SNP2-188997159 molecular marker related to content of notoginsenoside R1 in panax notoginseng and application thereof

Abstract

The application discloses a kind of detection and ginsenoside R1 content related SNP molecular marker kit in ginseng in ginsenoside R1 content character breeding in ginseng, its characterized in that: the SNP molecular marker is SNP2-188997159, located in the 188997159 base of Chr5 chromosome, and its mutation type is G / A.The KASP primer combination developed in the application can accurately distinguish ginsenoside R1 content high and low ginseng, and can be applied to ginseng molecular assisted marker breeding, shorten new variety cultivation cycle, and detection cost is lower, not limited by environment, detection result accuracy is high, easy to repeat.For speeding up the genetic improvement process of high ginsenoside R1 content ginseng breeding, it has important theoretical and practical guiding significance to improve breeding selection efficiency.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of molecular genetic breeding, and particularly relates to a SNP molecular marker related to the content of ginsenoside R1 in Panax notoginseng and application thereof. BACKGROUND

[0002] Panax notoginseng is a perennial herb of the genus Panax in the family Araliaceae, and its roots and rhizomes are used as medicines. Panax notoginseng has the effects of removing blood stasis, stopping bleeding, and relieving swelling and pain. Panax notoginseng is one of the most valuable traditional Chinese medicinal materials in China. Panax notoginseng is widely used in clinical practice, and is one of the main raw materials of Xuesaitong soft capsules, Yunnan white medicine, compound salvia miltiorrhiza tablets, compound salvia miltiorrhiza dripping pills, and Zhangzhou Banling Decoction. Panax notoginseng saponins are the main active ingredients in Panax notoginseng, and the content and types of saponins are important indicators for evaluating the quality of Panax notoginseng.

[0003] Quality breeding is the core measure of good seed selection. Studies have shown that the excellent allelic variation of key genes controlling important agronomic traits can be effectively utilized in molecular marker-assisted selection breeding through the development of allelic specific molecular markers. Panax notoginseng variety selection mainly adopts group mixed selection method, mainly relies on phenotypic selection, and obtains population varieties, which is the main breeding method for Panax notoginseng variety selection at present. However, Panax notoginseng requires at least 3 years per generation, and the speed of phenotypic separation and population construction is extremely slow, and there is also a lack of early selection and identification means, resulting in a long breeding cycle, low efficiency, and the need for 15-20 years to cultivate a new variety. At the same time, Panax notoginseng is a common cross-pollinated plant, and there is no pure line breeding material to date, which seriously limits the application of hybrid breeding methods in Panax notoginseng variety selection. It is also difficult to use distant hybridization for Panax notoginseng quality improvement.

[0004] With the development of omics technology, molecular genetic breeding of medicinal plants based on molecular markers can greatly improve the breeding efficiency, and make it possible to carry out molecular design breeding for targeted improvement of effective components of medicinal plants. SNP marker (single nucleotide polymorphism) mainly refers to DNA sequence polymorphism caused by single nucleotide variation at the genome level, which is the highest in polymorphism coverage and density among current molecular markers. Compared with traditional molecular marker-assisted selection, high-throughput resequencing technology can generate large-scale SNP markers, promote accurate association analysis of markers and traits, and improve the efficiency of molecular-assisted selection breeding. The content and types of saponins in Panax notoginseng should be the core target of Panax notoginseng variety selection. Therefore, it is particularly important to use known saponin biosynthesis genes and rich Panax notoginseng germplasm resources to excavate SNPs significantly associated with the content of ginsenoside R1 in Panax notoginseng, develop KASP molecular markers for assisted breeding, and realize early molecular-assisted selection of target traits to improve breeding efficiency. SUMMARY

[0005] In view of the above problems, the present application aims to provide a SNP molecular marker related to the content of ginsenoside R1 in Panax notoginseng and application thereof.

[0006] To achieve the above-mentioned purpose, the technical solution adopted by the present application is as follows:

[0007] The present application provides application of a kit for detecting a SNP molecular marker related to the content of ginsenoside R1 in Panax notoginseng in breeding of the content of ginsenoside R1 in Panax notoginseng, characterized in that the SNP molecular marker is SNP2-188997159, which is located at base position 188997159 of Chr5 chromosome, and the mutation type thereof is G / A.

