Sf9 cell line without rhabdovirus contamination, screening method and application thereof

Abstract

The present invention relates to a screening method and an acclimation method for Sf9 cell strains free of rhabdovirus contamination, and a Sf9 cell strain free of rhabdovirus contamination obtained by the screening method and the acclimation method. The present invention also relates to a screening method for Sf9 cell strains free of rhabdovirus contamination, low oxygen consumption and low sugar consumption, and a Sf9 cell strain free of rhabdovirus contamination, low oxygen consumption and low sugar consumption obtained by the screening method. The Sf9 cell strain free of rhabdovirus contamination of the present invention exhibits the characteristics of low oxygen consumption and low sugar consumption during fermentation culture, and is used to reduce production costs in the production of recombinant proteins or viral vectors such as AAV viral vectors and reduce the safety risk of biological products produced by Sf9 cells.

Description

Technical Field

[0001] The present invention relates to the technical field of producing recombinant proteins and viral vectors. Specifically, the present invention relates to screening Sf9 cell lines free of rhabdovirus contamination. The Sf9 cell lines free of rhabdovirus contamination obtained by the method of the present invention for screening Sf9 cell lines free of rhabdovirus contamination exhibit low oxygen and low sugar consumption characteristics during fermentation culture, and can be used for large-scale production of recombinant proteins or viral vectors such as AAV viral vectors. Background Art

[0002] The baculovirus expression vector system is a system that uses baculovirus as a gene vector.

[0003] The Sf9 cell line is a clonal isolate derived from the Spodoptera frugiperda (Sf) 21 cell line. It is a common cell line used in baculovirus expression vector systems and is widely used in the production of recombinant proteins and viral vectors such as AAV viral vectors.

[0004] However, during the culture of commercial Sf9 cells, rhabdovirus (Sf- R Habdo v irus, also referred to as "Sf-RV") contamination, which makes the use of rhabdovirus-contaminated Sf9 cells to produce biological products with potential safety risks.

[0005] There is a need in the art for using Sf9 cells free of rhabdovirus contamination for the production of recombinant proteins and viral vectors such as AAV viral vectors. Summary of the invention

[0006] The present invention provides a method for screening a Sf9 cell line free of rhabdovirus contamination. The Sf9 cell line free of rhabdovirus contamination obtained by the screening method of the present invention exhibits low oxygen consumption and low sugar consumption during fermentation culture, and can be used for large-scale production of target proteins or viral vectors such as AAV vectors.

[0007] Therefore, in a first aspect, the present invention provides a method for screening an Sf9 cell line free of rhabdovirus contamination, characterized in that it comprises the following steps:

[0008] 1) Preparation of cell suspension of Sf9 cells contaminated with rhabdovirus

[0009] 2) Preparation of monoclonal screening culture medium

[0010] A monoclonal screening culture medium is prepared using 30%-60% of a first basal serum-free insect cell culture medium supplemented with whey protein hydrolysate and Yeasolate, 20%-35% of a second basal serum-free insect cell culture medium, and 10%-35% of FBS, wherein the first basal serum-free insect cell culture medium not supplemented with whey protein hydrolysate and Yeasolate is the same as or different from the second basal serum-free insect cell culture medium, and can be any basal serum-free insect cell culture medium (for example, ESF AF™ insect cell culture medium (purchased from Expression Systems), Grace insect cell culture medium (Gibco), Sf-900 II SFM culture medium, Sf-900III SFM culture medium, etc.).

[0011] In some embodiments, the first basal serum-free insect cell culture medium supplemented with whey protein hydrolysate and Yeasolate is a Grace-supplemented insect cell culture medium.

[0012] 3) Dilution and plating of cell suspension

[0013] Centrifuge the cell suspension obtained in step 1) and wash the cells several times with basic serum-free insect cell culture medium; then take the freshly prepared monoclonal screening culture medium in step 2) and dilute the cells to 0.1×10 4 / ml-1×10 6 / ml, for example 1×10 5 cells / ml, and then dilute them in series to 25-100 cells / ml, and inoculate them in a culture plate, such as a 96-well culture plate, at 1-10 cells / well, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cells / well, and place them in a constant temperature incubator at about 27-28°C, such as about 27.5°C for static culture; or

[0014] The cell suspension obtained in step 1) is centrifuged and the cells are washed several times with a basic serum-free insect cell culture medium; then the monoclonal screening culture medium freshly prepared in step 2) is taken and an antiviral compound (e.g., ribavirin) is added to make the final concentration of the antiviral compound (e.g., ribavirin) 10-50 ng / ml, and the cells are diluted to 0.1×10 4 / ml-1×10 6 / ml, for example 1×10 5cells / ml, and then gradiently diluted to 25-100 cells / ml, seeded in a culture plate, for example, a 96-well culture plate, at 1-10 cells / well, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cells / well, and placed in a constant temperature incubator at about 27-28°C, for example, about 27.5°C for static culture;

[0015] 4) Cell culture, rhabdovirus detection and cell passaging

[0016] 5) Expanding the culture of cells free of rhabdovirus contamination

[0017] The cells obtained in step 4) that are initially tested to be free of rhabdovirus contamination are cultured in a monoclonal screening culture medium corresponding to the cells in each well plate or a monoclonal screening culture medium supplemented with an antiviral compound (e.g., ribavirin) at a final concentration of 10-50 ng / ml, for example, in a 24-well plate, a 6-well plate, a T25 flask, a T75 flask, or a T225 flask; rhabdovirus detection is performed to obtain an Sf9 cell line that is free of rhabdovirus contamination.

[0018] In some embodiments, rhabdovirus detection is performed by a method selected from polymerase chain reaction (PCR), reverse transcription (RT), reverse transcription-polymerase chain reaction (RT-PCR), RT-PCR combined with nested PCR, quantitative PCR (qPCR), RT-PCR combined with quantitative PCR (quantitative RT-PCR or RT-qPCR), multiple probe hybridization techniques, electron microscopy techniques, and antibody-based detection techniques (e.g., ELISA assays), plaque assays and cytopathic effect (CPE), and bioinformatics techniques such as BLAST searches.

[0019] In a second aspect, the present invention provides a method for taming an Sf9 cell strain free of rhabdovirus contamination obtained by the screening method for an Sf9 cell strain free of rhabdovirus contamination of the present invention, characterized in that a cell suspension of the Sf9 cell strain free of rhabdovirus contamination is prepared, and a basic serum-free culture medium supplemented with Pluronic™ F-68 is used in a shaking incubator at about 27-28°C, for example, about 27.5°C, and 100-130rpm for suspension culture; the suspension cultured cells are stably cultured for more than 3 generations, for example, 4-20 generations, to obtain a serum-independent suspension Sf9 cell strain free of rhabdovirus contamination.

