Application of Brassicaceae Crop GSL5 Gene in Improving Resistance to Clubroot Disease

Abstract

This application for invention is a divisional application of 202311580841.X. The present invention provides the application of the GSL5 gene of cruciferous crops in improving clubroot resistance, belonging to the technical field of plant breeding. The GSL5 gene is highly conserved in cruciferous crops. The homozygous mutant of cruciferous crops with the loss of GSL5 gene function has broad-spectrum and high resistance to clubroot, proving that gene modification targeting GSL5 can achieve the improvement of broad-spectrum clubroot resistance in cruciferous crops, providing new key genes and technical means for the improvement of clubroot resistance and long-term and efficient prevention and control of cruciferous crops.

Description

[0001] This application is a divisional application of the patent application entitled "Application of GSL5 Gene in Cruciferous Crops in Improving Resistance to Clubroot and Product Development". The filing date of the original application was November 23, 2023, and the application number was 202311580841.X. Technical Field

[0002] The present invention belongs to the technical field of plant breeding, and particularly relates to the application of the GSL5 gene of cruciferous crops in improving resistance to clubroot. Background Art

[0003] Cruciferous crops include Brassica napus, Brassica rapa, Brassica oleracea, Brassica juncea, Raphanus sativus, etc., and are important sources of human edible oil, vegetables, feed, and industrial oil, and are the most important type of economic crops worldwide.

[0004] Cruciferous clubroot is a devastating soil-borne disease caused by the protozoan Plasmodiophora brassicae, which can damage almost all cruciferous crops, causing root swelling, rot, and plant death. The average yield loss is 25-50%, and in severe cases, it can cause a complete crop failure. The clubroot fungus can survive in the soil for more than 10 years, and fields infected with the clubroot fungus will be unsuitable for growing any cruciferous crops for a long time. In recent years, clubroot has spread rapidly in the main production areas of cruciferous crops such as rapeseed, Chinese cabbage, cabbage, mustard, and radish in China, with an affected area of more than 40 million mu, and has become a major common industrial disease of cruciferous crops. The direct economic loss is about 50 billion yuan per year, seriously threatening the safe production of rapeseed and cruciferous vegetable crops. Therefore, green and efficient prevention and control of cruciferous clubroot is a key measure to ensure the supply safety of products such as edible oil and "vegetable basket".

[0005] Discovering and utilizing clubroot-resistant genes and cultivating disease-resistant varieties are the most economical and effective measures for controlling clubroot. There are physiological races of the clubroot fungus, and the currently used clubroot-resistant loci mainly come from turnips (B.rapa sp.rapifera, fodder Chinese cabbage), all of which show dominant and race-specific resistance. The disease-resistant varieties promoted and applied in production lose their resistance after about 3 years, and the disease-resistant breeding cycle is long, far from meeting the production needs. Broad-spectrum clubroot-resistant genes have a broad resistance spectrum and are not easily lost, and are ideal genes for disease-resistant breeding, but currently, no broad-spectrum clubroot-resistant genes have been found. Summary of the Invention

[0006] In view of this, the purpose of the present invention is to provide the application of the GSL5 gene of cruciferous crops in improving clubroot resistance. Genetic engineering modification targeting GSL5 can achieve broad-spectrum improvement of clubroot resistance in cruciferous crops, providing key genes and technical means for the sustainable and efficient prevention and control of clubroot in cruciferous crops.

[0007] To achieve the above-mentioned invention purpose, the present invention provides the following technical solutions:

[0008] The application of the GSL5 gene of cruciferous crops in improving clubroot resistance; preferably, targeting the promoter region, coding region, non-coding region, and intron region of GSL5, genetic modification is carried out to cause a decrease or termination in the transcriptional level of the GSL5 gene of cruciferous crops, a decrease or termination in the protein expression level, as well as amino acid mutations and amino acid modification changes, resulting in the loss or alteration of GSL5 function.

