A gene LOC_Os01g12160 regulating rice salt tolerance and its application
By knocking out the rice LOC_Os01g12160 gene, the rice gene was improved by using the CRISPR/Cas9 system, the problem of unclear salt tolerance in rice was solved, the survival rate and growth performance of rice under salt stress was improved, the salt tolerance of rice was enhanced, and breeding applications were provided for saline-alkali rice farming areas.
Patent Information
- Application Number
- CN202410966384.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-18
- Publication Date
- 2025-07-18
- Estimated Expiration
- 2044-07-18
AI Technical Summary
The salt tolerance mechanism of rice in the prior art is unclear, which has led to the threat of the food security and ecological environment of rice crops in saline-alkali land, and there is a lack of effective methods for improving rice salt tolerance.
By knocking out the LOC_Os01g12160 gene in rice, gene editing is performed using the CRISPR/Cas9 system to construct the LOC_Os01g12160 gene deletion strain to improve the salt tolerance of rice.
It significantly improves the survival rate and growth performance of rice under salt stress, enhances the salt tolerance of rice, and provides application potential in rice breeding.
Smart Images
Figure CN118931918B_ABST
Abstract
Description
Technical Field:
[0001] The present invention belongs to the field of rice breeding and relates to a gene LOC_Os01g12160 that regulates rice salt tolerance and its application. Background Art:
[0002] Global soil salinization is increasing day by day due to multiple factors such as industrial pollution and abuse of chemical fertilizers. Increasing the salt tolerance of rice is of great significance for improving the production potential of rice, promoting the utilization of saline-alkali land, and ensuring food security. The salt tolerance of rice refers to the ability of rice to maintain normal growth until filling and seed setting to form a yield under salt stress. Improving the salt tolerance of rice through genetic improvement and cultivating salt-tolerant rice varieties is one of the effective ways to ensure food safety production in saline-alkali rice-growing areas and improve the ecological environment.
[0003] In view of this, the present invention is specifically proposed. Summary of the Invention:
[0004] The purpose of the present invention is to provide the function of the LOC_Os01g12160 gene in regulating rice salt tolerance, and to provide technical support for improving rice salt tolerance by using the LOC_Os01g12160 gene.
[0005] The first object of the present invention is to provide a LOC_Os01g12160 gene that regulates salt tolerance, and the nucleotide sequence of the LOC_Os01g12160 gene is shown in SEQ ID NO.1.
[0006] The present invention also provides the application of the above-mentioned LOC_Os01g12160 gene in regulating rice salt tolerance.
[0007] Preferably, it is the application of knocking out the LOC_Os01g12160 gene in increasing rice salt tolerance.
[0008] The second object of the present invention is to provide a method for improving rice salt tolerance, which is to knock out the LOC_Os01g12160 gene in rice.
[0009] Preferably, for knocking out the LOC_Os01g12160 gene in rice, the knockout target is: GGCGGCGTCGAGTACCTCCGGGG.
[0010] The third object of the present invention is to provide the application of the LOC_Os01g12160 gene in rice breeding.
[0011] Preferably, the application in rice breeding is the application in improving rice salt tolerance.
[0012] Compared with the prior art, the present invention has the following beneficial effects:
[0013] (1) The present invention provides the function of the LOC_Os01g12160 gene in regulating the salt tolerance of rice. We demonstrated through transgenic experiments that the LOC_Os01g12160 gene can regulate the salt tolerance of rice.
[0014] (2) Currently, the mechanism related to rice salt tolerance is still unclear. The LOC_Os01g12160 gene knockout lines in the present invention have improved salt tolerance after salt stress. Therefore, the application of knocking out the LOC_Os01g12160 gene in improving the salt tolerance of rice is provided. Description of the Drawings:
[0015] Figure 1 : The knockout target and detection results of the LOC_Os01g12160 gene. ZH11 is the control material, and ja2r-1 and jar2-2 are the gene knockout lines.
[0016] Figure 2 : The function of the LOC_Os01g12160 gene in regulating the survival rate of rice seedlings under salt stress. Statistical comparison was performed using a one-sided t-test. * indicates a significant difference with p < 0.05 in the t-test, and ** indicates a significant difference with p < 0.01 in the t-test.