[0020] In some embodiments, the basal serum-free medium before adding Pluronic™ F-68 can be any basal serum-free insect cell culture medium, for example, ESF AF™ insect cell culture medium (available from Expression Systems), Grace insect cell culture medium (Gibco), Sf-900 II SFM culture medium, Sf-900 III SFM culture medium, and the like.

[0021] In a third aspect, the present invention provides a Sf9 cell line free of rhabdovirus contamination, which is obtained by the screening method and optionally the acclimation method of the Sf9 cell line free of rhabdovirus contamination of the present invention.

[0022] In a fourth aspect, the present invention provides use of the Sf9 cell line free of rhabdovirus contamination of the present invention in the production of recombinant proteins or viral vectors such as AAV viral vectors.

[0023] In some embodiments, the rhabdovirus-free Sf9 cell line of the present invention is used as a host cell in an insect cell-baculovirus expression vector system for producing a recombinant protein or a viral vector such as an AAV viral vector.

[0024] In a fifth aspect, the present invention provides a method for screening a rhabdovirus-free Sf9 cell strain with low oxygen and sugar consumption, characterized in that the rhabdovirus-free Sf9 cell strain obtained by the screening method and acclimation method of the present invention is inoculated into a fermenter for culture, for example, inoculated into a 1L-5L scale fermenter for culture, to screen the rhabdovirus-free Sf9 cell strain with low oxygen and sugar consumption. The rhabdovirus-free Sf9 cell strain with low oxygen and sugar consumption obtained by screening can be used in the production of recombinant proteins or viral vectors such as AAV viral vectors.

[0025] In some embodiments, the rhabdovirus-free, low oxygen and low glucose consumption Sf9 cell line of the present invention is used as a host cell in an insect cell-baculovirus expression vector system for producing recombinant proteins or viral vectors such as AAV viral vectors. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 The growth curves of Sf9-FP01, Sf9-FP02 and Sf9-FP03 cell lines cultured in 125 ml triangular shake flasks are shown compared with the control cells Sf9-Rha contaminated with rhabdovirus. In the figure, "VCD" represents viable cell density and "via" represents cell viability.

[0027] Figure 2Shown are the viable cell density (VCD) and cell viability (via) of Sf9-FP01, Sf9-FP02, and Sf9-FP03 cell lines grown in 2-L fermenters compared to rhabdovirus-contaminated control cells Sf9-Rha. Figure 2 The first “2” on the horizontal axis indicates before the recombinant baculovirus infects the cells, and the second “2” indicates after the recombinant baculovirus infects the cells, both of which are completed on the second day of cell culture.

[0028] Figure 3 Shown are the glucose (Glc) consumption and oxygen (O2) consumption in the culture medium of Sf9-FP01, Sf9-FP02 and Sf9-FP03 cell lines when grown in 2-L scale fermenters compared to rhabdovirus-contaminated control cells Sf9-Rha. DETAILED DESCRIPTION

[0029] Unless defined otherwise hereinafter, all technical and scientific terms used in this specification have the same meaning as those of ordinary skill in the art to which the present invention belongs. All publications, patent applications, patents and other references mentioned herein are fully incorporated by reference. In addition, the materials, methods and examples described herein are only illustrative and are not intended to be restrictive. Other features, purposes and advantages of the present invention will be apparent from this specification and the accompanying drawings and from the appended claims.

[0030] definition

[0031] As used herein, the term "about" when used in conjunction with a numerical value is intended to encompass numerical values ​​within a range having a lower limit of 5% less than the specified numerical value and an upper limit of 5% greater than the specified numerical value. The term is also intended to encompass values ​​within the range of ±1%, ±0.5%, or ±0.1% of the specified number. Unless otherwise specified, "%" herein refers to volume percentages.

[0032] Herein, the expression "and / or" is used to indicate any one of the related listed items, or any and all possible combinations of a plurality of the related listed items.

[0033] In this article, the term "comprising" or "including" means including the mentioned elements, integers or steps, or groups of elements, integers or steps, but does not exclude any other elements, integers or steps, or other groups of elements, integers or steps. In this article, when the term "comprising" or "including" is used, unless otherwise indicated, the situation consisting of the mentioned elements, integers or steps is also covered. For example, when referring to a polypeptide / protein "comprising" a specific sequence, it is also intended to cover polypeptides / proteins consisting of the specific sequence.

[0034] In this article, the use of terms such as "first", "second", etc. to modify elements does not itself mean any priority or order of one element relative to another element or the time order of implementing method actions, but is merely used as a label to distinguish one element with a specific name from another element with the same name to distinguish the elements.

[0035] "Cell line" refers to cells that proliferate after the first passage of primary cells, which can be called cell lines or subclones. As cells are passaged, cells with strong growth ability will gain an advantage, resulting in a certain degree of uniformity in genotype and phenotype of the cell population.

[0036] "Cell strain" refers to a culture obtained from a primary culture or cell line by selection or cloning. A monoclonal cell strain is a cell strain that is amplified from a single cell.

[0037] The terms "culture medium" and "culture fluid" are used interchangeably. Culture medium is not only the basic substance that provides cell nutrition and promotes cell proliferation, but also the environment in which cells grow and proliferate. There are many types of culture medium. Choosing the right culture medium according to different cell types and experimental requirements is the key to successful cell culture.

[0038] In this article, the terms "serum-free media (SFM)" or "serum-free insect cell culture medium" are used interchangeably and refer to medium that does not contain any animal-derived serum components. Serum-free media usually require the addition of specific chemical additives to simulate the effects of serum. Currently, a variety of serum-free media are on the market, such as hybridoma cell serum-free medium, CHO cell serum-free medium, Vero cell serum-free medium, Sf cell serum-free medium, etc. Serum-free media usually contain additional components that promote cell growth, such as hormones and growth factors, low-molecular nutrients, and transferrin, generally including insulin, progesterone, sodium selenate, putrescine, transferrin, etc.

[0039] The terms "basic serum-free medium" or "basic serum-free insect cell medium" are used interchangeably and refer to liquid or solid medium that supports the growth of Sf9 cells and maintains the basic nutrients required for Sf9 cells. For example, Grace Insect Cell Medium (Gibco), ESF 921 Medium (Expression Systems), ESF AF™ Insect Cell Medium (Expression Systems), IB907d Medium (Yishengke, https: / / www.yskbio.com / Insect-Cell-Serum-Free-Medium.html), Sf 900 II SFM Medium (GIBCO), Sf 900 III SFM Medium, etc.