[0009] Preferably, the genetic engineering modification includes any one of gene editing, EMS mutagenesis, radiation mutagenesis, homologous recombination, and T-DNA insertion.

[0010] Preferably, the cruciferous crops are clubroot pathogen-hosting cruciferous crops; more preferably, the cruciferous crops are any one of Arabidopsis thaliana, rapeseed, Chinese cabbage, cabbage, mustard, and radish.

[0011] Preferably, the nucleotide sequence of the GSL5 gene is any one of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8.

[0012] Compared with the prior art, the present invention has the following beneficial effects:

[0013] (1) The present invention has identified the conserved clubroot-susceptible gene GSL5 in cruciferous crops. Knocking out this gene can achieve broad-spectrum improvement of clubroot resistance in cruciferous crops, providing a brand-new gene for the improvement of clubroot resistance in cruciferous crops, with huge economic and social benefits and broad application prospects.

[0014] (2) The present invention has achieved the improvement of clubroot resistance in cruciferous crops by using gene editing technology, which can significantly shorten the breeding cycle for disease resistance, providing a brand-new approach for the improvement of clubroot resistance in cruciferous crops and having broad application prospects.

[0015] (3) The present invention has created Arabidopsis thaliana, Brassica napus, Brassica rapa, and Brassica oleracea materials with broad-spectrum resistance to different races of Plasmodiophora brassicae. The resistance is not easily lost, and it can effectively and durably control clubroot disease for a long time, providing key germplasm resources for the green, efficient, and durable control of clubroot disease in cruciferous crops, with great application potential, economic benefits, and social benefits.

[0016] (4) The clubroot-susceptible gene GSL5 identified in the present invention plays a key role in the infection and pathogenesis process of Plasmodiophora brassicae. Knocking out GSL5 can block the infection process of Plasmodiophora brassicae and significantly improve clubroot disease resistance. This discovery not only enriches the theoretical understanding of the pathogenesis of Plasmodiophora brassicae but also provides a theoretical basis for the research and development of precise control technologies for clubroot disease.

[0017] (5) The clubroot-susceptible gene GSL5 identified in the present invention is widely present and highly conserved in cruciferous crops. By modifying GSL5, the overall resistance of cruciferous crops to clubroot disease can be improved, which is of great significance for the green, efficient, and durable control of clubroot disease in cruciferous crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 (1) Modifying GSL5 in Arabidopsis thaliana can achieve the improvement of broad-spectrum resistance to clubroot disease; A. Structure of the GSL5 gene, gsl5-1 is a termination mutation of GSL5 at the 2220th base, and gsl5-2 is a deletion of GSL5 at positions 484 - 613; B and C. gsl5-1 and gsl5-2 have high resistance to clubroot disease and have no significant impact on growth and development; D. GSL5 is significantly up-regulated during the cortical infection stage of Plasmodiophora brassicae; E. gsl5-1 has broad-spectrum high resistance to different races of Plasmodiophora brassicae;

[0019] Figure 2 (2) The sequence and function of GSL5 are highly conserved in cruciferous crops; A. The protein sequence of GSL5 is highly conserved in cruciferous crops; B and C. GSL5 from five representative cruciferous crops can functionally complement the Arabidopsis thaliana gsl5-1 mutant and restore its susceptibility to the disease;

[0020] Figure 3 (3) Using gene editing to knock out the GSL5 gene in clubroot-susceptible rapeseed, Chinese cabbage, and Brassica oleracea materials can significantly improve their resistance to clubroot disease; A and B. Identification of the disease resistance of homozygous gsl5 mutant plants of rapeseed, Chinese cabbage, and Brassica oleracea; C. Identification of the gene editing target sequence of the GSL5 gene and the homozygous genotype of gsl5 in rapeseed, Chinese cabbage, and Brassica oleracea;