[0008] Preferably, in the SNP2-188997159, the content of ginsenoside R1 of AA genotype is higher than that of GG / GA genotype.

[0009] The present application also provides application of a KASP primer pair for detecting a SNP molecular marker related to the content of ginsenoside R1 in Panax notoginseng in breeding of the content of ginsenoside R1 in Panax notoginseng, characterized in that the KASP primer pair comprises an upstream primer SNP2-F1, an upstream primer SNP2-F2 and a downstream primer SNP2-R for detecting the SNP2-188997159.

[0010] Preferably,

[0011] The SNP2-F1 is 5'-GAAGGTGACCAAGTTCATGCTTCCAACGAAATCTCCGCCG-3';

[0012] The SNP2-F2 is 5'-GAAGGTCGGAGTCAACGGATTTCCAACGAAATCTCCGCCA-3';

[0013] The SNP2-R is 5'-CCCATGATACTCACAGCGGG-3'.

[0014] The present application also provides a method for detecting the content of ginsenoside R1 in Panax notoginseng, comprising the following steps:

[0015] (1) extracting DNA of a sample of Panax notoginseng to be detected as a template;

[0016] (2) performing PCR amplification on the template by using the KASP primer pair in claim 3 or 4;

[0017] (3) reading the fluorescence signal after PCR amplification is completed by a high-throughput genotyping system GeneMatrix, and analyzing and converting the fluorescence signal to genotype the SNP2-188997159 molecular marker site of the ginsenoside R1 content sample to be identified in Panax notoginseng;

[0018] (4) the method for determining the ginsenoside R1 content phenotype of the Panax notoginseng sample in step (3) is as follows: if the genotype determined is AA, it is determined that the ginsenoside R1 content in the Panax notoginseng sample is high; if the genotype determined is GG / GA, it is determined that the ginsenoside R1 content in the Panax notoginseng sample is low.

[0019] Preferably, the PCR amplification program is as follows: 95℃ pre-denaturation for 10 min; 95℃ denaturation for 20 sec; 61-55℃ annealing for 40 sec, decreasing 0.6℃ for each cycle, 10 cycles; 95℃ denaturation for 20 sec, 55℃ annealing for 40 sec, 40 cycles.

[0020] Preferably, the PCR amplification system is as follows: 15 ng / μL of DNA template 1 μL; 2×KASP Master mix 1 μL; KASP mixed primers 0.01 μL, wherein the volume ratio of the upstream primer SNP2-F1, the upstream primer SNP2-F2 and the downstream primer SNP2-R is 1:1:3.

[0021] The present application has the following beneficial effects:

[0022] The SNP significantly related to the ginsenoside R1 content in Panax notoginseng provided by the present application is obtained by performing association analysis on 236 Panax notoginseng natural populations, using SNP sites as genotype data, using the ginsenoside R1 content as its phenotype data, using EMMAX software, and using a mixed linear model (MLM) to perform whole genome association (GWAS) analysis screening. The SNP molecular marker SNP2-188997159 is located at the 188997159th base of Chr5 chromosome, and provides technical support for molecular marker assisted breeding of the ginsenoside R1 content trait in Panax notoginseng.

[0023] The KASP primer combination developed by the application can directly distinguish and detect the mutation site G or A base of SNP2-188997159. When the KASP primer combination is used to identify the content of ginsenoside R1, the two genotypes can be clearly separated. In the molecular marker SNP2-188997159, the dot close to the Y axis is the AA allelic variation site, and the genotype is AA. The content of ginsenoside R1 of the ginseng of this genotype is relatively high. The dot close to the X axis is the GG allelic variation site, and the genotype is GG. The content of ginsenoside R1 of the ginseng of this genotype is relatively low. The KASP primer combination developed by the application has good application value, can realize the pre-selection and molecular assisted breeding of the content of ginsenoside R1 of ginseng, and has important theoretical and practical guiding significance for improving the breeding selection efficiency of the content of ginsenoside R1 of ginseng. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 It is a Manhattan and QQ-plot graph of GWAS results of ginsenoside R1 in ginseng.

[0025] Figure 2 It is a statistical graph of allelic variation and phenotype of ginsenoside R1 content in ginseng.

[0026] Figure 3 It is a genotyping result of different ginseng samples by KASP special primer. DETAILED DESCRIPTION

[0027] The specific embodiments of the application will be further described below. It should be noted that the description of these embodiments is used to help understand the application, but does not constitute a limitation on the application. In addition, the technical features involved in each embodiment of the application described below can be combined with each other as long as they do not conflict with each other.