[0040] The basic serum-free medium allows the growth and expansion of Sf9 cells under specific circumstances by adding additional chemicals and / or cytokines, etc. In some embodiments, by adding whey protein hydrolysate and Yeasolate to the "basic serum-free medium", it is beneficial to obtain and enable the rapid growth and expansion of monoclonal Sf9 cells. In some embodiments, by adding Pluronic® F-68 to the "basic serum-free medium", the viable cell density (VCD) of Sf9 in suspension culture can be increased.

[0041] "Viable cell density", also referred to as "cell density", refers to the number of cells per unit volume of liquid.

[0042] "Cell Viability" refers to the percentage of live cells in the total cells. The determination methods include dye exclusion method, for example, trypan blue dyes dead cells blue, but live cells are not colored; aniline black dyes dead cells black, but live cells are not colored; eosin Y method; fluorescence exclusion method, in which cells with strong vitality can emit strong yellow-green fluorescence, cells with weak vitality emit weak fluorescence, and dead cells have no fluorescence; MTT colorimetric test method, in which succinate dehydrogenase can decompose MTT to produce blue crystalline formazan particles that accumulate in and around cells, and the amount is proportional to the number of cells and also proportional to cell vitality.

[0043] Primary cell culture is the culture of cells, tissues or organs taken directly from an organism before the first subculture. Cells are expanded in culture when they are placed in a growth medium under conditions that favor cell growth and / or division to obtain a larger cell population. As cells expand in culture, the rate of cell proliferation is measured by the amount of time required for the number of cells to double. This is called the cell doubling time.

[0044] Primary cells are cultured once or multiple times. Each round of subculture is called passage. When cells are subcultured, they are called passaged cells. Sometimes a specific cell population is mentioned or characterized by the number of passages. For example, a cultured cell population that has been passaged 10 times is called a P10 culture. The primary culture, i.e., the first generation culture after separating cells from tissues, is called P0. After the first subculture, cells are called second generation cultures (P1 or 1st generation). After the second subculture, cells become third generation cultures (P2 or 2nd generation), and so on. Those skilled in the art will understand that there may be multiple population doublings during passage; therefore, the population doubling number of the culture is greater than the number of passages. The expansion of cells (i.e., the population doubling number) in the period between passages depends on many factors, including but not limited to inoculation density, culture medium, growth conditions, and the time between passages.

[0045] "Recombinant viral vector" refers to a vector based on a recombinant virus, which is a vector that is genetically modified to carry exogenous target genes and related viral elements and is packaged into viral particles. After the recombinant viral vector infects the host, the exogenous gene carried is expressed in the host. Recombinant viral vectors include, for example, recombinant lentiviral vectors and recombinant adeno-associated virus (AAV) vectors.

[0046] The terms "recombinant adeno-associated virus vector", "adeno-associated virus vector", "AAV vector" and "rAAV vector" are used interchangeably herein, and are a highly efficient exogenous gene transfer tool transformed from wild-type AAV viruses as people understand the life cycle of AAV viruses and their related molecular biological mechanisms. Viral vectors contain vector genomes and protein capsids. Viral vector capsids can be provided by any AAV serotype known in the art, including currently identified human and non-human AAV serotypes and AAV serotypes to be identified (see: Choi VW et al. 2005, Schmidt et al. 2008). Viral capsids can be mixed and matched with other vector components to form hybrid viral vectors, for example, the ITR and capsid of the viral vector can come from different AAV serotypes. In one aspect, the ITR can be from the AAV2 serotype, and the capsid is from, for example, the AAV2 or AAV9 serotype. In addition, those skilled in the art will recognize that the vector capsid may also be a mosaic capsid (e.g., a capsid composed of a mixture of capsid proteins from different serotypes) or even a chimeric capsid (e.g., a capsid protein containing foreign or unrelated protein sequences for producing markers and / or altering tissue tropism).

[0047] Screening method for Sf9 cell lines without Sf-RV contamination

[0048] During the culture of commercial Sf9 cells, rhabdovirus (Sf-R Habdo v The present invention provides a method for screening Sf9 cell lines free of Sf-RV contamination from commercially available Sf9 cells.

[0049] In some embodiments, the method of the present invention for screening Sf9 cell lines free of Sf-RV contamination from commercially available Sf9 cells comprises the following steps:

[0050] 1) Recovery of commercially available Sf9 cells and restoration of cell growth status

[0051] The commercially derived Sf9 cells are taken out of the liquid nitrogen tank, and the basic serum-free insect cell culture medium (e.g., ESFAF™ insect cell culture medium (purchased from Expression Systems), Grace insect cell culture medium (Gibco), Sf-900 II SFM culture medium, Sf-900III SFM culture medium, etc.) is supplemented with fetal bovine serum (FBS) (e.g., 5%-20% FBS, e.g., 10% FBS) to culture the commercially derived Sf9 cells. The commercially derived Sf9 cells are statically cultured in a culture flask or culture plate at about 27-28°C, e.g., about 27.5°C in a constant temperature incubator; when the commercially derived Sf9 cells adhere to the wall and the degree of adhesion reaches more than 60%, they are digested and passaged using trypsin; passage is performed 2-3 times to restore the cell growth state to the best; and a cell suspension is prepared.

[0052] 2) Preparation of monoclonal screening culture medium

[0053] The first basal serum-free insect cell culture medium is supplemented with lactalbumin hydrolysate and Yeasolate, for example, lactalbumin hydrolysate is supplemented to 2000 mg / L-5000 mg / L, preferably, 3000 mg / L, 3500 mg / L, 4000 mg / L or 4500 mg / L; and Yeasolate is supplemented to 2000 mg / L-5000 mg / L, preferably, 3000 mg / L, 3500 mg / L, 4000 mg / L or 4500 mg / L, thereby preparing a first basal serum-free insect cell culture medium supplemented with lactalbumin hydrolysate and Yeasolate, wherein the first basal serum-free insect cell culture medium can be any basal serum-free insect cell culture medium (for example, ESF AF™ insect cell culture medium (purchased from Expression Systems), Grace insect cell culture medium (Gibco), Sf-900 II SFM culture medium, Sf-900III SFM culture medium, etc.).

[0054] Whey protein hydrolysate is an enzymatic hydrolysate of whey protein that contains high levels of essential amino acids.

[0055] There is no particular limitation on the whey protein hydrolysate of the present invention, as long as it is obtained by degrading whey protein using a protease. Commercially available whey protein hydrolysate can be used and added in an amount recommended by the manufacturer's instructions. For example, commercially available whey protein hydrolysate from Merck is used.