[0021] Figure 4 (4) Broad-spectrum resistance of homozygous gsl5 mutant plants of rapeseed to Plasmodiophora brassicae and their growth status; A. Homozygous gsl5 mutant plants of rapeseed have broad-spectrum high resistance to different races of Plasmodiophora brassicae; B and C. Homozygous gsl5 mutation in rapeseed has no significant impact on plant growth and development. Detailed implementation manners

[0022] The present invention provides an application of the GSL5 gene (Glucan Synthase-Like 5 or Callose synthase 12, CalS12) of cruciferous crops in improving the resistance of cruciferous crops to clubroot disease; aiming at the promoter region, coding region, non-coding region, and intron region of the GSL5 gene of cruciferous crops, through genetic modification to cause a decrease or termination in the transcriptional level of the GSL5 gene of cruciferous crops, a decrease or termination in the protein expression level, as well as amino acid mutations and amino acid modification changes resulting in the loss or change of GSL5 function, the broad-spectrum resistance of cruciferous crops to clubroot disease can be improved.

[0023] The genetic modification preferably included in the present invention is any one of gene editing, EMS mutagenesis, radiation mutagenesis, homologous recombination, and T-DNA insertion.

[0024] The cruciferous crops preferably used in the present invention are cruciferous crops that are hosts of Plasmodiophora brassicae, and further preferably any one of Arabidopsis thaliana, rapeseed, Chinese cabbage, cabbage, mustard, and radish. The nucleotide sequence of the GSL5 gene is preferably any one of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8, wherein the nucleotide sequence is the nucleotide sequence of the gene coding region, specifically as follows: Arabidopsis thaliana GSL5 is shown as SEQ ID NO.1; GSL5 of the A sub-genome of rapeseed is shown as SEQ ID NO.2; GSL5 of the C sub-genome of rapeseed is shown as SEQ ID NO.3; Chinese cabbage GSL5 is shown as SEQ ID NO.4; cabbage GSL5 is shown as SEQ ID NO.5; GSL5 of the A sub-genome of mustard is shown as SEQ ID NO.6; GSL5 of the B sub-genome of mustard is shown as SEQ ID NO.7; radish GSL5 is shown as SEQ ID NO.8. Due to the high conservation of the GSL5 gene in cruciferous crops, the GSL5 genes of other cruciferous crops not mentioned should also fall within the protection scope of the present invention.

[0025] The present invention also provides a nucleotide sequence capable of gene - editing the GSL5 gene of cruciferous crops, and the nucleotide sequence is as shown in SEQ ID NO.9 or SEQ ID NO.10; the cruciferous crops include rapeseed, Chinese cabbage - type crops, and Brassica oleracea crops. The target sequence bases of the GSL5 genes of rapeseed, Chinese cabbage - type crops, and Brassica oleracea crops are exactly the same, with a length of 20 bases. The 3' end of the target sequence has an NGG motif, where N represents any one of the bases A, G, C, and T. In view of the high conservation of the GSL5 gene in cruciferous crops, the identical sequences containing the above - mentioned characteristics in all cruciferous crop GSL5 genes should also fall within the protection scope of the present invention.

[0026] The present invention also provides a recombinant vector comprising the above - mentioned nucleotide sequence. Transferring the gene - directed editing recombinant vector into cruciferous crops can obtain cruciferous crop materials with clubroot disease resistance. The gene - directed editing recombinant vector performs directed editing on the cruciferous clubroot disease - causing related gene GSL5, resulting in a loss - of - function mutation. A DNA fragment ending with the base NGG is selected as the target site in the exon region, where N represents any one of the bases A, G, C, and T.

[0027] The present invention also provides a recombinant strain comprising the recombinant vector.

