A rubber tree powdery mildew resistance protein HbCNL4 and its encoding gene and application

Abstract

The present invention discloses a rubber tree powdery mildew resistance protein HbCNL4 and its encoding gene and application. The amino acid sequence of the protein is shown in SEQ ID No. 1; its encoding gene HbCNL4 The nucleotide sequence of is shown in SEQ ID No. 2. HbCNL4 Gene expression analysis was performed, and the gene was significantly upregulated under the induction of rubber tree powdery mildew. HbCNL4 protein is located in the plasma membrane and the nucleus. Transgenic technology was used to find that it has the ability to induce immune responses in tobacco, Arabidopsis and pepper, causing cell necrosis. The present invention provides important gene resources for rubber tree disease resistance breeding, and it is expected to design a new type of plant immune inducer based on the protein for application in the field of plant disease resistance such as tobacco and Arabidopsis.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, relates to the research field of disease-resistant gene engineering of rubber trees, and specifically relates to a rubber tree powdery mildew resistance protein HbCNL4 and a coding gene and application thereof. Background Art

[0002] Rubber tree ( Hevea brasiliensis ) is the main source of natural rubber and has important strategic significance for my country's national defense and economic development. Erysiphe quercicola ) has posed a serious threat to the safety of natural rubber production in my country, and can lead to a loss of up to 45% of latex production. Due to the lack of in-depth understanding of the molecular mechanism of disease resistance and key genes of rubber trees, rubber-producing countries still rely on traditional hybrid breeding methods to develop disease-resistant varieties. This time-consuming breeding method has set up many obstacles in cultivating highly disease-resistant varieties. Therefore, it is urgent to conduct in-depth research on the molecular response mechanism of rubber trees to powdery mildew and screen out key disease-resistant proteins to accelerate the molecular breeding process of rubber tree disease resistance. In addition, using these disease-resistant proteins as targets to develop plant immune inducers can not only enhance the immunity of the plant itself, but also is an environmentally friendly and cost-effective strategy that helps to solve the problem of powdery mildew in rubber trees.

[0003] In the defense mechanism of plants against pathogens, pathogen effector-triggered immunity (ETI) mediated by nucleotide-binding leucine-rich repeat receptors (NLRs) plays a vital role. This defense mainly blocks the further spread of pathogens by activating the plant hypersensitive response (HR) and inducing cell necrosis in local tissues, forming the core of the plant defense system. As a key component of ETI, NLRs can directly or indirectly recognize pathogen effectors and trigger a series of intracellular responses including calcium influx, HR and cell necrosis, which together form a rapid and effective defense of plant cells against pathogens. NLRs have shown high diversity and adaptability through evolution, providing plants with the ability to resist a variety of pathogens. Woody plants have more NLRs than herbaceous plants due to their longer life cycle and more frequent pathogen contact, providing unique pathogen recognition and response strategies. Researching and developing NLRs in woody plants can not only deepen the understanding of plant immune mechanisms, but also provide important genetic resources for disease-resistant breeding, which has important academic and application value. Summary of the invention

[0004] In view of the deficiencies in the prior art, the present invention provides a rubber tree powdery mildew resistance protein HbCNL4 and its encoding gene and application. The protein has the characteristics of stimulating plant immune function, and its full-length sequence can cause cell necrosis reaction in model plants such as tobacco, Arabidopsis and pepper. By applying the protein, its encoding gene and its recombinant vector to transgenic plant cultivation or the development of plant immune inducers, the resistance of plants to pathogens can be improved.

[0005] The technical solution of the present invention is as follows:

[0006] On the one hand, the present invention provides a rubber tree powdery mildew resistance protein HbCNL4, and the amino acid sequence of the rubber tree powdery mildew resistance protein HbCNL4 is shown in SEQ ID NO.1.

[0007] Transient expression experiments have shown that the rubber tree disease resistance protein HbCNL4 is localized in the plasma membrane and cell nucleus, and can induce allergic reactions in tobacco, Arabidopsis and pepper, triggering cell necrosis in plants.

[0008] In a second aspect, the present invention provides a gene encoding the rubber tree powdery mildew resistance protein HbCNL4 HbCNL4 The nucleotide sequence of the gene is shown in SEQ ID NO.2.

