A method for SNP molecular marker for detecting the pH value of goose meat

Abstract

The present invention discloses a method for SNP molecular markers for detecting the pH value of goose meat, which relates to the field of SNP molecular marker breeding. The technical solution of the present invention includes the following steps: S1, aligning the whole genome resequencing data of the goose to be detected to the reference genome sequence, combining the pH value data of the goose meat to be detected, and screening candidate SNP sites for the pH value of the goose meat to be detected through genome-wide association analysis; S2, using the technology of flight mass spectrometry to test the distribution frequency of SNP sites in goose individuals and performing association analysis with the pH value trait of goose meat. The identified SNPs can provide theoretical support for the screening of goose meat quality, provide important references for the improvement of goose meat quality and breeding, and provide a new direction for the development of breeding markers.

Description

Technical Field

[0001] The present invention relates to the field of SNP molecular marker breeding, and particularly to a method for detecting SNP molecular markers for the pH value of goose meat quality. Background Art

[0002] Although goose meat accounts for only 2% of global poultry production, it is considered an important guarantee for dietary diversity and nutritional security due to its high protein content, ideal amino acid composition, low fat and low cholesterol levels, and high unsaturated fatty acids. These qualities have been recognized by the World Health Organization, making goose meat an important source of nutritious food and making important contributions to global food safety and optimized nutrition.

[0003] The quality of goose meat is determined by the quality traits of goose meat, and the quality traits of goose meat are comprehensively affected by various factors such as breed differences, slaughter methods, and unbalanced breeding improvements. Among them, the surrounding environment is a key factor affecting the quality traits of goose meat. Coupled with the need to collect a sufficient number of individuals to statistically analyze the quality traits of goose meat, it requires a large amount of human resources and time costs, with low efficiency and unsatisfactory results.

[0004] The pH value is one of the important factors affecting the quality of goose meat and is widely used to evaluate the quantitative traits of goose meat quality. The selection of the pH value is also jointly affected by various factors such as breed, slaughter method, post-slaughter treatment, and physiological state. Since the pH value is jointly regulated by multiple factors and the phenotypic statistics is difficult, there is an urgent need for a convenient, efficient, and highly accurate biological means to promote the breeding work of goose meat breeds. Summary of the Invention

[0005] To solve the above technical problems, the present invention provides a method for detecting SNP molecular markers for the pH value of goose meat quality. The identified SNPs can provide theoretical support for screening goose meat quality, provide important references for improving goose meat quality and breeding, and provide a new direction for developing breeding markers.

[0006] The technical solution adopted by the present invention to solve its technical problems is: A method for detecting SNP molecular markers for the pH value of goose meat quality includes the following steps:

[0007] S1, align the whole-genome resequencing data of the goose to be detected to the reference genome sequence, combine the pH value data of the goose meat to be detected, and screen candidate SNP sites for the pH value of the goose meat to be detected through genome-wide association analysis;

[0008] S2, use the technology of matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS) to detect the distribution frequency of SNP sites in goose individuals and perform association analysis with the pH value trait of goose meat.

[0009] Preferably, the 30 SNP sites include the following:

[0010] chr13:31574342, chr17:23566904, chr17:23566877, chr5:29563347, chr13:31574379, and chr13:31599541;

[0011] The 9 SNPs include the following: chr37:5044859, chr17:23683245, chr21:2614659, chr15:1248686, chr8:31941519, chr5:29563347, chr13:31599746, chr17:23566904, chr21:2584087.