[0028] The technical solutions provided by the present invention will be described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0029] Example 1

[0030] Analysis of Arabidopsis thaliana GSL5 gene mutation and broad - spectrum resistance to clubroot disease

[0031] The Arabidopsis thaliana mutant gsl5 - 1, namely pmr4 - 1 (Stock number CS3858), was obtained by ordering from the Arabidopsis Biological Resource Center. This mutant had a mutation from G to A at the 2220th base of the GSL5 gene (gene number AT4G03550), resulting in the generation of a stop codon and the loss of GSL5 protein function. The Arabidopsis thaliana mutant gsl5 - 2 was obtained by gene - editing to knockout GSL5. This mutant had a deletion at positions 484 - 613 in the first exon of GSL5, resulting in a frameshift mutation in the subsequent coding region and the loss of GSL5 protein function.

[0032] Figure 1A represents the gene structure of GSL5. The Arabidopsis thaliana gsl5-1 mutant used has a termination mutation at the 2220th base of the GSL5 gene; the gsl5-2 mutant was obtained using the pYLCRISPR / Cas9 multi-target gene editing system and has a deletion mutation at positions 484 - 613 of the first exon of the GSL5 gene. The gene editing target sites were designed on the first exon of GSL5, and 4 editing target sites were designed. The target site sequences are as follows:

[0033] sgRNA1: 5’-ACGAAACCGACGAACAACCGCGG-3’, as shown in SEQ ID NO.11;

[0034] sgRNA2: 5’-TATTGATTCTCTCGATTCCGCGG-3’, as shown in SEQ ID NO.12;

[0035] sgRNA3: 5’-GAACGCCATTGAACATACGGCGG-3’, as shown in SEQ ID NO.13;

[0036] sgRNA4: 5’-GATTGCCTCGATGAGAACACCGG-3’, as shown in SEQ ID NO.14;

[0037] The primers for PCR identification of gene-edited offspring plants are:

[0038] GSL5-F1: 5’-CGCCGTCTTCAGAGCTACAA-3’, as shown in SEQ ID NO.15;

[0039] GSL5-R1: 5’-GGCGGCTTGAAGGAACAAAG-3’, as shown in SEQ ID NO.16.

[0040] The GSL5 gene used for complementing gsl5-1 is the full-length gene region of the genome (including introns), and the promoter is the GSL5 self-promoter (2500 bp upstream of the start codon). The gene promoter was cloned using the genomic DNA of Arabidopsis thaliana ecotype Col-0 leaves. The primers and sequencing were completed by Tsingke Biotechnology Co., Ltd. (Beijing). The primers used for cloning the Arabidopsis thaliana GSL5 promoter and gene fragment are:

[0041] AtGSL5F: GTCGACCTGCAGGCATGCCTGTCTTAAATGGACATTTGTAGT AACAAA;

[0042] AtGSL5R: AAGTTCTTCTCCTTTACTGACATCGCCTTTTGATTTCTTC;

[0043] As shown in SEQ ID NO.17 and SEQ ID NO.18, the recombinant vector was constructed by double digestion (the restriction enzyme sites are HindIII and Kpn I) and homologous recombination methods and ligated to the expression vector PBI121. After correct sequencing, it was transformed into Agrobacterium tumefaciens GV3101, and genetic transformation was carried out by the Agrobacterium-mediated flower dipping method. The offspring plants were screened using kanamycin resistance, and the positive plants obtained were further identified by PCR amplification of the kanamycin gene. The primer sequences for identification are

[0044] KanR-jcF: CCTGTTCCAAAGGTCCTGCA;

[0045] kanR-jcR: TGTCATACCACTTGTCCGCC;

[0046] As shown in SEQ ID NO.19 and SEQ ID NO.20; the amplified product size is 500bp, thus obtaining GSL5 overexpression plants. By crossing the gsl5-1 mutant and GSL5 overexpression plants, the offspring plants were identified by PCR amplification of the kanamycin gene (the amplification primers are the same as above) to obtain gsl5-1 GSL5 complementary plants. The identification of clubroot resistance of Arabidopsis wild-type Col-0, gsl5-1, GSL5, and gsl5-1 GSL5 plants was carried out in a plant growth chamber. The clubroot strains used were collected from the main disease areas across the country. Plants at the 2-week-old seedling stage were used for clubroot inoculation, and inoculation was carried out using a dormant spore suspension of clubroot. The inoculation amount was 10 8 / plant. The incidence of clubroot was investigated 30 days after inoculation. The incidence level was determined according to the industry standard of the Ministry of Agriculture and Rural Affairs, "Technical Regulations for Identification of Clubroot Resistance in Rapeseed" (NY / T 3621-2020). A disease index ≤ 10 indicates high resistance.