[0056] Yeastolate is a yeast extract obtained by autolysis of yeast cells of Saccharomyces cervisiae. Yeastolate of the present invention is not particularly limited, and commercially available Yeastolate can be used and added in an amount recommended by the manufacturer's instructions. For example, Yeastolate commercially available from US Biological and Yeastolate commercially available from Sartorius can be used.

[0057] In some embodiments, the first basal serum-free insect cell culture medium supplemented with whey protein hydrolysate and Yeasolate is Grace supplemented insect cell culture medium (Gibco).

[0058] A monoclonal screening culture medium is prepared with 30%-60% of a first basal serum-free insect cell culture medium supplemented with whey protein hydrolysate and Yeasolate, 20%-35% of a second basal serum-free insect cell culture medium, and 10%-35% of FBS, wherein the first basal serum-free insect cell culture medium (i.e., a basal serum-free insect cell culture medium not supplemented with whey protein hydrolysate and Yeasolate) can be any basal serum-free insect cell culture medium (e.g., ESF AF™ insect cell culture medium (available from Expression Systems), Grace insect cell culture medium (Gibco), Sf-900 II SFM culture medium, Sf-900 III SFM culture medium, etc.), and the second basal serum-free insect cell culture medium can be any basal serum-free insect cell culture medium (e.g., ESF AF™ insect cell culture medium (available from Expression Systems), Grace insect cell culture medium (Gibco), Sf-900 II SFM culture medium, Sf-900 III The first basal serum-free insect cell culture medium and the second basal serum-free insect cell culture medium may be the same or different. For example, the first basal serum-free insect cell culture medium and the second basal serum-free insect cell culture medium may be independently selected from ESFAF™ insect cell culture medium (purchased from Expression Systems), Grace insect cell culture medium (Gibco), Sf-900 II SFM culture medium, Sf-900 III SFM culture medium and other commercially available basal serum-free insect cell culture media for culturing Sf9 cells.

[0059] In some embodiments, Grace's supplemented insect cell culture medium (GIBCO), Sf 900 II SFM medium (GIBCO), and FBS are mixed at a volume ratio of 3:1:1 to obtain a monoclonal screening culture medium.

[0060] In some embodiments, Grace's supplemented insect cell culture medium (Pnocell), Sf900 III SFM medium (GIBCO), and FBS are mixed at a volume ratio of 1:1:1 or 3:2:1.

[0061] The monoclonal screening culture fluid prepared by the present invention has the functions of screening monoclonal Sf9 cells and supporting the growth and expansion of monoclonal Sf9 cells.

[0062] 3) Dilution and plating of cell suspension

[0063] The cell suspension obtained in step 1) was centrifuged and the cells were washed several times with basic serum-free insect cell culture medium; then the monoclonal screening culture medium freshly prepared in step 2) was taken and the cell suspension prepared in step 1) was diluted to 0.1×10 4 cells / ml-1×10 6 cells / ml, for example 1×10 5 cells / ml, and then dilute the monoclonal screening culture medium to 25-100 cells / ml, and inoculate the culture plates, such as 96-well culture plates, at 1-10 cells / well, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cells / well, and place the plates in a constant temperature incubator at about 27-28°C, such as about 27.5°C, for static culture;

[0064] or

[0065] The cell suspension obtained in step 1) is centrifuged and the cells are washed several times with a basic serum-free insect cell culture medium; then the monoclonal screening culture medium freshly prepared in step 2) is taken and at least one antiviral compound is added to make the final concentration of the at least one antiviral compound be 10-50 ng / ml, and the cells are diluted to 0.1×10 4 / ml-1×10 6 / ml, for example 1×10 5 The cells are diluted to 25-100 cells per ml, and then inoculated into a culture plate, such as a 96-well culture plate, at 1-10 cells per well, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cells per well, and placed in a constant temperature incubator at about 27-28° C., such as about 27.5° C. for static culture.

[0066] Antiviral compounds added to the culture medium are used to inhibit rhabdovirus replication. In some embodiments, the diluted and plated single cell or a few cells are cultured with a monoclonal screening medium supplemented with at least one antiviral compound to inhibit rhabdovirus replication.

[0067] Exemplary antiviral compounds include, but are not limited to, nucleoside analogs, interferons, and virus-specific antibodies, such as monoclonal or polyclonal antibodies that neutralize viruses. Non-limiting examples of nucleoside analogs include ribavirin, 6-azauridine, adenosine, acyclovir, 9- / 3-D-arabinofuranosyl adenine (Ara-A), cytosine arabinose, adenine arabinoside, and guanine 7-N-oxide (G-7-Ox). In some embodiments, at least one antiviral compound includes 6-azauridine. In some embodiments, the antiviral compound is selected from ribavirin, 6-azauridine, adenosine, acyclovir, 9- / 3-D-arabinofuranosyl adenine (Ara-A), cytosine arabinose, adenine arabinoside, and guanine 7-N-oxide (G-7-Ox). In some embodiments, the antiviral compound is 6-azauridine. In some embodiments, the antiviral compound is ribavirin.

[0068] 4) Cell culture, Sf-RV detection and cell passaging

[0069] From the second day to the tenth day after plating, for example, from the second day to the seventh day after plating, observe the well plate every day to find the single cell wells, and mark the monoclonal cell wells obtained by limiting dilution. Regularly observe the cell growth of the corresponding wells in the 96-well plate, and perform rhabdovirus Sf-RV detection at the same time. According to the cell growth and rhabdovirus detection results, the well plate cells are selectively replaced or expanded and passaged, wherein the replacement of the medium is to replace the culture medium with the monoclonal screening culture medium corresponding to the culture of each well plate cell or the monoclonal screening culture medium added with at least one antiviral compound with a final concentration of 10-50ng / ml.

[0070] The cell culture supernatant was taken for Sf-RV virus detection.

[0071] There are many known detection techniques in the art that can be used to detect Sf-RV virus, including polymerase chain reaction (PCR), reverse transcription reaction (RT), reverse transcription-polymerase chain reaction (RT-PCR), RT-PCR combined with nested PCR, quantitative PCR (qPCR), RT-PCR combined with quantitative PCR (quantitative RT-PCR or RT-qPCR), multiple probe hybridization techniques, electron microscopy techniques, and multiple antibody-based detection techniques known in the art, such as ELISA assays. Detection techniques also include, but are not limited to, plaque assays and cytopathic effect (CPE) observations, as well as bioinformatics techniques such as BLAST searches, etc.

[0072] In one embodiment, a virus extraction kit is used to extract viral RNA from the cell culture supernatant, and the Sf-RV virus is detected using the RT-PCR method.