[0012] SNP locus 2nd-PCRP amplification primer 1st-PCRP amplification primer UEP_SEQ extension primer chr13:31599746 ACGTTGGATGACTTGGCACATGATGGCTAC ACGTTGGATGGACACCAGGAGTGTTTTTTG aggcTGGCTACTTTTACTGGAA chr15:1248686 ACGTTGGATGGTGGTGATGGTGCTTAATGC ACGTTGGATGTACTGAATTCATCCACGCCG ccctTGTGAGACCTGATCACT chr17:23566904 ACGTTGGATGGTCTGAAGTTACAGATATCC ACGTTGGATGATAAGGAATTGGAGGACAAG aGAAGTTACAGATATCCATTAAAAAT chr17:23683245 ACGTTGGATGTTCCCTCCCCCACATTTTTC ACGTTGGATGCAGTACATACTATTATCTCAG aagTTTAAAAATTGTCTGCAGATTC chr21:2584087 ACGTTGGATGGCTAAAAAGGAAAAGCTACC ACGTTGGATGGAGGTGTTTCGTGTCGTATG GGAAAAGCTACCTTTAAATTC chr21:2614659 ACGTTGGATGCAGCCTTTTCTTGCACACTC ACGTTGGATGACCTCTCACTTTCTGAAAGC ccTAAAGCCCCCTATTGCCA chr37:5044859 ACGTTGGATGAACAGACAAGCATCCTGCAC ACGTTGGATGTCTGGGGTCTGCTGGAGAG ccccaAAGCATCCTGCACCAGCTGGC chr5:29563347 ACGTTGGATGTTTGAACTGACTGTCTCAGG ACGTTGGATGGGTTGCGAACCTGTAGAATG gcttTCTCAGGACAATAACCATGA chr8:31941519 ACGTTGGATGCAAGCAGACTACTCAGACAC ACGTTGGATGTACACAGGTGAAAGCACTGG ACACACACAGCAACGGGCA Preferably, the genotypes of the SNPs significantly correlated with the pH value are as follows:

[0013] Advantages of the present invention:

[0014] The present invention uses molecular marker methods to select male geese with high-quality goose meat, quickly and accurately screening out individuals with target traits from goslings to 70-day-old geese, thus greatly improving the selection efficiency. 30 SNP loci related to the pH value of goose meat quality are discovered, and the flight mass spectrometry method is used for verification. The SNPs identified by this scheme can provide theoretical support for the screening of goose meat quality, provide important references for the improvement of goose meat quality and breeding, provide a new direction for the development of breeding markers, and can also significantly promote molecular breeding work, having important theoretical and commercial values. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments. Obviously, the following drawings are only 14 of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0016] Figure 1 Primer sequences for detecting the pH traits of goose meat quality;

[0017] Figure 2 Manhattan plot of the genome-wide association analysis of the muscle pH value of Sichuan White Geese;

[0018] Figure 3 Q-Q plot of the genome-wide association analysis of the muscle pH value of Sichuan White Geese;

[0019] Figure 4 Genotypes of SNPs significantly associated with the pH value of goose meat

[0020] Figure 5 SNPs and candidate genes associated with the muscle pH value trait of Sichuan White Geese;

[0021] Figure 6 Results of MALDI-TOF mass spectrometry for chr13:31599746 in the examples of the present invention. Note: No call: Individuals with failed detection; C: CC genotype; T: TT genotype;

[0022] Figure 7 Results of MALDI-TOF mass spectrometry for chr15:1248686 in the examples of the present invention. Note: No call: Individuals with failed detection; T: TT genotype; C: CC genotype;

[0023] Figure 8 Results of MALDI-TOF mass spectrometry for chr17:23566904 in the examples of the present invention. Note: No call: Individuals with failed detection; T: TT genotype; C: CC genotype;

[0024] Figure 9 Results of MALDI-TOF mass spectrometry for chr17:23683245 in the examples of the present invention. Note: No call: Individuals with failed detection; G: GG genotype; A: AA genotype;

[0025] Figure 10 Results of MALDI-TOF mass spectrometry for chr21:2584087 in the examples of the present invention. Note: No call: Individuals with failed detection; G: GG genotype; A: AA genotype;

[0026] Figure 11 Results of MALDI-TOF mass spectrometry for chr21:2614659 in the examples of the present invention. Note: No call: Individuals with failed detection; A: AA genotype; T: TT genotype;