[0009] In a third aspect, the present invention provides a HbCNL4 The biological material of the gene is an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium.

[0010] The recombinant vector is a recombinant cloning vector or a recombinant expression vector containing the gene HbCNL4. In a specific embodiment of the present invention, the gene HbCNL4 is inserted into the pBinGFP2 plasmid to prepare a recombinant expression vector. The recombinant bacteria are carrying the gene HbCNL4 of Agrobacterium.

[0011] In a fourth aspect, the present invention provides the use of the aforementioned rubber tree powdery mildew resistance protein HbCNL4, its encoding gene or biological material in any one of the following (1) to (4):

[0012] (1) Induce plant immune response;

[0013] (2) Inducing plant cell necrosis;

[0014] (3) developing powdery mildew-resistant plant varieties;

[0015] (4) Develop plant immune inducers.

[0016] Among them, plant immunity inducer is a biological pesticide developed by utilizing the principle of biological induced resistance to enhance plant immunity. It regulates plant metabolism, activates the plant's immune system and growth system, and thus enhances plant disease resistance.

[0017] Furthermore, the plant includes rubber tree, tobacco, Arabidopsis thaliana or pepper.

[0018] Beneficial effects of the present invention:

[0019] The present invention found that HbCNL4 is localized in the plasma membrane and the cell nucleus, and can induce allergic reactions in tobacco, Arabidopsis and pepper, triggering cell necrosis of the plant. HbCNL4 The gene is significantly upregulated under the induction of rubber tree powdery mildew. The present invention is based on the typical NLR protein in rubber tree, and explores its immune induction effect in different plants. This has important scientific significance for revealing plant disease resistance mechanism and developing immune inducers. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 Utilize fluorescent quantitative PCR to detect rubber tree in embodiment 2 of the present invention HbCNL4 Gene expression under powdery mildew infection conditions.

[0021] Figure 2 This is the localization of the rubber tree HbCNL4 protein in tobacco cells in Example 3 of the present invention. GFP, RFP, Bright, and Merge at the top of the figure represent GFP-green fluorescent protein signal, RFP-nuclear localization marker protein signal, Bright-bright field, and Merge-a fusion of green fluorescent protein signal, nuclear localization marker protein signal, and bright field.

[0022] Figure 3 The results are as follows: The cell necrosis of tobacco, Arabidopsis and pepper caused by the HbCNL4 protein of the rubber tree in Example 4 of the present invention. pBin, Infl and pBin-HbCNL4 represent the negative control, the positive control and the transfection recombinant vector, respectively. DETAILED DESCRIPTION

[0023] In order to better understand the technical content of the present invention, the present invention is further described below in conjunction with specific embodiments and drawings.

[0024] In the examples, the techniques or conditions not specifically specified are all in accordance with conventional experimental conditions, such as Sambrook et al. Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, 2001). Reagents or instruments whose manufacturers are not clearly stated are all conventional products available on the market. The strains and plasmid biological materials used in the following examples were all provided by the applicant's research group.

[0025] Example 1: Cloning of the Gene Encoding the Rubber Tree Disease Resistance Protein HbCNL4

[0026] The gene encoding the disease resistance protein HbCNL4 of rubber tree was cloned from the leaves of rubber tree variety Reyan 73397 using PCR technology. The specific method is as follows:

[0027] 1. Extract total RNA from rubber tree leaves and obtain cDNA through reverse transcription.

[0028] 2. Using cDNA as template and HbCNL4-F and HbCNL4-R as primers, the cDNA sequence of the HbCNL4 coding gene was obtained by PCR amplification reaction.

[0029] The primer sequences are as follows:

[0030] HbCNL4-F: 5'-GGCTCAGTCAAACTATTAGATGAA-3' (SEQ ID NO. 3)

[0031] HbCNL4-R: 5'-TTACTTGGCTTTGTATGGGATTA -3' (SEQ ID NO. 4)

[0032] High-fidelity DNA polymerase 2 × Phanta Max Master Mix (Novozymes) was used for PCR amplification. The reaction system was: 1 μL of cDNA template, 1 μL each of primers HbCNL4-F and HbCNL4-R (10 μmol / L), 10 μL of 2×PCR Master Mix, and dd H2O was added to 50 μL.

