Application of a Molecular Marker InDel_XE Related to Peanut Pod Size
By developing the molecular marker of peanut pod size related to InDel_XE, PCR amplification and electrophoresis detection, combined with traditional breeding methods, the problem of difficult pod size in peanut breeding is solved, and efficient breeding of high-yield large fruit varieties is achieved, reducing breeding costs.
Patent Information
- Application Number
- CN202411298083.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-18
- Publication Date
- 2025-07-11
- Estimated Expiration
- 2044-09-18
AI Technical Summary
The lack of effective molecular markers related to peanut pod size in the prior art leads to low peanut breeding efficiency and it is difficult to quickly select and breed high-yield large fruit varieties.
A peanut pod size-related molecular marker InDel_XE was developed, which was located at 106,694,064 bp on the chromosome of peanut 05. The marker was detected by PCR amplification and polyacrylamide gel electrophoresis. Combined with traditional breeding methods, the large fruit genotype carrying the marker was selected as donor parents for hybridization and self-crossing to ensure the stability of the trait.
The breeding cycle of high-yield large fruit peanut varieties has been significantly shortened, the breeding cost has been reduced, and the breeding efficiency has been improved.
Smart Images

Figure CN118910320B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant genetic engineering, and particularly relates to an application of a molecular marker for peanut pod size InDel_ XE Background Art
[0002] Cultivated peanut is an important oil and cash crop, providing nutrients such as protein for humans, widely planted in the world, being one of the three major oil crops in China, with the total output ranking first in the world and accounting for more than half of the total oil output in the country, which is important for ensuring edible oil safety. Molecular markers are based on genetic material variation, and various molecular markers have been used in peanut research, such as RFLP, RAPD, AFLP, SSR, etc., and new markers such as ISSR and MFLP have also been developed.
[0003] The development of biotechnology has enabled more new molecular markers to be applied in research, such as the identification of the fatty acid desaturase gene AhMITE1 , and the development of the AhTE marker for gene mapping; SNP is the most abundant structural variation in the genome, and a " Arachis_Axiom " SNP array has been developed based on high-throughput sequencing for peanut diversity detection and map construction; a large number of InDels have also been detected and InDel molecular markers have been developed, and the KASP molecular marker is commonly used in peanut germplasm breeding. Molecular markers have advantages such as high specificity, high stability, good repeatability, rich quantity, rapid detection, low requirements for samples, early detection, and facilitation of genetic linkage analysis. Combining with traditional breeding methods can accelerate the breeding of excellent peanut varieties. Summary of the Invention
[0004] The purpose of the present invention is to provide a molecular marker related to peanut pod size InDel_XE and its application in breeding, so as to solve the problem of the lack of molecular markers related to peanut pod size traits and provide more choices for peanut breeding.
[0005] The present invention provides a molecular marker related to peanut pod size InDel_XE , the marker is located on chromosome 05 of peanut, there is a structural variation at 106,694,064 bp, and this structural variation is located in the intron of the gene AhXE45GC , and the large-fruit material lacks 33 bp compared with the small-fruit material.
[0006] Specifically, the nucleotide sequence of the fragment of the gene sequence without deletion is as shown in SEQ ID NO: 2, and the nucleotide sequence of the fragment of the gene sequence with deletion is as shown in SEQ ID NO: 3.
[0007] The present invention further provides a primer for detecting the above-mentioned molecular marker related to peanut pod size InDel_XE
[0008] Specifically, the nucleotide sequences of its forward and reverse primers are as follows:
[0009] InDel_XE F: 5’- CAATTCTATCTTTCTTTCAATTATTATCC -3’;
[0010] InDel_XE R: 5’- CCAATGAATATAAATATGTCAAGATACG -3’.
[0011] The present invention particularly provides the molecular markers related to peanut pod size InDel_XE and the application of the primers in peanut breeding.