[0027] Figure 12 Results of MALDI-TOF mass spectrometry for chr37:5044859 in the examples of the present invention. Note: No call: Individuals with failed detection; G: GG genotype; T: TT genotype;

[0028] Figure 13 Results of MALDI-TOF mass spectrometry for chr5:29563347 in the examples of the present invention. Note: No call: Individuals with failed detection; G: GG genotype; T: TT genotype;

[0029] Figure 14Results of the flight mass spectrometry of chr8:31941519 in the embodiments of the present invention. Note: No call: individuals with failed detection; G: GG genotype; T: TT genotype. Detailed implementation manners

[0030] To deepen the understanding of the present invention, the present invention will be further described in detail below with reference to the drawings and embodiments. The embodiments are only used to explain the present invention and do not limit the protection scope of the present invention. Embodiment

[0031] A method for detecting SNP molecular markers of the pH value of goose meat. The present invention uses the method of molecular markers to select breeding male geese with high-quality goose meat, and quickly and accurately screens out individuals with target traits from goslings to 70-day-old stage, thereby greatly improving the breeding efficiency.

[0032] To achieve the above objectives, the technical solution of the present invention is as follows: The specific steps are as follows:

[0033] A1: Align the whole-genome resequencing data of the geese to be detected to the reference genome sequence, and combine the pH value data of the goose meat to be detected. Through genome-wide association analysis, 30 candidate SNP loci for the pH value of the goose meat to be detected are screened out;

[0034] A2: Test 30 SNP loci (chr13:31574342, chr17:23566904, chr17:23566877, chr5:29563347, chr13:31574379, and chr13:31599541) by time-of-flight mass spectrometry technology and count the distribution frequencies of 9 SNPs (chr37:5044859, chr17:23683245, chr21:2614659, chr15:1248686, chr8:31941519, chr5:29563347, chr13:31599746, chr17:23566904, chr21:2584087) in goose individuals, and perform association analysis with the pH value trait of goose meat. The results show that the above SNP loci and haplotypes are significantly or extremely significantly correlated with the pH value trait of goose meat.

[0035] B1: Collect venous blood from the wing veins of 215 male geese at 70 days old under vacuum, and extract genomic DNA; B2: Then, prepare a PCR primer stock solution with a final concentration of 100 p (umol / L) and a single-base primer stock solution with a final concentration of 500 p (umol / L), and perform a PCR reaction. The total reaction system is 5 μl (including 1.8 μl of dddH2O, 0.5 μl of 10* buffer, 0.4 μl of Mg2+, 0.1 μl of dNTP, 0.2 μl of Hotstar, 1 μl of F Primer / R Primer, and 1 (20 ng - 50 ng) μl of the DNA sample to be detected);

[0036] PCR amplification reaction: Pre-denature at 95°C for 2 min, then perform 45 cycles (denature at 95°C for 30 s, anneal at 56°C for 30 s, extend at 72°C for 60 s), extend at 72°C for 5 min, and store at 25°C.

[0037] B3: SAP enzyme digestion reaction. Prepare the SAP enzyme Mix. Pipette 1.53 * 460 μl of dddH2O, 0.17 * 460 μl of SAP Buffer, and 0.3 * 460 μl of SAP Enzyme. Then, perform SAP enzyme digestion in a PCR instrument at 37°C for 40 min and 85°C for 5 min in sequence, and store at 25°C.

[0038] B4: Single-base extension reaction: Prepare the single-base extension reaction Mix: Pipette 0.619 * 460 μl of dddH2O, 0.2 * 460 μl of 10*iplex buffer, 0.2 * 460 μl of Terminator mix, 0.94 * 460 μl of primer, and 0.041 * 460 μl of single-base extension enzyme; Pre-denature in a PCR instrument at 94°C for 30 s, 94°C for 5 s, 52°C for 5 s, and 80°C for 5 s (where 52°C for 5 s and 80°C for 5 s are for 5 internal cycles, and 94°C for 5 s, 52°C for 5 s, and 80°C for 5 s are for 40 external cycles), extend at 72°C for 3 min to perform the single-base extension reaction, and store at 25°C.