[0033] The PCR amplification program was as follows: denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 50 s, and extension at 72°C for 3 min, for a total of 35 cycles; and finally extension at 72°C for 10 min.

[0034] After 1% agarose gel electrophoresis, the target fragment was cut out, gel recovery and purification were performed, and cloned into the pMD18-T vector. After colony PCR detection, the sample was sent to Sangon Biotech (Shanghai) Co., Ltd. for sequencing verification. The sequencing results showed that the rubber tree HbCNL4 gene is a typical NLR gene, and its cDNA sequence (SEQ ID NO. 2) is 2763 bp in length, encoding a protein HbCNL4 (SEQ ID NO. 1) composed of 920 amino acids.

[0035] Example 2: Expression analysis of HbCNL4 gene after treatment of rubber tree powdery mildew infection

[0036] The budded seedlings of rubber tree 'Reyan 73397' were cultured in a seedling room at 25°C, relative humidity of 65%-70%, and a photoperiod of 16 h light / 8 h dark until bronze leaves grew out. Healthy budded seedlings without pathogen infection and mechanical damage were selected and transferred to the inoculation room. Conidia of powdery mildew strains parasitizing rubber trees were collected and prepared into a spore suspension (1×10 5 CFU·mL -1 ), and sprayed it evenly on the bronze stage leaves. After that, the inoculated rubber seedlings were cultured in an artificial climate chamber at a temperature of 19°C and a relative humidity of 85%-90%. Leaves were collected at 0, 4, 8, 15, 24, 36, 48 and 72 h after inoculation, and the uninoculated leaves were used as controls. Three biological replicates were performed for each treatment. The collected leaves were quickly frozen in liquid nitrogen and temporarily stored in a -80°C refrigerator.

[0037] The following fluorescence quantitative PCR detection primers were designed based on the HbCNL4 gene sequence and the internal reference gene HbACTIN (GenBank ID: HO004792):

[0038] HbCNL4-QF: 5'-AAAATGGATTCAAGGTTGTAGTC-3' (SEQ ID NO. 5)

[0039] HbCNL4-QR: 5'- AAGATGATGATTCTCCGTAGTGT -3' (SEQ ID NO. 6)

[0040] HbACTIN-F: 5′-GATGTGGATATCAGGAAGGA-3′ (SEQ ID NO. 7)

[0041] HbACTIN-R: 5′-CATACTGCTTGGAGCAAGA-3′ (SEQ ID NO. 8)

[0042] The fluorescence quantitative PCR was performed using the CFX-96 fluorescence quantitative PCR instrument of Bio Rad Company. The reaction program was: 95°C pre-denaturation for 30s; 94°C for 5s, 60°C for 20s, and 72°C for 20s, for a total of 45 cycles. The expression level of the HbCNL4 gene was calculated using the formula Qt=2^(-Ct(HbACTIN) - Ct(HbCNL4)), where Ct represents the number of cycles experienced when the fluorescence signal in each reaction tube reaches the set threshold.

[0043] Fluorescence quantitative PCR test results Figure 1 As shown, the expression of HbCNL4 gene was significantly upregulated 24 h after powdery mildew infection.

[0044] Example 3 Transient expression and subcellular localization of HbCNL4 protein in tobacco

[0045] In this study, homologous recombination was used to construct the vector. The pGREEN vector plasmid (i.e., 35S-GFP vector) with 35S promoter and green fluorescent protein (GFP) tag was cut into a linearized vector using EcoRI and BamHI. The CDS sequence of the HbCNL4 gene was amplified by PCR using primers HbCNL4-PF1 and HbCNL4-PR1 with restriction sites as the insert fragment.