[0017] Figure 3 : The function of the LOC_Os01g12160 gene in regulating the salt tolerance of rice. Statistical comparison was performed using a one-sided t-test. * indicates a significant difference with p < 0.05 in the t-test, and ** indicates a significant difference with p < 0.01 in the t-test. Detailed Embodiments:
[0018] The following examples are further illustrations of the present invention, rather than limitations thereof. The specific experimental conditions and methods were not specified in the following examples, and the technical means used were conventional means well-known to those skilled in the art.
[0019] Example 1: Construction of the LOC_Os01g12160 Gene Knockout Lines
[0020] The nucleotide sequence of the LOC_Os01g12160 gene is shown in SEQ ID NO.1. We designed the gene knockout target as: GGCGGCGTCGAGTACCTCCGGGG. The transgenic vector was constructed with reference to the publicly published CRISPR / Cas9 system (Xingliang, Ma. "A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants." Molecular Plant 8.8 (2015): 1274-1284.). The constructed knockout vector was transformed into Agrobacterium BGK03, and then the Agrobacterium was used to infect and transform the callus tissue of ZH11, and the obtained transgenic strain was separated by breeding. Primers (5'-GAACGTCTGGAACGCGAG GA-3', 5'-GCGACGAGGAGTACTAGGGT-3') were used to detect gene editing, and the sequence of the control material ZH11 was compared to obtain the transgenic lines with homozygous knockout of the LOC_Os01g12160 gene. The two knockout lines were jar2-1 and jar2-2. jar2-1 lacked 2bp at the target site, and jar2-2 lacked 10bp at the target site ( Figure 1 ).
[0021] Example 2: Effect of LOC_Os01g12160 gene on the survival rate of rice seedlings under salt stress
[0022] Select the plump, normal, and disease-free rice seeds of the control ZH11 and the knockout strains (jar2-1 and jar2-2), and sow them aseptically in 1 / 2MS culture medium. After 10 days, select the seedlings with consistent growth and place them in seedling boxes and culture them with 1X Kimura B nutrient solution. After the seedlings adapt, treat them with 200mM mol / L NaCl solution + 1X Kimura B nutrient solution for 5 days. After treatment, use 1X Kimura B nutrient solution to recover. During this period, the nutrient solution is replaced every 2-3 days. After 14 days of recovery, the survival rate is calculated. Four independent biological replicates were set up for the control and knockout strains, and all seedling boxes were placed in a constant temperature incubator (Ningbo Jiangnan Instrument Factory, temperature 28±1℃, humidity 75%±5%) for culture. Figure 2 The survival rate statistics showed that the survival rates of jar2-1 and jar2-2 were significantly improved compared with ZH11.
[0023] Example 3: Effect of LOC_Os01g12160 gene on seedling height and fresh weight under salt stress
[0024] According to the same method as above, the bud length and fresh weight of the seedlings of the control and knockout lines were counted. From Figure 3 The statistical results showed that under salt stress, the bud lengths of jar2-1 and jar2-2 increased by 13% and 20% respectively compared with the control ZH11, and the fresh weights increased by 23% and 30% respectively compared with the control ZH11. It indicates that the LOC_Os01g12160 gene regulates the salt tolerance of rice.