[0039] B5: Resin purification: Add 16 μl of dddH2O to a 384-well plate (containing the reaction product), centrifuge at 2000 r / 3 min; Then add the resin, perform a resin purification reaction on a rotary shaker for 35 min to desalt; After the reaction is completed, centrifuge again at 2000 r / 3 min;

[0040] Spot the desalted sample on the sample target and wait for natural crystallization.

[0041] B6: Mass spectrometry detection and data analysis: The reaction results obtained from B1 - B5 are detected on a nucleic acid flight mass spectrometer. The Typer 4.0 software is used to detect the mass spectrometry peaks, and the genotypes of the target sites of each sample are interpreted based on the mass spectrometry peak map.

[0042] SNP locus 2nd-PCRP amplification primer 1st-PCRP amplification primer UEP_SEQ extension primer chr13:31599746 ACGTTGGATGACTTGGCACATGATGGCTAC ACGTTGGATGGACACCAGGAGTGTTTTTTG aggcTGGCTACTTTTACTGGAA chr15:1248686 ACGTTGGATGGTGGTGATGGTGCTTAATGC ACGTTGGATGTACTGAATTCATCCACGCCG ccctTGTGAGACCTGATCACT chr17:23566904 ACGTTGGATGGTCTGAAGTTACAGATATCC ACGTTGGATGATAAGGAATTGGAGGACAAG aGAAGTTACAGATATCCATTAAAAAT chr17:23683245 ACGTTGGATGTTCCCTCCCCCACATTTTTC ACGTTGGATGCAGTACATACTATTATCTCAG aagTTTAAAAATTGTCTGCAGATTC chr21:2584087 ACGTTGGATGGCTAAAAAGGAAAAGCTACC ACGTTGGATGGAGGTGTTTCGTGTCGTATG GGAAAAGCTACCTTTAAATTC chr21:2614659 ACGTTGGATGCAGCCTTTTCTTGCACACTC ACGTTGGATGACCTCTCACTTTCTGAAAGC ccTAAAGCCCCCTATTGCCA chr37:5044859 ACGTTGGATGAACAGACAAGCATCCTGCAC ACGTTGGATGTCTGGGGTCTGCTGGAGAG ccccaAAGCATCCTGCACCAGCTGGC chr5:29563347 ACGTTGGATGTTTGAACTGACTGTCTCAGG ACGTTGGATGGGTTGCGAACCTGTAGAATG gcttTCTCAGGACAATAACCATGA chr8:31941519 ACGTTGGATGCAAGCAGACTACTCAGACAC ACGTTGGATGTACACAGGTGAAAGCACTGG ACACACACAGCAACGGGCA

[0043] The technical principle and significant results of the present invention are as follows: This technical solution uses the method of molecular markers to select male geese with goose meat pH value, and quickly and accurately screens out individuals with target traits from goslings to 70 - day - old geese, thereby greatly improving the breeding efficiency.

[0044] The embodiments of the present invention include the following steps:

[0045] For the whole - genome re - sequencing data of Sichuan White Geese, the filtered reads are aligned with the goose genome using the BWA software. Subsequently, the GATK (3.8.1) software is used for SNP detection, and the Plink software is used for filtering to obtain 9 SNP loci related to goose meat pH value. After technical verification of the 9 SNP loci (chr37:5044859, chr17:23683245, chr21:2614659, chr15:1248686, chr8:31941519, chr5:29563347, chr13:31599746, chr17:23566904, chr21:2584087) by time - of - flight mass spectrometry, the distribution frequencies in Sichuan White Goose individuals are statistically analyzed and association analysis is performed. The above - mentioned SNP loci are significantly or extremely significantly correlated with the goose meat pH value trait (p < 0.05).