[0073] 5) Expand the culture of cells without Sf-RV virus contamination

[0074] Single cells that are initially detected to be free of Sf-RV virus contamination in a 96-well plate are expanded and cultured using, for example, 24-well plates, 6-well plates, T25 square flasks, T75 square flasks, and T225 square flasks using the monoclonal screening culture medium corresponding to the cells in each well plate or the monoclonal screening culture medium supplemented with at least one antiviral compound at a final concentration of 10-50 ng / ml, to perform Sf-RV virus detection and obtain cell lines that are free of Sf-RV virus contamination.

[0075] In some embodiments, the cell line free of Sf-RV virus contamination is a cell line obtained by culturing in step 3) and step 4) using only a monoclonal screening culture medium.

[0076] In some embodiments, the cell line free of Sf-RV virus contamination is a cell line obtained by culturing in step 3) and step 4) using a monoclonal screening culture medium supplemented with at least one antiviral compound at a final concentration of 10-50 ng / ml.

[0077] Compared with the culture performed in step 3) and step 4) using only the monoclonal screening culture medium, the culture performed in step 3) and step 4) using the monoclonal screening culture medium supplemented with at least one antiviral compound at a final concentration of 10-50 ng / ml can obtain Sf9 cell lines free of Sf-RV virus contamination more quickly, for example, 15-30 days faster.

[0078] In some embodiments, the antiviral compound is selected from ribavirin, 6-azauridine, vidarabine, acyclovir, 9- / 3-D-arabinofuranosyl adenine (Ara-A), cytosine arabinose, adenine arabinoside and guanine 7-N-oxide (G-7-Ox). In some embodiments, the antiviral compound is 6-azauridine. In some embodiments, the antiviral compound is ribavirin.

[0079] Method for acclimating Sf9 cell line without Sf-RV contamination

[0080] The Sf9 cell strain free of Sf-RV contamination obtained by the screening method of the Sf9 cell strain free of rhabdovirus contamination of the present invention is an adherent cell adapted to be cultured in a serum-containing medium. In order to meet the needs of large-scale production of recombinant proteins or viral vectors such as AAV viral vectors, it is important to establish a stable Sf9 serum-free suspension cell strain free of Sf-RV contamination and to perform large-scale culture amplification of suspension cells.

[0081] The full suspension culture system is easy to operate, and can complete the passage without trypsin digestion of adherent cells. The cell growth density is large, the culture cost is saved, and the culture process is easier to scale up. Therefore, the present invention provides a method for acclimating Sf9 cells without Sf-RV contamination, which performs serum-free culture acclimation and suspension acclimation on the Sf9 cell line without Sf-RV contamination obtained by the screening method of the Sf9 cell line without rhabdovirus contamination of the present invention.

[0082] In some embodiments, the method for acclimating an Sf9 cell line free of Sf-RV contamination comprises: culturing the Sf9 cells free of Sf-RV contamination obtained in step 5) above, digesting with trypsin when the cell adhesion reaches more than 60%, preparing a cell suspension, and culturing the cells at a concentration of about 1×10 5 / ml-1×10 6 The cells were inoculated into a triangular shake flask at 100-130 rpm in a basal serum-free medium supplemented with Pluronic™ F-68 in a shaking incubator at about 27-28°C. The cells were stably cultured for more than 3 generations, for example, 4-20 generations, to obtain a serum-independent suspension Sf9 cell line free of rhabdovirus contamination. A cell bank was established and named.

[0083] The time it takes for the Sf9 cells obtained in step 5) to adapt to serum-free culture conditions will vary depending on the growth characteristics of the specific Sf9 cells. If during the serum-free acclimation process, the cell viability drops below 80%, or the doubling time is significantly prolonged, it may be that the serum-free acclimation progress is too fast. Before restarting the continuous serum-free acclimation, the cells need to be passaged several times at the previous cell density.

[0084] In some embodiments, the basal serum-free insect cell culture medium is commercially available, for example, ESF AF™ insect cell culture medium (purchased from Expression Systems), Grace insect cell culture medium (Gibco), Sf-900 II SFM culture medium, Sf-900 III SFM culture medium, etc. In some embodiments, Pluronic™ F-68 is added to the basal serum-free insect cell culture medium, for example, Pluronic™ F-68 is added to 500 mg / L-2000 mg / L, preferably, 600 mg / L, 800 mg / L, 1000 mg / L or 1500 mg / L.

[0085] In some embodiments, the basal serum-free insect cell culture medium supplemented with Pluronic™ F-68 is Vigor-S101 medium (Bio-Tech Biotech Co., Ltd.).

[0086] In some embodiments, the present invention obtains cell lines named Sf9-FP01, Sf9-FP02, and Sf9-FP03 respectively without Sf-RV virus contamination.

[0087] The Sf9-FP01 cell line (classification name: Spodopterafrugiperda Ovary Cell, Latin name: Spodopterafrugiperda Ovary Cell) was deposited in the General Microbiology Center of China Microorganism Culture Collection Administration (address: Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101), with the deposit number CGMCC No. 46033 and the deposit date of August 8, 2024.

[0088] Use of the Sf9 cells free of Sf-RV virus contamination of the present invention

[0089] The present invention relates to the use of the Sf9 cell strain free of Sf-RV virus contamination obtained by the screening method of the Sf9 cell strain free of rhabdovirus contamination of the present invention and the optional acclimation method, which is used in the fermentation tank production of recombinant proteins and the fermentation tank production of viral vectors such as AAV viral vectors, preferably, to reduce oxygen consumption and reduce glucose consumption in the culture medium, thereby saving production costs and reducing the safety risks of biological products produced by Sf9.

[0090] Screening of Sf9 cell lines without Sf-RV contamination and with low oxygen and glucose consumption

[0091] Due to the high oxygen consumption of Sf9 cells and their inability to tolerate shear forces, in large-scale fermentation tank production, the demand for oxygen increases, but the ventilation volume cannot be increased indefinitely (a large number of bubbles will be generated and cell damage will occur). Therefore, there is an urgent need in the art for Sf9 cell lines that are free of Sf-RV contamination, have low oxygen and sugar consumption, and can increase cell viability and live cell density while reducing production costs.

[0092] After obtaining the Sf9 cell strain without Sf-RV contamination, the present invention further implements screening of the cell strain in fermentation tank production. Unexpectedly, it is found that the cell strain obtained by the screening method and optional acclimation method of the Sf9 cell strain without Sf-RV contamination of the present invention is a cell strain with low oxygen consumption and low sugar consumption, which provides better convenience for the large-scale fermentation tank production of recombinant proteins and viral vectors such as AAV viral vectors in the future.