[0012] The present invention further provides a method for identifying peanut pod size, which comprises the following steps: using the primers to perform PCR amplification on a peanut genomic DNA sample, and if the amplification result shows a structural variation, i.e., a 33-bp deletion, it indicates that the peanut pods are larger, while if the amplification result shows no structural variation, it indicates that the peanut pods are smaller;
[0013] The structural variation refers to the structural variation at 106,694,064 bp on chromosome 05 of peanut, which is located in the intron of the gene AhXE45GC and the large-fruit material has a 33-bp deletion relative to the small-fruit material.
[0014] Specifically, the amplified product is observed and judged by polyacrylamide gel electrophoresis.
[0015] More specifically, when using the primers, if the polyacrylamide gel electrophoresis band of the amplified product is high, it indicates that the amplified fragment is long, indicating the absence of the structural variation; if the band is low, it indicates that the amplified fragment is short, indicating the presence of the structural variation.
[0016] The present invention also provides a method for breeding large-fruit peanut varieties, which comprises the following steps: selecting an excellent variety with a large-fruit genotype having a structural variation as the donor parent to cross with the recipient parent, identifying true hybrids in F1, performing amplification using the primers described in claim 3 or 4 in F2, selecting plants carrying the structural variation, and simultaneously performing field trait identification to select plants with large-fruit traits and excellent other agronomic traits;
[0017] The structural variation refers to the structural variation at 106,694,064 on chromosome 05 of peanut, which is located in the intron of the gene AhXE45GC and the large-fruit material has a 33-bp deletion relative to the small-fruit material. The large-fruit material is used as an excellent variety with a large-fruit genotype having a structural variation.
[0018] Optionally, it further includes self-crossing the selected excellent plants until the traits are stable (usually up to the F6 generation); molecular marker detection and field trait identification are carried out in each generation to ensure the stability and consistency of the target traits.
[0019] Furthermore, multi-point regional trials are also carried out on the excellent plant lines in the stable generations to evaluate their yield, fruit size, disease resistance and other agronomic traits.
[0020] Compared with the prior art, the beneficial technical effects of the present invention are as follows: The present invention identifies a molecular marker related to peanut pod size, named InDel_XE , which is located at the structural variation at 106,694,064 bp on peanut chromosome 05, and this structural variation is located in the intron of the gene AhXE45GC . Compared with the small-fruit material (the length of the corresponding fragment is 320 bp), a 33-bp base sequence is deleted in the large-fruit material, and its length is 287 bp.
[0021] Based on the molecular marker related to peanut pod size of the present invention InDel_XE can lay a foundation for the application practice of peanut molecular marker breeding. It can significantly shorten the breeding cycle of high-yield large-pod peanut varieties, reduce the breeding cost, and has application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0022] Figure 1 is AhXE45GC the structure of the gene and InDel_XE the development of molecular markers.
[0023] Figure 2 is InDel_XE the polyacrylamide gel electrophoresis result of the molecular marker.
[0024] Figure 3 is InDel_XE the proportion of the molecular marker in materials with different sizes of pods. Among them, the bar chart shows the percentage of each haplotype in RILs (A) and NAs (B). According to the pod length, RILs and NAs are divided into three categories: small (pod length < 30 mm), medium (30 mm < pod length < 40 mm) and large (pod length > 40 mm).
[0025] Figure 4 is InDel_XEAssociation analysis of molecular markers in RIL population and natural population. Among them, Figures A and B: Association analysis of HapI and haplotype HapII with pod length, pod width, pod surface area, seed length, weight of ten fruits, weight of ten kernels, seed width and seed area in 90 RILs (A) and 178 peanut NAs (B). Error bars represent the standard deviation of three biological replicates. **P < 0.01 (two-tailed t-test). Detailed implementation manners
[0026] The following combines the accompanying drawings and embodiments to illustrate the detailed implementation manners of the present invention. However, the following embodiments are only used to elaborate on the present invention in detail and do not limit the scope of the present invention in any way.