[0046] 9 SNP molecular marker primers are detected as Figure 1 shown: Time - of - flight mass spectrometry primer sequences

[0047] The re - sequencing is the whole - genome re - sequencing sequence of Sichuan White Geese, and the reference genome is the reference genome sequence of Sichuan White Geese.

[0048] The method described above includes the following steps:

[0049] B1: Collect venous blood from the wing veins of 215 male Sichuan white geese at 70 days old by vacuum, and extract genomic DNA; B2: Then, prepare a PCR primer stock solution with a final concentration of 100 p (umol / L) and a single-base primer stock solution with a final concentration of 500 p (umol / L), and perform a PCR reaction. The total reaction system is 5 μl (including 1.8 μl of dddH2O, 0.5 μl of 10* buffer, 0.4 μl of Mg2+, 0.1 μl of dNTP, 0.2 μl of Hotstar, 1 μl of F Primer / R Primer, 1 (20 ng - 50 ng) μl of the DNA sample to be detected);

[0050] PCR amplification reaction: Pre-denaturation at 95°C for 2 min, then 45 cycles (denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 60 s), extension at 72°C for 5 min, and storage at 25°C.

[0051] B3: SAP enzyme digestion reaction. Prepare the SAP enzyme Mix. Pipette 1.53 * 460 μl of dddH2O, 0.17 * 460 μl of SAP Buffer, and 0.3 * 460 μl of SAP Enzyme. Then, perform SAP enzyme digestion in a PCR instrument at 37°C for 40 min and 85°C for 5 min in sequence, and store at 25°C.

[0052] B4: Single-base extension reaction: Prepare the single-base extension reaction Mix: Pipette 0.619 * 460 μl of dddH2O, 0.2 * 460 μl of 10*iplex buffer, 0.2 * 460 μl of Terminator mix, 0.94 * 460 μl of primer, and 0.041 * 460 μl of single-base extension enzyme; Pre-denature in a PCR instrument at 94°C for 30 s, 94°C for 5 s, 52°C for 5 s, and 80°C for 5 s (where 52°C for 5 s and 80°C for 5 s are performed for 5 internal cycles, and 94°C for 5 s, 52°C for 5 s, and 80°C for 5 s are performed for 40 external cycles), extension at 72°C for 3 min, and perform the single-base extension reaction: Store at 25°C.

[0053] B5: Resin purification: Add 16 μl of dddH2O to a 384-well plate (containing the reaction product), centrifuge at 2000 r / 3 min; Then add resin, perform a resin purification reaction on a rotary shaker for 35 min to desalt; After the reaction is completed, centrifuge again at 2000 r / 3 min;

[0054] Dot the desalted sample on the sample target and wait for natural crystallization.

[0055] B6: Mass spectrometry detection and data analysis: The reaction results obtained from B1 - B5 were detected using a nucleic acid MALDI-TOF mass spectrometer. The Typer 4.0 software was used to detect the mass spectrometry peaks, and the genotypes of the target sites of each sample were interpreted based on the mass spectrometry peak pattern.

[0056] Taking 215 healthy male Sichuan white geese as the research objects. At 10 weeks of age (i.e., 70 days old), the selected geese were sacrificed by cervical exsanguination, and blood samples were collected by vacuum venipuncture from the wing vein to complete the collection of blood samples. The pH values at a depth of 1 cm in the pectoralis major muscle were measured at three fixed points on the right pectoral muscle of the geese using a calibrated portable pH meter (LP115, Metall Zug Group, Zurich, Switzerland) to complete the determination data of meat pH values.