[0093] In some embodiments, the present invention provides a method for screening a Sf9 cell line with low oxygen and glucose consumption, comprising:

[0094] A plurality of Sf9 cell strains free of Sf-RV contamination obtained by the screening method for Sf9 cell strains free of Sf-RV contamination of the present invention and optionally the acclimation method are inoculated into a fermenter for culture, for example, in a 1L-5L scale fermenter for culture, for example, using serum-free insect cell culture medium, preferably, using a basic serum-free insect cell culture medium supplemented with Pluronic™ F-68 for culture, and infected with a recombinant baculovirus after 2 days for the production of a recombinant protein or a viral vector such as an AAV viral vector, and the number of cells is regularly counted, the glucose concentration in the culture medium is measured, and the oxygen consumption is recorded to obtain a Sf9 cell strain with low oxygen and glucose consumption.

[0095] In some embodiments, the basal serum-free insect cell culture medium supplemented with Pluronic™ F-68 is Vigor-S101 medium (Bio-Tech Biotech Co., Ltd.). Example

[0096] The technical scheme in the embodiment of the present invention is clearly and completely described below. Obviously, the described embodiment is only a part of the embodiment of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by those of ordinary skill in the art without making creative work are within the scope of protection of the present invention. Unless otherwise specified, the various reaction reagents involved in the embodiments can be purchased through commercial channels.

[0097] Example 1 Screening of Sf9 cell lines free of Sf-RV contamination

[0098] In this example, Sf9 cell lines free of Sf-RV contamination were screened, and the specific screening method was as follows:

[0099] 1. Cell recovery: Sf9 cells were obtained from Beijing Union Medical College Cell Resource Center (Cell Resource Center, IBMS, CAMS / PUMC). Sf9 cells were taken out of the liquid nitrogen tank and recovered to 6-well plates. The culture medium used was ESF AF™ insect cell culture medium (purchased from Expression Systems) + 10% FBS (purchased from AusGeneX) (the culture medium using serum is also referred to as "complete culture medium" in this article). The culture was statically cultured in a 27.5°C biochemical incubator (Yatai Cologne, model: SPX-150B). The cell culture supernatant was tested for rhabdovirus by qPCR, and rhabdovirus contamination (also referred to as "Sf-RV contamination" in this article) was detected. The Sf9 cells contaminated by Sf-RV are also referred to as "Sf9-Rha" cells in this article.

[0100] 2. Cell culture: When the adhesion degree of the cultured Sf9-Rha cells reaches more than 60%, the Sf9-Rha cells are passaged and expanded for 2-3 consecutive times. When the cell state recovers to the best, the Sf9-Rha cells that have recovered to the best cell state are cultured in cell culture plates or square bottles. Thus, the Sf9-Rha cells are routinely maintained as a polyclonal Sf9 adherent cell population.

[0101] 3. Cell passaging: After culturing Sf9-Rha cells for 2-3 days, aspirate the cell supernatant into a sterile centrifuge tube; wash the cell culture plate or flask containing Sf9-Rha cells twice with DPBS, add 0.25% trypsin for digestion, and add ESF AF™ insect cell culture medium (purchased from Expression Systems) + 10% FBS complete culture medium to the cell culture plate or flask after digestion to terminate the trypsin digestion reaction. Blow the cells and mix them well, then aspirate them into a sterile centrifuge tube containing the cell supernatant, centrifuge at 800rpm for 5min, resuspend the Sf9-Rha cells with complete culture medium, expand the culture and pass the cells at a ratio of 1:3-1:5, and culture them statically in a 27.5℃ biochemical incubator.

[0102] 4. Cell screening: Use the limited cell culture method, 5 cells / well × 4 96-well plates and 10 cells / well × 4 96-well plates, 150μl / well for plating, wash the cells 3-6 times before plating to remove all the original culture medium containing rhabdovirus, add fresh monoclonal screening culture medium, and culture in a 27.5℃ biochemical incubator. The monoclonal screening culture medium is obtained by mixing Grace's supplemented insect cell culture medium (GIBCO, catalog number: 11605094), Sf 900 II SFM culture medium (GIBCO) and FBS in a volume ratio of 3:1:1.

[0103] In addition, the following experiment was carried out in parallel. Using the limited cell culture method, 5 cells / well × 4 96-well plates and 10 cells / well × 4 96-well plates were plated at 150 μl / well. Before plating, the cells were washed several times to remove all the original culture medium containing rhabdovirus, and fresh monoclonal screening culture medium was added. Ribavirin was added to a final concentration of 10, 20, 30, 40 or 50 ng / ml, and the cells were cultured statically in a biochemical incubator at 27.5°C. The monoclonal screening culture medium was obtained by mixing Grace's supplemented insect cell culture medium (GIBCO, catalog number: 11605094), Sf 900 II SFM culture medium (GIBCO) and FBS in a volume ratio of 3:1:1.

[0104] On the 2nd to 7th day after plating, observe the well plate every day to find single cell wells. Mark the monoclonal cell wells obtained by limiting dilution. Regularly observe the cell growth of the corresponding wells in the 96-well plate, and use the qPCR method to detect rhabdovirus in the cell culture supernatant. According to the cell growth and rhabdovirus detection results, selectively change the medium or expand the culture and pass the well plate cells. The medium change is to replace the culture medium with the monoclonal screening culture medium corresponding to the cells in each well plate or add a monoclonal screening culture medium with a final concentration of 10-50ng / ml ribavirin.

[0105] Control cell wells were set up. For comparison, the limited cell culture method was used, with 5 cells / well × 4 96-well plates and 10 cells / well × 4 96-well plates, 150 μl / well for plating. Before plating, the cells were washed several times to remove all the original culture medium containing rhabdovirus. No monoclonal screening culture medium or ribavirin was added. Instead, culture medium was added: ESF AF™ insect cell culture medium (purchased from Expression Systems) or IB907d culture medium (Yishengke, https: / / www.yskbio.com / Insect-Cell-Serum-Free-Medium.html) to culture cells, with or without 2%-10% FBS. As a result, the corresponding wells were observed on days 2-7, and no single cell wells were obtained.

[0106] 5. Cell expansion and subculturing: After culturing single cells in 96-well plates, expand and subculture them in 24-well plates, 6-well plates, T25 flasks, T75 flasks, and T225 flasks.

[0107] Specifically, after the single cells in the 96-well plate formed obvious cell clusters, the cells were dispersed by blowing and directly expanded to the 24-well plate, 750 μL / well, and cultured at 27.5°C.