[0047] Figure 1 Figures B and 1C show that the loss-of-function mutation of GSL5 confers high resistance of plants to clubroot, and the roots and plant development are normal, with no significant impact on growth and development. Figure 1 Figure D shows that the expression of GSL5 is significantly up-regulated during the cortical infection period of clubroot (7 days after inoculation); Figure 1 Figure E shows that the GSL5 mutation has broad-spectrum high resistance to clubroot from 35 different regions, and the disease index is significantly reduced. The above results indicate that Arabidopsis GSL5 is a key susceptibility gene to clubroot.

[0048] Example 2

[0049] Conservation analysis of the GSL5 gene in cruciferous crops

[0050] The collinearity analysis tool of the online BRAD database (http: / / www.brassicadb.cn / # / s-yntenic-gene / ) was used to identify genes collinear with Arabidopsis GSL5 in the genomes of rapeseed, Chinese cabbage, cabbage, mustard, and radish. Among them, the genes of the allopolyploid crops rapeseed and mustard each contain two GSL5 genes, while the diploid crops Chinese cabbage, cabbage, and radish each have only one GSL5 gene. The protein sequences were subjected to multiple sequence alignment using the online multiple alignment tool COBALT (https: / / www.ncbi.nlm.nih.gov / tools / cobal-t / re_cobalt.cgi), and visualized analysis was performed using Jalview. The corresponding GSL5 genes and promoters (2500 bp upstream of ATG) were cloned from the genomic DNA of rapeseed, Chinese cabbage, cabbage, mustard, and radish leaves respectively. After the genes were verified by sequencing, they were ligated into the PBI121 expression vector. Using the Arabidopsis gsl5-1 mutant as the receptor, genetic transformation was carried out by the Agrobacterium-mediated floral dipping method. The progeny plants were identified by PCR, and the positive plants were used for clubroot resistance identification. The vectors, construction strategies, Arabidopsis transformation, and clubroot inoculation methods were the same as those in Example 1. The primer sequences for cloning the GSL5 promoters and genes of the said crops are shown in Table 1.

[0051] Table 1 Primer sequences for amplifying the GSL5 promoters and genes of cruciferous crops

[0052]

[0053]

[0054] The results are as Figure 2 shown, Figure 2 The amino acid sequence conservation analysis of A shows that the GSL5 protein is highly conserved in cruciferous crops; Figure 2 B and 2C show that the GSL5 of five representative cruciferous crops: rapeseed (BnaA09.GSL5, BnaC09.GSL5), Chinese cabbage (BraGSL5), cabbage (BolGSL5), mustard (BjuA09.GSL5, BjuB08.GSL5), radish (RsGSL5) can functionally complement Arabidopsis gsl5-1 and restore its susceptibility. Thus, it can be shown that GSL5 is a conserved key clubroot-susceptible gene common to cruciferous crops, and it is expected to achieve broad-spectrum resistance improvement to clubroot by genetically engineering the GSL5 of the above crops.