[0057] Whole-genome resequencing of 215 70-day-old Sichuan white geese was performed at 9.9× depth using the sequencing mode of the Illumina HiSeq X Ten platform. The original Sequenced Reads were filtered, and the adapter and low-quality reads were removed using the NGS QC Toolkit software to obtain Clean Reads. The filtered reads were aligned with the goose genome using the BWA software, and then the SNP detection was performed using the GATK (3.8.1) software, and the filtering was performed using the Plink software. A total of 185 individuals passed the quality inspection, and the passing rate of the sampled samples was 87.5%.

[0058] The GEMMA software was used to construct a mixed linear model (MLM) to identify SNPs associated with the muscle pH trait in geese. The model used was as follows: y = Gα + xβ + e. Where, y represents the trait phenotypic value; G represents the covariance matrix; α represents the coefficient vector including the intercept; x represents the corresponding SNP; β represents the SNP; represents the random residual. The Wald test statistic and applied Bonferroni’s correction were used to evaluate the significance of the association between the SNP and the phenotype, and the association results were corrected. Using the "gap" package in the R (V4.3.1) software, SNP molecular markers related to the muscle pH trait, such as Figure 2 and Figure 3 .

[0059] The genotypes and frequencies of the above 9 SNPs were detected in the Sichuan white goose population using time-of-flight mass spectrometry technology, such as Figure 3 .

[0060] There are many ways to detect SNP, such as HTS, dPCR, SMRT, RFLP, etc. The present invention mainly provides 9 molecular markers for pH value traits of goose meat, and corresponding detection methods can be used according to actual conditions.

[0061] Unless otherwise specified, all reagents and materials used in the present invention were purchased.

[0062] The Sichuan white goose samples used in the present invention are all from the Anfu Waterfowl Breeding Base in Chongqing, China, and are selected from male Sichuan white geese hatched from the same batch. The experimental geese are raised in iron flat mesh cages, and the feed is based on the NRC (1994) international standard, and routine immunization is performed, and food and drinking water are free to be consumed. The pH value of the meat of 215 Sichuan white geese is statistically analyzed. Example

[0063] Genome-wide association analysis of pH value in goose meat

[0064] Genome-wide association analysis: C1 Vacuum blood was collected from the wing veins of 215 male Sichuan white geese at 70 days of age, and genomic DNA was extracted from the goose blood samples using the Ezup Column blood genomic DNA extraction kit of Tiangen Biochemical Technology (Beijing) Co., Ltd.; C2: 200uL of venous blood was taken from each sample, anticoagulant was added, and placed in a 1.5ml test tube consistent with the sample number. Insufficient amount can be supplemented by adding buffer GA. Add 4uL RNase A (100mg / ml), shake for 15 seconds and let stand at room temperature for 5 minutes. Add 20uL Proteinase K solution and mix well, then add 200uL buffer GB, place in a 70℃ water bath for 10 minutes to make the solution clear, and then centrifuge to remove water droplets on the inner wall of the tube cap. Add 200uL anhydrous ethanol, shake and mix thoroughly for 15 seconds, flocculent precipitation may appear, and then centrifuge to remove water droplets on the inner wall of the tube cap.

[0065] C3: Add the obtained solution and flocculent precipitate to the adsorption column CB3 in sequence, centrifuge at 12,000rpm (~134,000xg) for 30 seconds, discard the waste liquid and put the adsorption column CB3 back into the collection tube. Add 500uL buffer GD and 600uL rinse solution PW to the adsorption column CB3 in sequence, centrifuge for 30 seconds each time, discard the waste liquid and put the adsorption column CB3 back into the collection tube.

[0066] C4: Finally, centrifuge the adsorption column at 12,000rpm (~134,000xg) for 2 minutes and discard the waste liquid. Place the adsorption column CB3 at room temperature for 3-5 minutes to dry the remaining rinse liquid in the adsorption material, and then transfer it to a clean centrifuge tube. Add 60uL of elution buffer TE to the middle of the adsorption membrane, place it at room temperature for 2-5 minutes, and then centrifuge it at 12,000rpm (~134,000xg) for 2 minutes. The eluted DNA is immediately used for quality testing, and the remaining samples are stored at -20℃ for later use.