[0025] The LOC_Os01g12160 gene sequence is as follows (SEQ ID NO.1):
[0026] ATGTTGGAGAAGAAGGCGACGAGGAGTACTAGGGTGGATGGGGTGAGCGGCGAGGCGGTGATCGA
[0027] GGAGTTCGAGCGGGTGACGCGCGACGCGGCCAATGTGCAGCGGGAGACGCTGCGGCGGATCCTCG
[0028] CCGAGAACGGCGGCGTCGAGTACCTCCGGGGGCTGGGCCTCGCCGGCGCCACCGACCCGGCCACC
[0029] TTCCGCGCGCGCGTCCCGCTCGCCACCCACGCCGACCTCGAGCCCTACATTGACCGCATCGCCGAC
[0030] GGCGACGCCTCCCCCGTCCTCACCGCCAAGCCCGCCACCTCCATCTCCCTCAGCTCCGGCACGACG
[0031] CAGGGGAAGCGCAAGTACCTGCTATTCAACGAGGAGCTCGTCAAGTCCACGATGCAGATATACCGG
[0032] ATCTCCTACGCGTTCCGGAACAGGGAGTTTCCGGTGGAGAACGGGAAGGCGCTGCAGTTCATCTAC
[0033] AGCAGCAGGGAGACGAGGACGAAGGGGGGGCTTACGGCGACGACGGCGACGACGAACGTGTACC
[0034] GGAGCGAGGAGTTCAAGGCGACGATGAGGGACATCCAGTCGCAGTGCTGCAGCCCCGACGAGGTG
[0035] ATCTTCGGCCCGGACTTCGCGCAGTCGCTCTACTGCCACCTCCTCGCCGGCCTCCTCGCCGCCGGCG
[0036] ACGTGCAGATCGTGTCCGCCACCTTCGCCCACAGCGTCGTCCTCGCGTTCCAGACGTTCGAGCGCG
[0037] CCTGGGAGGACCTCTGCGCCGACATCCGCCGCGGCGAGGTGTCGCCGTCGCGGGTCACCTCGCCG
[0038] GCCGTCCGCCGCGCCATGGCGGCGCTCCTCGCCGCGCCCAACCCGGGCCTCGCCGACGAGGTCGC
[0039] CCGCAAGTGCGCCGCCCTGAGCAACTGGTACGGCGTCATCCCGGCGCTGTGGCCCAACGCCAGGT
[0040] ACGTGTACGGCATCATGACGGGGTCCATGGAGCACTACGTCAAGAAGCTCCGCCACTACGCCGGCG
[0041] GCCTGCCGCTCGTCGCCGCCGAGTACGGCGCCTCCGAGGGGTGGGTCGGCGCCAACGTCGAGCCC
[0042] GGGACGCCGCCGGAGCGCGCCACCTTCACCGTGCTCCCCGACATCGCCTACTTCGAGTTCATCCCC
[0043] CTCAAGCCCGTCGCCGGCGACGGCGGCTACGCCGAGGCGGAGCCCGTCGGCCTCACGGAGGTCGC
[0044] CGCCGGCGAGCTCTACGAGGTCGTCATGACCACCTTCGCAGGGCTTTACCGGTATCGGCTGGGGGA
[0045] CGTGGTGAAGGTGGCAGGGTTCTACAACGCGACGCCCAAGCTCAAGTTCGTGTGCAGGAGGAACC
[0046] TGATGCTGTCGATCAACATCGACAAGAACAGCGAGCAGGACCTGCAGCTGGCGGTGGACGCGGCG
[0047] GCGAGGGCGGTGCTCGCCGGCGAGAAGCTGGAGGTGGTGGACTACACCAGCCACGCCGACGTGTC
[0048] GTCGGACCCGGGCCACTACGTCGTCTTCCTGGAGCTCAACGCCGCCGACCCCGCCGCCGTCGACGG
[0049] CGACGTGATGCAGGCCTGCTGCGACGAGCTGGACAGGGCGTTCGCCGACGCCGGCTACGTCGGGT
[0050] CGAGGAAGTCCGGCGCCATCGCCCCGCTCGAGCTCCGCGTGCTGCAGCGTGGAACCTTCCAGAAG
[0051] GTTCTCCGCCACTACCTCTCCCTCGGCGCCCCCGTCAGCCAGTTCAAGTCCCCCCGCTGCGTCTCCC
[0052] GCTCCAACTCCGGCGTCCTCCAGATCCTCGCCGGCTGCACCGTCAACGTCTTCTTCAGCTCCGCCTA
[0053] CGACTGA
Claims
1. Use of knocking out the LOC_Os01g12160 gene in improving the salt tolerance of rice, characterized in that, The nucleotide sequence of the LOC_Os01g12160 gene is shown in SEQ ID NO.
1.
2. A method for improving the salt tolerance of rice, characterized in that, It is to knockout the LOC_Os01g12160 gene in rice, and the nucleotide sequence of the LOC_Os01g12160 gene is shown in SEQ ID NO.
1.
3. The method according to claim 2, wherein For the knockout of the LOC_Os01g12160 gene in rice, the knockout target is: GGCGGCGTCGAGTACCTCCGGGG.
4. Use of knocking out the LOC_Os01g12160 gene in rice breeding for improving the salt tolerance of rice, characterized in that, The nucleotide sequence of the LOC_Os01g12160 gene is shown in SEQ ID NO.1.