene transcription, and nucleotides 576-582 are the terminator for terminating sgRNA gene transcription. Cas9-sgRNA also contains a Cas9 protein gene expression cassette with nucleotide sequences from positions 584 to 5568 of SEQ ID No. 4, and can express the Cas9 protein.

[0145] Example 2: Obtaining the GmZG1 gene-edited mutant

[0146] 1. Obtaining and phenotypic identifying GmZG1 mutants

[0147] The recombinant vector GmZG1-sgRNA obtained in Example 1 was transformed into Agrobacterium EHA105 by electroporation. The plasmid was extracted and sequenced for verification. The recombinant strain that was correctly sequenced was named EHA / GmZG1-sgRNA.

[0148] 2. Agrobacterium-mediated transformation

[0149] The EHA / GmZG1-sgRNA constructed in step 1 was transformed into the soybean variety Jack (hereinafter referred to as wild-type soybean or WT) using Agrobacterium-mediated transformation. The specific method is as follows:

[0150] A. Seed sterilization

[0151] 1) Take healthy, plump, uniform, and dry Jack soybean seeds that are free from pests, diseases, and spots, spread them evenly in a petri dish, and then place the petri dish in a desiccator.

[0152] 2) After completing step 1), place a 100ml beaker in the desiccator, pour 80ml of 12M sodium hypochlorite aqueous solution into the beaker, then slowly add 4ml of concentrated hydrochloric acid, and then quickly cover the desiccator, seal it with petroleum jelly, and place it for 16 hours for chlorine sterilization.

[0153] B. Preparation of infecting bacterial solution

[0154] 1) Incubate the EHA / GmZG1-sgRNA bacterial culture obtained in step 4 above at 28℃, resuspend it in liquid culture medium, and obtain OD. 600nm =0.6% of the infecting bacterial solution.

[0155] 2) Place the seeds treated in step A into a clean bench. Under a microscope, peel off the seed coat, separate the two cotyledons along the long axis, and keep the cotyledon with the complete hypocotyl. Make scratches at the junction of the hypocotyl and cotyledon, usually 3-5 scratches per cotyledon. Then, immerse the seeds in a 28℃ incubator for 2 hours.

[0156] 3) Place the cotyledons with the inner (smooth) side up on a co-culture medium lined with sterile filter paper, and incubate in the dark at 22°C for 5 days.

[0157] 4) After 5 days of co-culture, the hypocotyl of the explants elongated to 2 cm. Part of the hypocotyl was cut off, leaving 0.5 cm. The treated explants were then placed in recovery medium and cultured at 28°C under 16 h light / 8 h dark conditions for 7 days.

[0158] 5) Remove the explants from the recovery medium, remove the new shoots, cut off part of the hypocotyl, leaving 0.5 cm of the hypocotyl, and then transfer the trimmed explants into the selection medium and culture them at 28℃ for 21 days under 16h light / 8h dark conditions.

[0159] 6) After 21 days of selection and induction, the explants produced a large number of adventitious buds. The cotyledons and brown leaves were removed, and the remaining parts were transferred to elongation medium for culture at 28°C under 16h light / 8h dark conditions.

[0160] 7) In the elongation medium, when the clustered buds produce 5-8cm young stems, cut them off from the base of the adventitious buds; dip the stem base in 1mg / LIBA solution for 1min, and then transfer it to the rooting medium for culture. Culture at 28℃ under 16h light / 8h dark conditions for one week. After a large number of roots are produced at the base of the stem, transplant them into pots. The resulting plants are T0 generation transformed soybeans.

[0161] 3. Molecular detection of edited plants

[0162] DNA was extracted from the leaves of T0 generation transformed soybean obtained in step 2 and used as a template for PCR molecular detection, with wild-type soybean as a control.

[0163] A PCR primer set LTPP-F / LTPP-R was designed near the target site of the GmZG1 gene to amplify the GmZG1 gene by PCR and then sequence it.

[0164] ZG1-F: 5'-TTTCCACTCCTTCTCCTCACT-3';

[0165] ZG1-R: 5'-TAGAGAGAGAGAGAGAAATG-3'.

[0166] PCR reaction system: 12.5 μL 2×PhantaMax Buffer, 0.5 μL dNTP Mix (10 mM), 1 μL DNA (200 ng / μL), 1 μL LTPP-F (10 pmol / μL), 1 μL LTPP-R (10 pmol / μL), 0.5 μL Super-Fidelity DNA Polymerase, 8.5 μL ddH2O, total volume 25 μL. Amplification reaction system: 95℃ for 3 min; 95℃ for 30 sec, 58℃ for 30 sec, 72℃ for 1 min, 35 cycles; 72℃ for 5 min. PCR products were sent to the company for sequencing verification.

[0167] The plants exhibiting overlapping peaks near the target site were heterozygous edited plants, named T0 generation GmZG1 gene-edited soybeans.

[0168] T0 generation GmZG1 gene-edited soybeans were sown and then the seeds of T1 generation GmZG1 gene-edited soybeans were harvested to cultivate T1 generation GmZG1 gene-edited soybeans.