[0067] C5: Take 1.0 μL of the DNA sample and use a Nanodrop 2000 nucleic acid concentrator to detect the DNA concentration, ensuring that the OD260 / 280 ratio is between 1.8 and 1.89. Use Qubit to accurately quantify the DNA concentration, ensuring that the concentration of the extracted DNA sample is greater than or equal to 15 ng / μL. Take 1.0 μL of the DNA sample and detect the DNA degradation degree and integrity by 1% agarose gel electrophoresis (100 V, 45 min). Use a spectrophotometer to detect the purity, and the extracted sample meets the requirements. Dissolve it in TE solution and store it at -20°C. Transport the genomic DNA in a dry ice foam box to Novogene Co., Ltd. in Beijing for whole-genome resequencing.

[0068] Perform whole-genome resequencing at a depth of 9.9× on 215 70-day-old Sichuan white geese, using the sequencing mode of the Illumina HiSeq X Ten platform. Filter the original Sequenced Reads, use the NGS QC Toolkit software to remove adapters and low-quality reads to obtain Clean Reads, use the BWA software to align the filtered reads with the goose genome, then use the GATK (3.8.1) software to detect SNPs, and use the Plink software to filter. A total of 185 individuals passed the quality inspection, and the qualified rate of the sampled samples was 87.5%.

[0069] The GEMMA software constructs a mixed linear model (MLM) to identify SNPs associated with the pH trait of goose meat. The model used is as follows: y = Gα + xβ + e. Where, y represents the trait phenotypic value; G represents the covariance matrix; α represents the coefficient vector including the intercept; x represents the corresponding SNP; β represents the SNP; represents the random residual. The Wald test statistic and applied Bonferroni’s correction are used to evaluate the significance of the association between the SNP and the phenotype, and the association results are corrected. Use the "gap" package in R (V4.3.1) software for SNP molecular markers related to the pH value trait of goose meat, such as Figure 2 、 Figure 3 and Figure 5 。

[0070] Use the time-of-flight mass spectrometry method to detect the distribution frequency of candidate SNPs for the pH trait of goose meat in Sichuan white geese. Then, use the whole-genome DNA of 185 geese as the experimental object to verify the SNP sites by time-of-flight mass spectrometry.

[0071] Instruments and reagents used: For gene amplification: GeneAmp® 9700 384 Dual (ABI); for mass spectrometry spotting: MassARRAY Nanodispenser RS1000 (Agena); iPLEX®Gold; for mass spectrometry analysis: MassARRAY CompactSystem (Agena);

[0072] Reagents: Complete Genotyping Reagent Kit for MassARRAY® Compact 384 (Agena).

[0073] Primer design: Primer design was carried out using the Assay Design 3.1 software of Agena company according to the SNP sites.

[0074] Synthesis and quality inspection of primers: The primers synthesized by the primer synthesis company were subjected to quality inspection using a matrix-assisted laser desorption / ionization time-of-flight mass spectrometer (MALDI-TOF) to detect whether the actual molecular weight was consistent with the theoretical molecular weight and whether the primer purity met the experimental requirements. The specific operation was as follows: 2 μl of each synthesized extension primer was taken to prepare a Mix, and 2 μl was taken from the extension primer Mix and added to 40 μl of dddH2O for mass spectrometry detection. The molecular weight of the obtained peak pattern should be consistent with the theoretical value and there should be no miscellaneous peaks. (61) Electrophoresis conditions: The agarose gel concentration was 1.5%, the dye was EB (0.5 μg / ml), and GoldView could also be used. The total volume of sample loading in the lane was 5 μl (4 μl of loading buffer + 1 μl of gDNA), and the Marker was 5 μl (DL15000).