[0046] HbCNL4-PF1: 5'-tacgaattcgagctcggtaccATGGCAGATGGCGCTGTG-3' (SEQ ID NO.9)

[0047] HbCNL4-PR1: 5'-caggtcgactctagaggatccAAGGGTTTCAACCATTCGGG-3' (SEQ IDNO. 10)

[0048] The insert fragment was ligated into the linearized vector using the ClonExpress II One Step Cloning Kit (Non-ligase-dependent Single Fragment Rapid Cloning Kit, manufacturer: Nanjing Novogene Biotech Co., Ltd.) to obtain the recombinant vector 35S-HbCNL4-GFP. The ligation product was transformed into DH5α competent cells by heat shock method and inverted cultured at 37°C on Luria-Bertani (LB) agar plates containing corresponding resistance for 12-16 h. Single colonies were randomly picked and PCR detection of bacterial liquid was performed using HbCNL4-YF1 and HbCNL4-YR1 as verification primers.

[0049] HbCNL4-YF1: 5'-cacaggaaacagctatgac-3' (SEQ ID NO. 11)

[0050] HbCNL4-YR1: 5'-gtaaaacgacggccagt-3' (SEQ ID NO. 12)

[0051] After verification, the bacterial solution and 40% glycerol were stored in a -80°C ultra-low temperature refrigerator at a ratio of 1:1. The positive results were sent for testing, and the recombinant vector plasmid DNA stored in Escherichia coli was extracted by FastPure Plasmid Mini Kit (Plasmid DNA Mini Extraction Kit, Brand: Novozyme). The 35S-HbCNL4-GFP recombinant vector was transformed into GV3101 Agrobacterium competent cells by liquid nitrogen freeze-thaw method, and LB (50 μg mL -1 Kana and 25 μg mL -1 Rif) medium, invert and culture in a 28℃ incubator for 48 h, pick a single colony for colony PCR verification. Note: Kana is kanamycin and Rif is rifampicin.

[0052] Select positive single clones and culture them in 5 mL LB medium with corresponding antibiotics at 200 rpm for 14-16 h. At the same time, culture Agrobacterium with 35S-GFP empty load and RFP-nuclear localization marker protein. Take 500 μL of bacterial solution and add an equal volume of 40% (volume fraction) glycerol to store as glycerol bacteria. The remaining bacterial solution was centrifuged at room temperature to collect the cells. After removing the LB medium, use 5 mL of suspension (add 10 mmol·L -1 MgCl2, 10 mmol·L -1 MES and 200 μmol·L-1 AS, pH=5.6) were used to resuspend the cells, and the cells were collected by centrifugation again. The suspension was used to adjust the OD value of the bacterial solution. 600 To 0.6-0.8, and stand in the dark for 2 h. Add the Agrobacterium resuspension of RFP-nuclear localization marker protein to the 35S-HbCNL4-GFP and 35S-GFP resuspensions at a volume ratio of 1:0.1, select tobacco plants with consistent growth at the 5-7 leaf stage, and inject the mixed resuspension from the back of the tobacco leaves with a 1 mL sterile syringe. Inject 3 leaves for each treatment. After injection, the tobacco was cultured in a dark environment for 12 h, and then taken out for normal light culture. Cut the leaves at 36 hpi, and observe the green fluorescence signal of the back cells of the leaves with an Olympus BX53 upright fluorescence microscope. Using 35S-GFP empty vector and RFP-nuclear localization marker protein as controls, observe the tobacco subcellular localization of HbCNL4 protein. Note: MES is sodium methyl fatty acid ester sulfonate, and AS is acetosyringone.

[0053] The results are as follows Figure 2As shown, the HbCNL4-GFP fusion protein is distributed in both the plasma membrane and the nucleus, indicating that HbCNL4 is localized in the plasma membrane and the nucleus, and plays a role in the plasma membrane and mid-cell nucleus of plants.

[0054] Example 4 Immune Activation of HbCNL4 Protein in Tobacco, Arabidopsis and Pepper

[0055] Homologous recombination was used to construct the vector. The pBinGFP2 vector plasmid (Shanghai Qincheng Biotechnology Co., Ltd.) was cut into a linearized vector using Smal enzyme. The CDS sequence of the HbCNL4 gene was amplified by PCR using primers HbCNL4-PF2 and HbCNL4-PR2 with restriction sites as the insert fragment.