[0028] Example 1

[0029] Obtaining of nucleotide mutation site (SNP) related to ginsenoside R1 content in ginseng

[0030] (1) DNA extraction and high-throughput sequencing:

[0031] Take 236 ginseng natural population materials, extract genomic DNA by CTAB method, and perform 10X whole genome resequencing.

[0032] (2) Determination of ginsenoside R1 content:

[0033] The notoginseng sample was dried at 50°C until constant weight, and then crushed with a pulverizer and passed through a No. 4 sieve. 0.6 g of the sample was precisely weighed, 50 ml of methanol was added, and the bottle was sealed with a sealing film. The mixture was ultrasonicated for 30 min, and then allowed to stand for 20 h. The sealing film was removed, the weight was measured, and the lost weight was made up with methanol. The mixture was shaken and filtered with a 0.22 μm microporous filter to obtain 1 ml of a test solution. The ginsenoside R1 was quantitatively analyzed by HPLC using an external standard method. The column was Agilent ZORBAX SB-AQ (3.5 μm, 4.6 x 150 mm), the flow rate was 0.7 ml / min, the column temperature was 30°C, the injection volume was 10 μl, the detection wavelength was 203 nm, and the mobile phase was acetonitrile (A) and H2O (B). The elution gradient was 19% (A) for 0-12 min and 19-36% (A) for 12-60 min. The compounds were identified according to the retention time, and quantified by an external standard method using the peak area as the quantitative basis.

[0034] (3) Genome-wide association analysis (GWAS)

[0035] The SNP site was used as the genotype data, the ginsenoside R1 content was used as the phenotype data, the EMMAX software was used, and the mixed linear model (MLM) was used for genome-wide association (GWAS) analysis. The results are shown in Table 1. Figure 1 The threshold value of -log10(P) > 6 was used, and the SNP molecular marker SNP2-188997159 significantly associated with ginsenoside R1 was located at the 188997159th base of Chr11 chromosome. The sequence allelic variation of the SNP was extracted by aligning the notoginseng reference genome, and combined with the ginsenoside R1 content of the population material for joint analysis. The SNP2-188997159 had three genotypes GG, AA and GA, and the T test was used to find that the ginsenoside R1 content in the AA genotype was higher, which was the dominant genotype. Figure 2

[0036] The gene sequence containing 100 bp before and after the SNP2-188997159 site is shown in SEQ ID NO. 1:

[0037] ​CAAAGTCTCCAATTTCTCCGATCTGATCCACCGCGTCACCACTTCGTGCTTTCTCCACCCTCTTGCCGGCGGCCACTACCAGTCCAACGAAATCTCCGCC[G / A]GTGGCGACTCCATTAACGTCGTCGATCCCGCTGTG AGTATCATGGGGTAGTCCAACACCGTCGATCCCGCTGTGATTCCATTAACTCCATTAATAGGCTC (SEQ ID NO. 1)

[0038] Development of SNP marker KASP specific primers

[0039] Three primers were designed according to the sequence of SEQ ID NO. 1 using the Primer-BLAST function of NCBI, the upstream primer F1, the upstream primer SNP2-F2 and the downstream primer SNP2-R, wherein SNP2-F1 and SNP2-F2 respectively contain FAM and HEX fluorescent linker sequences (underlined), and the sequences are as follows:

[0040] SNP2-F1: 5’- GAAGGTGACCAAGTTCATGC TTCCAACGAAATCTCCGCCG-3’

[0041] SNP2-F2: 5’- GAAGGTCGGAGTCAACGGAT TTCCAACGAAATCTCCGCCA-3’

[0042] SNP2-R: 5’-CCCATGATACTCACAGCGGG-3’

[0043] Detection of genotypes of SNP sites in different Panax notoginseng samples and application thereof

[0044] The authenticity of SNP2-188997159 in Panax notoginseng natural population was verified by high-throughput genotyping system GeneMatrix (GM). Ninety-four Panax notoginseng single plant materials were randomly selected, and the genomic DNA of the samples was extracted. The genomic DNA was used as a template, and the SNP marker KASP specific primers developed in Example 2 were used for PCR amplification.