[0108] When the cell confluence in the 24-well plate reaches 30-60%, the cells are expanded and dispersed by blowing. The cell suspension is aspirated into a centrifuge tube and centrifuged at 800 rpm for 5 min. After discarding the old culture medium, the cells are resuspended in fresh corresponding culture medium (i.e., the corresponding monoclonal screening culture medium or the monoclonal screening culture medium supplemented with ribavirin at a final concentration of 10-50 ng / ml) and the cells are expanded to a 6-well plate at 3 mL / well and cultured in a 27.5°C biochemical incubator.

[0109] When the cell confluence in the 6-well plate reaches 30-60%, the cells are propagated. The cells are dispersed by blowing, and the cell suspension is aspirated into a centrifuge tube. Centrifuge at 800 rpm for 5 min. After discarding the old culture medium, the cells are resuspended in fresh corresponding culture medium (i.e., the corresponding monoclonal screening culture medium or the monoclonal screening culture medium supplemented with ribavirin at a final concentration of 10-50 ng / ml). The cells are propagated to T25 square bottles, 5 mL / well, and cultured in a 27.5°C biochemical incubator.

[0110] Propagation of T75 and T225 flasks: In T25 flasks, cells are propagated when the confluence reaches 30-60%. For cells that are firmly attached to the wall, digestion is required: After the T25 flask is rinsed with DPBS twice, 0.25% trypsin digestion solution is added to fully wet the cells, and the digestion solution is aspirated. The T25 flask is placed in a 27.5℃ biochemical incubator for digestion for 5-10 minutes. After digestion, monoclonal screening culture medium is added to terminate digestion. After blowing to disperse the cells, centrifuge and change to the corresponding culture medium (i.e., the corresponding monoclonal screening culture medium or the monoclonal screening culture medium with a final concentration of 10-50ng / ml ribavirin) for continued culture; if the cell line is not firmly attached to the wall, the cells can be dispersed by direct blowing, and then centrifuged to change to the corresponding culture medium (i.e., the corresponding monoclonal screening culture medium or the monoclonal screening culture medium with a final concentration of 10-50ng / ml ribavirin) for continued culture. The culture volumes are 12 mL for T75 square bottles and 30 mL for T225 square bottles.

[0111] 6. Cell domestication: When the cells are expanded and subcultured to a certain scale and the rhabdovirus test is negative, a certain number of cells are frozen for future use. At the same time, they are digested, expanded and subcultured into triangular culture flasks for suspension domestication. The culture medium used is Vigor-S101 culture medium (Bei Anji Biotechnology Co., Ltd.). The culture conditions are: 15-30 ml of cell suspension is cultured in a 125 ml shake flask at a rotation speed of 100-120 rpm and cultured in a biochemical incubator at 27-28°C for about 20-30 days, during which the medium is changed every 3-5 days.

[0112] During the suspension acclimation period, samples were taken and counted every day, and the acclimation conditions were adjusted in real time according to the cell counting results:

[0113] When the cells grow slowly, centrifuge at 800 rpm for 5 minutes to change the medium; when the cells are severely aggregated (aggregation rate exceeds 40%), increase the shaker speed to 130-140 rpm; when the cell viability is low, reduce the shaker speed to 80-90 rpm.

[0114] In comparison, the Vigor-S101 medium was replaced with the serum-free medium Sf-900 II SFM medium without Pluronic™ F-68 supplementation for suspension acclimation of cells, and suspension cells were eventually obtained, but the acclimation time was prolonged to about 40 days, which increased the time to obtain suspension acclimated cells, and the cell metabolism and the number of cells obtained were lower than those using the Vigor-S101 medium.

[0115] 7. Cell cryopreservation: Take the acclimated cells, count them with an automatic cell counter, determine the cell viability, ensure that the cell viability is greater than 95%, centrifuge the cells at 800rpm at room temperature for 5 minutes, resuspend the cell pellet with cell freezing solution, the cell density is 2E+07 cells / ml, divide into cryopreservation tubes, after gradient cooling, transfer to a liquid nitrogen tank for long-term storage.

[0116] After expanding the culture and acclimating the monoclonal cells without Sf-RV contamination, multiple Sf9 cell banks without Sf-RV contamination were established. In this article, the Sf9 cell bank without Sf-RV contamination is referred to as the "Sf9-FP cell bank", and each Sf9-FP cell bank is named Sf9-FP01 cell strain, Sf9-FP02 cell strain, and Sf9-FP03 cell strain, respectively, wherein the Sf9-FP01 cell strain and Sf9-FP02 cell strain are obtained in steps 4 and 5 using a monoclonal screening culture medium supplemented with ribavirin at a final concentration of 10 ng / ml and then acclimated in step 6; the Sf9-FP03 cell strain is obtained in steps 4 and 5 using only a monoclonal screening culture medium and then acclimated in step 6.

[0117] Example 2 Sf-RV virus detection in Sf9-FP cell line

[0118] In the process of obtaining the Sf-FP cell line in Example 1, the culture supernatants of each cell harvested in step 4 "cell screening" and step 5 "cell expansion culture and passaging" were detected by quantitative PCR, and the culture supernatants of the Sf9-FP01 cell line, the Sf9-FP02 cell line, and the Sf9-FP03 cell line obtained after 2-6 passaging of the final cell line were monitored. The specific method is as follows.

[0119] The design of the quantitative PCR test for rhabdovirus genome is as follows:

[0120] 1. Comparative analysis of rhabdovirus genome sequences from insect cells

[0121] Using the NCBI database, we searched for 7 rhabdovirus genome sequences from insect cells, with genome sequence numbers MH926031.1, MH926030.1, MF536978.1, MH926029.1, KF947078.1, MF536979.1, and NC_025382.1. The rhabdovirus sequence reported in patent publication number WO2015051255A1 (SEQ ID NO.1 in WO2015051255A1) was also used. Using Vector NTI11.0 software sequence alignment, we found that the 8 rhabdovirus genome sequences had high homology in the RNA-dependent RNA polymerase gene.