[0027] In the following embodiments, the instrument equipment involved, unless otherwise specified, are all conventional instrument equipment; the reagents involved, unless otherwise specified, are all commercially available conventional reagents; the test methods involved, unless otherwise specified, are all conventional methods. In the following embodiments, quantitative tests are all set with three repeated experiments, and the results are averaged. The primer synthesis and sequencing work are all completed by Sangon Biotech (Shanghai) Co., Ltd.
[0028] Example 1: Molecular markers related to peanut pod size traits InDel_XE Obtaining
[0029] Combined with forward genetics to mine genes related to peanut pod size traits, specifically as follows:
[0030] (1) Construct a population from two materials with extreme pod sizes selected in the early stage of the laboratory. Then, select and calculate individuals for BSA analysis. The result shows that there is a QTL on chromosome 05 that is tightly linked to pod size.
[0031] (2) To further finely map the target gene, we developed polymorphic InDel molecular marker association analysis on chromosome 05. Finally, it was found that the molecular marker InDel_XE is tightly linked to pod size.
[0032] (3) To verify the sequence differences of the above InDel molecular marker, its nucleotide sequence was cloned and sequenced.
[0033] The specific steps are as follows:
[0034] 1.1 DNA extraction
[0035] Extract DNA using the SLS method respectively (HapI: InDel exists; HapII: InDel does not exist).
[0036] 1.2 InDel_XE Marker sequence cloning and sequence analysis
[0037] Using DNA as a template, high-fidelity enzyme KOD FX Neo (KFX-201, Toyobo, Japan) was used to InDel_XE perform PCR amplification separately (the PCR reaction program was: pre-denaturation at 94°C for 2 min in a PCR instrument; then 30 cycles: denaturation at 98°C for 10 sec, annealing at 56°C for 30 sec, extension at 68°C for 30 sec, extension at 72°C for 5 min, and then stored at 4°C). After detecting the PCR products in 1% agarose gel, sequencing was performed. The primer sequences are as follows:
[0038] InDel_XE F: 5’- CAATTCTATCTTTCTTTCAATTATTATCC -3’;
[0039] InDel_XE R: 5’- CCAATGAATATAAATATGTCAAGATACG -3’; The sequencing results showed that using the peanut DNA of HapI and HapII as templates for PCR amplification of sequences, the obtained DNA fragments were located AhXE45GC on the intron of the genome of the gene ( Figure 1 ), as shown in the sequence SEQ ID NO.1.
[0040] The sequence length of HapI: 320 bp (SEQ ID NO.2), while that of HapII was a 278-bp fragment. The results showed that there was a 33-bp deletion in HapII ( Figure 1 ), and the sequence was as shown in SEQ ID NO.3.
[0041] Example 2: Verification of the marker development population
[0042] Based on the InDel differences in the introns of the AhXE45GC gene between two materials, a InDel_XE marker was developed:
[0043] InDel_XE F: 5’- CAATTCTATCTTTCTTTCAATTATTATCC -3’;
[0044] InDel_XE R: 5’- CCAATGAATATAAATATGTCAAGATACG -3’;
[0045] After that, we used 90 high-generation RIL populations and 178 natural populations for verification. First, DNA was extracted according to the method in Example 1, and then InDel_XEPCR amplification was carried out with primers using GenStar's 2X Tap PCRStarMix polymerase. The PCR system was as follows: pre-denaturation at 95°C for 5 min; then 30 cycles: denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec, extension at 72°C for 25 sec, 30 cycles, extension at 72°C for 5 min, and then stored at 4°C. The PCR products were analyzed by polyacrylamide gel electrophoresis, and the bands were counted (high band was HapI; low band was HapII). Figure 2 ). We divided 90 RILs and 178 natural materials into three categories according to the pod length: small pods (pod length < 30 mm), medium pods (30 mm < pod length < 40 mm), and large pods (pod length > 40 mm). We found that both the RIL population and the natural population with large pods were of the HapII genotype, while in medium pods, the haplotype HapII accounted for 60% and 83% respectively. Figure 3 ). Next, association analysis was performed on different shapes to evaluate the relationship between the two haplotypes and several traits, namely pod length, pod width, pod area, seed length, weight of ten pods, weight of ten kernels, seed width, and seed area. In the F9 population, there were significant differences in all eight traits between single HapI and HapII. In natural materials, there were significant differences in traits such as pod length, pod width, and seed length between the two haplotypes. Figure 4 In A and B), from which we can draw the conclusion InDel_XE The marker has a very strong correlation with the size of peanut pods.