[0045] The PCR reaction system is as follows: 15 ng / μL of DNA template 1 μL; 2×KASP Master mix 1 μL; KASP mixed primer 0.01 μL, wherein the volume ratio of the upstream primer SNP2-F1, the upstream primer SNP2-F2 and the downstream primer SNP2-R is 1:1:3. The PCR amplification procedure is as follows: 95°C pre-denaturation for 10 min; 95°C denaturation for 20 sec; 61-55°C annealing for 40 sec, decreasing 0.6°C for each cycle, 10 cycles; 95°C denaturation for 20 sec, 55°C annealing for 40 sec, 40 cycles. After the PCR amplification is completed, the fluorescence signal is read, the fluorescence signal is converted and analyzed, and the fluorescence scanning result is automatically converted into a graph, and the two genotypes can be clearly separated by the two marker primers.

[0046] In the molecular marker SNP2-188997159, the dot close to the Y axis carries an AA allelic variation site, and the genotype is AA, and the content of gypenoside R1 of the ginseng of the genotype is relatively high; the dot close to the X axis carries a GG allelic variation site, and the genotype is GG, and the content of gypenoside R1 of the ginseng of the genotype is relatively low. Figure 3

[0047] The above describes the embodiments of the present application in detail, but the present application is not limited to the described embodiments. For those skilled in the art, various changes, modifications, replacements and variations can be made to the embodiments without departing from the principles and spirits of the present application, and still fall within the protection scope of the present application.​

Claims

1. The use of a kit for detecting a SNP molecular marker related to the content of ginsenoside R1 in Panax notoginseng in breeding the content of ginsenoside R1 in Panax notoginseng, characterized in that: The SNP molecular marker is SNP2-188997159, located at base 188997159 of chromosome 5, the mutation type is G / A; the gene sequence containing 100bp before and after SNP2-188997159 site is shown as SEQ ID NO. 1 and SEQ ID NO. 2; in the SNP2-188997159, the content of gypenoside R1 of AA genotype is higher than that of GG / GA genotype. ​ 2. Use of KASP primer pair for detecting the SNP2-188997159 molecular marker associated with the content of notoginsenoside R1 in Panax notoginseng as claimed in claim 1 in breeding the content of notoginsenoside R1 trait in Panax notoginseng, characterized in that: The KASP primer comprises an upstream primer SNP2-F1, an upstream primer SNP2-F2 and a downstream primer SNP2-R for detecting the SNP2-188997159; in the SNP2-188997159, the content of gypenoside R1 of AA genotype is higher than that of GG / GA genotype; The SNP2-F1: 5'- GAAGGTGACCAAGTTCATGCTTCCAACGAAATCTCCGCCG-3'; The SNP2-F2: 5'- GAAGGTCGGAGTCAACGGATTTCCAACGAAATCTCCGCCA-3'; The SNP2-R: 5'- CCCATGATACTCACAGCGGG-3'.

3. A method for detecting the content of ginsenoside R1 in Panax notoginseng, characterized in that: The method comprises the following steps: (1) extracting DNA of the sample to be tested as a template; (2) using the KASP primer in claim 2 to perform PCR amplification on the template; (3) reading the fluorescence signal after PCR amplification by using the high-throughput genotyping system GeneMatrix, and analyzing and converting the fluorescence signal, so as to perform genotyping on the SNP2-188997159 molecular marker site related to the content of gypenoside R1 in the sample to be identified in claim 1; (4) the method for determining the phenotype of the content of gypenoside R1 in the sample to be identified in step (3) is as follows: if the genotype is AA, it is determined that the content of gypenoside R1 in the sample is high; if the genotype is GG / GA, it is determined that the content of gypenoside R1 in the sample is low.

4. The method of claim 3, wherein, The program of the PCR amplification is: 95℃ pre-denaturation for 10min; 95℃ denaturation for 20sec; 61-55℃ annealing for 40sec, reducing 0.6℃ for each cycle, 10 cycles; 95℃ denaturation for 20sec, 55℃ annealing for 40sec, 40 cycles.

5. The method of claim 4, wherein, The system of the PCR amplification is: 15 ng / μL of DNA template 1μL; 2×KASP Master mix 1μL; KASP mixed primer 0.01μL, wherein the volume ratio of the upstream primer SNP2-F1, the upstream primer SNP2-F2 and the downstream primer SNP2-R is 1:1:3.

Images