[0055] Example 3

[0056] Knockout of GSL5 genes in rapeseed, Chinese cabbage, and cabbage and analysis of broad-spectrum clubroot resistance

[0057] The rapeseed materials used were the spring rapeseed variety Westar and the semi-winter rapeseed variety Zhongshuang 11. The Chinese cabbage variety was pakchoi F554 (B.rapa ssp.chinensis), and the cabbage variety was headed cabbage HXF (B.oleracea var.capitata). The GSL5 genes of rapeseed, Chinese cabbage, and cabbage were knocked out using the pYLCRISPR / Cas9 multi-target gene editing vector. The gene editing target sites were designed on the first exon of GSL5, and two editing target sites were designed, with the sequences as follows:

[0058] sgRNA1: 5’-ACACGAACATCTGGAAGCAGAGG, as shown in SEQ ID NO.9;

[0059] sgRNA2: 5’-GAAAGCCACCACAGCGTAAAGG, as shown in SEQ ID NO.10;

[0060] These two target sites can be used simultaneously to edit GSL5 of rapeseed, Chinese cabbage, and cabbage. The constructed vectors were transformed into the hypocotyls of rapeseed, Chinese cabbage, and cabbage respectively by Agrobacterium-mediated genetic transformation. After the obtained T1 generation positive transgenic plants were propagated, homozygous mutant single plants of GSL5 were screened in the T2 population. The primer sequences for amplifying GSL5 of the A sub-genome, C sub-genome of rapeseed, Chinese cabbage, and cabbage are as follows:

[0061] GSL5 of the A sub-genome of rapeseed:

[0062] BnGSL5A-F: GACGCTGGCTCGCAACGGT, as shown in SEQ ID NO.35;

[0063] BnGSL5A-R: CGGCCGCCCCAATCCATACC, as shown in SEQ ID NO.36;

[0064] GSL5 of the C sub-genome of rapeseed:

[0065] BnGSL5C-F: ACGCTGCCTCGCAACGGC, as shown in SEQ ID NO.37;

[0066] BnGSL5C-R: TGGCCGCCCAAGTCCATACCT, as shown in SEQ ID NO.38;

[0067] The primer for amplifying the GSL5 target site of Chinese cabbage is the same as that of GSL5 of the A sub-genome of rapeseed.

[0068] GSL5 of cabbage:

[0069] BoGLS5-F: ACGCTGGCTCGCAACGGC, as shown in SEQ ID NO.39;

[0070] BoGSL5-R: CGGCCGCCCCAATCCATACC, as shown in SEQ ID NO.40;

[0071] The obtained homozygous single-plant progeny of GSL5 was used for the identification of clubroot resistance. The inoculation method of Plasmodiophora brassicae and the method for resistance evaluation were the same as those in Example 1.

[0072] The results are as Figure 3 shown, Figure 3 A and 3B show the disease resistance identification of homozygous GSL5 mutant plants of Brassica napus, Brassica rapa, and Brassica oleracea; Figure 3 C shows the gene editing target sequences of GSL5 in Brassica napus, Brassica rapa, and Brassica oleracea and the genotypes of their homozygous mutant plants. Figure 3 The results show that knocking out the GSL5 gene in susceptible Brassica napus, Brassica rapa, and Brassica oleracea materials by gene editing can significantly improve the resistance of plants to clubroot.

[0073] Inoculate the homozygous mutant plants of the spring rape variety Westargsl5 with different races of Plasmodiophora brassicae and count the disease index. The results show that the gsl5 homozygous mutant plants of Westar have broad-spectrum high resistance to different races of Plasmodiophora brassicae ( Figure 4 A), and field trials (in non-clubroot disease areas) show that the GSL5 mutation has no significant effect on the growth and development of rape ( Figure 4 B and C).

[0074] The above are only the preferred embodiments of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. Use of the GSL5 gene of cruciferous crops in improving clubroot resistance; the cruciferous crop is any one of Arabidopsis thaliana, rapeseed, Chinese cabbage, and cabbage; the nucleotide sequence of the GSL5 gene is any one of SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7, and SEQ ID NO.8; the function of the GSL5 gene of the cruciferous crop is deleted.

2. The use according to claim 1, characterized in that, for the GSL5 promoter region and coding region, the function of the GSL5 gene of the cruciferous crop is deleted by gene modification.

3. The use according to claim 1, characterized in that, the gene modification includes any one of gene editing and homologous recombination.

Images