[0056] HbCNL4-PF2: 5'-aattctgcagtcgaccccgggATGGCAGATGGCGCTGTG-3' (SEQ ID NO.13)

[0057] HbCNL4-PR2: 5'-caagaaagctgggtccccgggTCAAAGGGTTTCAACCATTCG-3' (SEQ IDNO. 14)

[0058] The target fragment and linear vector were homologously recombined using the ClonExpress Ultra One Step Cloning Kit (flexible and versatile integrated ultra-fast cloning kit, brand: Novogene) to obtain the recombinant vector. The ligation product was transformed into DH5α competent cells by heat shock method and inverted cultured at 37°C on LB agar plates containing kanamycin resistance for 12-16 h. Single colonies were randomly picked and PCR detection of bacterial liquid was performed using HbCNL4-YF2 and HbCNL4-YR2 as verification primers.

[0059] HbCNL4-YF2: 5'-GAATCTCAAGCAATCAAGCA-3' (SEQ ID NO. 15)

[0060] HbCNL4-YR2: 5'-CTCTAGATCAGGTGGATCCC-3' (SEQ ID NO. 16)

[0061] After verification, the bacterial solution and 40% glycerol were stored in a -80°C ultra-low temperature refrigerator at a volume ratio of 1:1. The positive results were sent for testing, and the recombinant vector plasmid DNA was extracted by FastPure Plasmid Mini Kit (Plasmid DNA Mini Extraction Kit, Brand: Novozyme). The constructed HbCNL4-pBinGFP2 recombinant vector was transformed into GV3101 Agrobacterium competent cells by liquid nitrogen freeze-thaw method, and LB (50 μg mL -1 Kana and 25 μg mL -1 Rif) medium, inverted culture in a 28°C incubator for 48 h, and single colonies were picked for colony PCR verification. Positive single clones were selected and cultured in 5 mL LB medium with corresponding antibiotics and shaken at 28°C and 200 rpm for 14-16 h. Agrobacterium transformed with pBinGFP2 empty vector (negative control), Inf1 (positive control, Inf1 is a gene known to induce cell necrosis and trigger plant PTI immune response, the amino acid sequence is shown in GenBank: AAV92919.1, the nucleotide sequence is shown in GenBank: AY830094.1) and HbCNL4-pBinGFP2 was cultured at the same time. 500 μL of bacterial solution was added to an equal volume of 40% (volume fraction) glycerol and stored in a -80 ultra-low temperature refrigerator. The remaining bacterial solution was centrifuged at room temperature to collect the bacteria, and after removing the LB medium, 5 mL of suspension (10 mmol·L -1 MgCl2, 10mmol·L -1 MES and 200 μmol·L -1 AS, pH = 5.6) resuspended the cells, centrifuged again to collect the cells, and used the suspension to adjust the OD of the bacterial solution. 600 to 0.6-0.8 (OD in Arabidopsis immune activation test) 600 Adjust to 0.4), and keep it in the dark for 2 h. Select tobacco, Arabidopsis, and pepper plants with the same growth, and inject the resuspended solution from the back of the plant leaves with a 1 mL sterile syringe. Five plants were injected for each treatment. After injection, the tobacco was cultured in a dark environment for 12 h, and then taken out for normal light culture. Observe the cell necrosis of the plant 72 h after injection and take photos to record.

[0062] The results are as follows Figure 3 As shown in the figure, after injection of rubber tree HbCNL4, tobacco, Arabidopsis and pepper leaves all showed the same cell necrosis phenomenon as the positive control Inf1. This shows that HbCNL4 can induce immune responses in tobacco, Arabidopsis and pepper, causing cell necrosis. This indicates that HbCNL4 can be used as a new immune-inducing molecule to develop immune-inducing agents and powdery mildew-resistant crop varieties.

[0063] The above descriptions are only some embodiments of the present invention and are not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention shall fall within the protection scope of the present invention.

Claims

1. A rubber tree powdery mildew resistance protein HbCNL4, characterized in that The amino acid sequence of the rubber tree powdery mildew resistance protein HbCNL4 is shown in SEQ ID NO.

1.

2. A gene encoding the rubber tree powdery mildew resistance protein HbCNL4 according to claim 1.

3. The gene according to claim 2, characterized in that The nucleotide sequence of the gene is shown in SEQ ID NO.

2.

4. A biological material containing the gene according to claim 2 or claim 3, characterized in that: The biological material is an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacterium.

Images