[0169] PCR was used to detect the GmZG1 gene-edited soybean of generation T1. Sequencing results of the amplified products showed that in the T1 generation GmZG1 gene-edited soybean (gmzg1), compared with the genomic DNA of the soybean variety Jack (wild type, abbreviated as WT), the gene encoding the GmZG1 protein in both homologous chromosomes of the gmzg1 homozygous mutant underwent the following mutation: "The nucleotide "5'-GGTTGGAAGGA-3'" at positions 389-398 of SEQ ID No. 1 (corresponding to positions 157-166 of SEQ ID No. 3 (coding sequence CDS) was deleted, thereby knocking out the gene encoding the GmZG1 protein. The sequencing results of this mutation site and its surrounding nucleotides are shown in the figure." Figure 1 .

[0170] The T1 generation GmZG1 gene-edited soybean mutant plant gmzg1 with the above-mentioned GmZG1 gene mutation type was further cultured and screened to obtain the T2 generation GmZG1 gene-edited soybean homozygous mutant gmzg1 without transgenic elements.

[0171] Example 3: Phenotypic Identification of GmZG1 Gene-Edited Soybean Mutants

[0172] The plants to be tested were soybean varieties Jack and GmZG1 gene-edited soybean GmZG1, grown in a net house under natural light conditions in Beijing during the summer. The planting conditions were: plant spacing 10cm and row spacing 50cm.

[0173] Plant morphological traits (plant height, number of nodes, number of branches, number of pods per plant, and number of grains per plant) of the wild-type soybean variety Jack (referred to as the control plant) and the homozygous mutant gmzg1 of GmZG1 were statistically analyzed. The experimental materials were replicated three times, with at least six plants from each line measured each time.

[0174] The results (Table 1) show that, in terms of plant type, compared with the control plant height of 148.3 cm, the average height of the gmzg1 homozygous mutant was 126.0 cm, which was significantly lower than that of the control. In terms of branching phenotype, the control plant had 1.5 branches, while the gmzg1 homozygous mutant plant had 2.0 branches, with no significant difference between the mutant and wild types. In terms of the number of nodes, the control plant had 25.0 nodes, while the gmzg1 homozygous mutant plant had an average of 25.6 nodes, with no significant change between the gmzg1 homozygous mutant and the control.

[0175] In terms of yield per plant, the control plants had an average of 106.5 pods and 257.8 seeds per plant, while the gmzg1 homozygous mutant had an average of 109.6 pods and 277.0 seeds per plant. The number of pods and seeds per plant of the gmzg1 homozygous mutant was higher than that of the wild type, but the difference was not significant.

[0176] Table 1. Statistics on soybean plant type data

[0177]

[0178] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. The use of a substance that knocks out a protein-coding gene or reduces the activity or content of said protein in any of the following: U1) Application in reducing plant height; U2) Application in the preparation of products that reduce plant height; Application of U3 in cultivating plants with reduced plant height; U4) is used in the preparation of products that cultivate plants with reduced plant height; Application of U5 in plant breeding; The protein is as follows: A1) A protein with the amino acid sequence shown in SEQ ID No. 2; A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1); The purpose of the breeding is to select plant varieties with reduced plant height; The plant in question is soybean.

2. The application according to claim 1, characterized in that, The substance is a biomaterial related to the protein, and the biomaterial is any one of the following: C1) Nucleic acid molecules that inhibit, reduce, or silence the expression of the gene encoding the protein described in claim 1; C2) expresses the gene encoding the nucleic acid molecule described in C1); C3) contains an expression cassette containing the gene encoding described in C2); C4) A recombinant vector containing the encoding gene described in C2), or a recombinant vector containing the expression cassette described in C3); C5) A recombinant microorganism containing the encoding gene described in C2), or a recombinant microorganism containing the expression cassette described in C3), or a recombinant microorganism containing the recombinant vector described in C4); C6) A transgenic plant cell line containing the encoding gene described in C2), or a transgenic plant cell line containing the expression cassette described in C3), or a transgenic plant cell line containing the recombinant vector described in C4); C7) Transgenic plant tissue containing the encoding gene described in C2), or transgenic plant tissue containing the expression cassette described in C3), or transgenic plant tissue containing the recombinant vector described in C4); C8) A transgenic plant organ containing the encoding gene described in C2), or a transgenic plant organ containing the expression cassette described in C3), or a transgenic plant organ containing the recombinant vector described in C4).

3. A method for reducing plant height, characterized in that, This includes reducing the activity and / or content of proteins in the target plant, and / or knocking out the gene encoding the protein, to reduce plant height; the protein is as follows: A1) A protein with the amino acid sequence shown in SEQ ID No. 2; A2) A fusion protein obtained by attaching a protein tag to the N-terminus and / or C-terminus of A1); The plant in question is soybean.

4. The method according to claim 3, characterized in that, The reduction of the activity and / or content of the protein in the target plant, or / and the knockout of the gene encoding the protein, includes introducing a substance that knocks out the gene encoding the protein into the recipient plant to obtain a target plant with reduced plant height; the gene encoding the protein in claim 3.

5. A method for cultivating plants with reduced plant height, characterized in that, The method includes knocking out the gene encoding the protein of claim 1 in the target plant, and / or inhibiting, reducing or silencing the activity and / or content of the protein of claim 1, to obtain a plant with reduced plant height; the plant is soybean.

Images