[0046] In summary, the molecular marker related to the peanut pod size trait of the present invention InDel_XE is tightly linked to the peanut pod size. At the breeding stage, select excellent varieties (donor parents, including this difference) with the large pod genotype to cross with the recipient parents (without this difference). In F2, use InDel_XE PCR amplification, perform polyacrylamide gel electrophoresis, select plants carrying the large pod-related marker, and at the same time conduct field trait identification, and select plants with large pod traits and excellent other agronomic traits. Self-cross the selected excellent plants until the traits are stable (usually up to the F6 generation). Molecular marker detection and field trait identification are carried out in each generation to ensure the stability and consistency of the target traits. Conduct multi-point regional trials on the excellent lines in the stable generation to evaluate their yield, fruit size, disease resistance, and other agronomic traits. Applying this marker can significantly shorten the breeding cycle of high-yield large pod varieties, reduce the breeding cost, and has high application value.
[0047] Among them, it should be noted that the peanut pod size is a typical quantitative trait, which is controlled by multiple genes. If this difference is found in all large fruits in a certain number of natural populations, and there is a relatively high probability of this difference in medium-fruit materials. In summary, if this difference appears in the natural population materials, there is a high probability that they are medium and large fruits, and if there is no such marker, it is probably small fruits. In the actual offspring population selected and mated, molecular markers and field phenotypes should also be combined for judgment.
[0048] The present invention has been described in detail above in conjunction with the accompanying drawings and embodiments. However, those skilled in the art can understand that without departing from the purpose of the present invention, various specific parameters in the above embodiments can be changed to form multiple specific embodiments, which are all within the common change range of the present invention and will not be elaborated here one by one.
Claims
1. A primer for detecting the peanut pod size-related molecular marker InDel_XE, characterized in that, The nucleotide sequences of its forward and reverse primers are as follows: InDel_XE F: 5’- CAATTCTATCTTTCTTTCAATTATTATCC -3’; InDel_XE R: 5’- CCAATGAATATAAATATGTCAAGATACG -3’.
2. A method for identifying the size of peanut pods, characterized in that, Comprising the following steps: Using the primer pair as described in claim 1 to perform PCR amplification on a peanut genomic DNA sample. If the amplification result shows a structural variation, i.e., a 33-bp deletion, it indicates that the peanut pods are larger; if the amplification result shows no structural variation, it indicates that the peanut pods are smaller. The structural variation refers to a structural variation at 106,694,064 bp on peanut chromosome 05, which is located in the intron of the gene AhXE45GC, and the large-fruit material has a 33-bp deletion relative to the small-fruit material. The amplified product sequence with the structural variation is as shown in SEQ ID NO:
3. The amplified product sequence without the structural variation is as shown in SEQ ID NO:
2.
3. The method according to claim 2, characterized in that The amplified product is observed and judged by polyacrylamide gel electrophoresis.
4. The method according to claim 3, wherein, When using the primer as described in claim 1, the amplified product is observed through the polyacrylamide gel electrophoresis band. If the amplified fragment is long, it indicates the absence of the said structural variation. If the amplified fragment is short, it indicates the presence of the said structural variation.