[0075] Preparation of PCR primer stock solutions with a final concentration of 100 p (μmol / L) and single-base primer stock solutions with a final concentration of 500 p (μmol / L), and carrying out PCR reactions. The total reaction system was 5 μl (including 1.8 μl of dddH2O, 0.5 μl of 10* buffer, 0.4 μl of Mg2+, 0.1 μl of dNTP, 0.2 μl of Hotstar, 1 μl of F Primer / R Primer, 1 μl (20 ng - 50 ng) of the DNA sample to be detected);

[0076] PCR amplification reaction: Pre-denaturation at 95°C for 2 min, then 45 cycles (denaturation at 95°C for 30 s, annealing at 56°C for 30 s, extension at 72°C for 60 s), extension at 72°C for 5 min, and storage at 25°C.

[0077] B3: SAP enzyme digestion reaction. Prepare the SAP enzyme Mix. Pipette 1.53 * 460 μl of dddH2O, 0.17 * 460 μl of SAP Buffer, and 0.3 * 460 μl of SAP Enzyme. Then, perform SAP enzyme digestion in a PCR instrument successively at 37°C for 40 min and 85°C for 5 min, and store at 25°C.

[0078] B4: Single-base extension reaction: Prepare the single-base extension reaction Mix: Pipette 0.619 * 460 μl of dddH2O, 0.2 * 460 μl of 10 * iplex buffer, 0.2 * 460 μl of Terminator mix, 0.94 * 460 μl of primer, and 0.041 * 460 μl of single-base extension enzyme; pre-denature in a PCR instrument at 94°C for 30 s, 94°C for 5 s, 52°C for 5 s, and 80°C for 5 s (where 52°C for 5 s and 80°C for 5 s are performed for 5 internal cycles, and 94°C for 5 s, 52°C for 5 s, and 80°C for 5 s are performed for 40 external cycles), and 72°C for 3 min to perform the single-base extension reaction; store at 25°C.

[0079] B5: Resin purification: Add 16 μl of dddH2O to a 384-well plate (containing the reaction product), centrifuge at 2000 r / 3 min; then add resin, perform resin purification reaction on a rotary shaker for 35 min to desalt; after the reaction is completed, centrifuge again at 2000 r / 3 min;

[0080] Dot the desalted sample on the sample target and wait for natural crystallization.

[0081] B6: Mass spectrometry detection and data analysis: Detect the reaction results obtained in B1 - B5 on a nucleic acid mass spectrometer, detect the mass spectrometry peaks using Typer4.0 software, and interpret the genotypes of the target sites of each sample according to the mass spectrometry peak map.

[0082] The technical features of the above embodiments can be combined arbitrarily. For the sake of brevity of description, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, it should be considered as falling within the scope described in this specification.

[0083] The above-described embodiments merely represent several implementation manners of the present application. Their descriptions are relatively specific and detailed, but they should not be construed as limiting the scope of the invention patent. It should be noted that for those of ordinary skill in the art, without departing from the concept of the present application, several modifications and improvements can still be made, and these all belong to the protection scope of the present application. Therefore, the protection scope of the patent of the present application should be subject to the appended claims.

Claims

1. A method for SNP molecular marker for detecting the pH value of goose meat, characterized in that Including the following steps: S1. Align the whole-genome resequencing data of the geese to be detected with the reference genome sequence, and combine the pH value data of the goose meat to be detected. Through genome-wide association analysis, candidate SNP sites for the pH value of the goose meat to be detected are screened and obtained. S2. Use the technology of matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS) to detect the distribution frequency of SNP sites in goose individuals and conduct association analysis with the pH value trait of goose meat. The SNP molecular markers for the pH value of goose meat include 9 SNPs, specifically as follows: chr37:5044859, chr17:23683245, chr21:2614659, chr15:1248686, chr8:31941519, chr5:29563347, chr13:31599746, chr17:23566904, and chr21:2584087; The primer pairs for detecting 9 SNP molecular markers are: 。

Images