[0122] 2. Selection of homologous sequences

[0123] According to the sequence comparison results, the completely identical sequences in the RNA-dependent RNA polymerase gene sequences of these 8 rhabdovirus strains were selected as the target sequences for probe primer design. The specific sequence information is as follows:

[0124] 5'TTTATGGTGAGTTTGGATTTTTCCAAGTGGAACACCAATATGAGAGCCCCAGACACACAGCCATTTTACCACACTATAGATACGATGTTTGGTTTGGAAAATTGTTTTACCAGGACACATGAAATGTTCTACAATTCCTTTTTGTACCTTATAGACGGTTCTTATCTCCCAACAATAGTTGATGATGGGTTCAAAACAGATATTGGATGTTGGCGACATCATCTTGGGGGAATCGAAGGTCTCAGACAAAAAGGATGGACTCTGTGGACAGTTATGTTGATCAGGCTAGTTGCGGAAAAATATATTTTCAATATGTCTATCATGGGACAGGGGGACAATCAAATGCTACTTCTAACTTTCGATTCTAATA3' (SEQ ID NO. 1), the sequence is named as the consensus sequence of Sf-RV RNA-dependent RNA polymerase gene.

[0125] 3. Design of probe primers based on homologous sequences

[0126] The consensus sequence of the Sf-RV RNA-dependent RNA polymerase gene was used as the target sequence, and the TaqMan-MGB probe primers were designed using Primer express 3.0 software, as follows:

[0127] GQP-4-F TCGAAGGTCTCAGACAAAAAGGA (Tm: 59) (SEQ ID NO. 2)

[0128] GQP-4-R TTCCGCAACTAGCCTGATCA (Tm:58) (SEQ ID NO.3)

[0129] GQP-4-P FAM-ACTCTGTGGACAGTTATG-MGB (Tm: 69) (SEQ ID NO.4)

[0130] The size of the amplified fragment was 64 bp.

[0131] 4. Preparation of standards for quantitative PCR based on homologous sequences

[0132] A single-stranded RNA with a length of 85 nt was synthesized as a quantitative PCR standard. Since rhabdovirus is a negative-strand RNA virus, the synthetic sequence when preparing the standard is negative-strand RNA. The details are as follows:

[0133] 5'aaauauauuuuuccgcaacuagccugaucaacauaacuguccacagaguccauccuuuuugucugagaccuucgauucccccaag3' (SEQ ID NO.5)

[0134] The results are shown in Table 1 below, which show that no rhabdovirus was detected in the culture supernatants of the Sf9-FP01, Sf9-FP02, and Sf9-FP03 cell lines.

[0135] Table 1. Detection of Sf RV virus in the culture supernatant of each Sf9 cell line

[0136] Sample No. Sample Information Inspection quantity Rhabdovirus residual vg / mL 1 Sf9-Rha cell culture supernatant 50ul 2.88E+09 2 Culture supernatant of Sf9-FP01 cell line 50ul Not detected 3 Culture supernatant of Sf9-FP02 cell line 50ul Not detected 4 Culture supernatant of Sf9-FP03 cell line 50ul Not detected 5 Positive Control 50ul 5.94E+08 6 Negative control 50ul Not detected

[0137] Note: Sf9-Rha cells: a cell population in which rhabdovirus was detected in the cell culture supernatant of the Sf9 cell line without Sf-RV contamination before screening; positive control: culture supernatant of Sf9-V432A cells contaminated with rhabdovirus (Sf9-V432A cells were preserved by Beijing Jinlan Gene Technology Co., Ltd. and tested positive for rhabdovirus by the China Food and Drug Inspection Institute); negative control: monoclonal screening culture medium that does not contain ribavirin.

[0138] Example 3 Study on the growth curve of each cell line

[0139] The Sf9-FP01, Sf9-FP02 and Sf9-FP03 cell lines screened and tested in Example 1 and Example 2 were inoculated into a 125 ml triangular shake flask at 2.0E+06 cells / ml, 30 ml / flask, and cultured in a shaker at 27-28°C and 120 rpm. The culture medium used was Vigor-S101 insect cell serum-free culture medium (Shanghai Biogen). Samples were taken and counted every day, and cell growth curves were drawn to determine cell growth.

[0140] The results are as follows Figure 1 As shown in the figure. The analysis of cell density and cell viability showed that compared with the rhabdovirus-contaminated control cell Sf9-Rha (cell density 9.1E6 cells / ml), the Sf9-FP02 cell line and the Sf9-FP01 cell line reached higher cell densities, 1.14E7 cells / ml (day 4) and 1.27E7 cells / ml (day 5), respectively; the cell viability was greater than 95%. When the Sf9-FP02 cell line was cultured to the fifth day, it was in the late stage of cell growth, and the insufficient nutrition of the culture medium and cell metabolism led to a significant decrease in cell density and cell viability.

[0141] Example 4 Fermentation tank growth and metabolism studies of various cell lines

[0142] In order to further screen cell lines from the fermentation tank and metabolic levels, the above three Sf9 cell lines (i.e., Sf9-FP01, Sf9-FP02 and Sf9-FP03 cell lines) and the control cell Sf9-Rha were simultaneously inoculated into a 2L fermenter for culture. On the second day, the cells were infected with recombinant baculovirus for AAV recombination.

[0143] Specifically, three Sf9 cell lines (i.e., Sf9-FP01, Sf9-FP02, and Sf9-FP03 cell lines) and control cell Sf9-Rha cells were inoculated into a 2L scale fermenter at 2.0 E+6 cells / mL. The medium used was Vigor-S101 insect cell serum-free medium (Shanghai Biogen). After inoculation, the fermenter parameters were set as follows: 250rpm, 35% DO, 28.0℃, Sparger O2 was linked to dissolved oxygen (DO), and the maximum ventilation volume was 500mLPM (the unit of the flow meter used in the equipment, equivalent to 0.5 L / min). The glucose concentration in the culture medium was measured by sampling and counting. On the second day of culture, the cell density was diluted to 4.0E+06 cells / mL and recombinant baculovirus infection was performed as follows, thereby preparing the recombinant AAV virus vector AAV9-EGFP (EGFP: enhanced green fluorescent protein). As described in CN111088284, two recombinant baculoviruses are used to co-infect Sf9 cells to package and produce rAAV9, wherein one recombinant baculovirus carries the rep2 and cap9 gene expression frames of AAV, and the other recombinant baculovirus carries the ITR sequence of the rAAV vector and the gene expression frame expressing the EGFP protein. The Bac-to-AAV system is patented by Virovek, Inc. of the United States. After the two recombinant baculoviruses co-infect each Sf9 cell line (i.e., Sf9-FP01, Sf9-FP02 and Sf9-FP03 cell lines) and the control cell Sf9-Rha, the culture is continued for 96h-120h, the cell viability is determined, and the recombinant AAV virus vector AAV9-EGFP is harvested. The cells are counted every day, the glucose content in the culture medium is detected, and the oxygen consumption is recorded. The statistical results are as follows Figure 2 and Figure 3 shown.

[0144] Depend on Figure 2 It can be seen that during the cell culture process, the Sf9-FP01 cell line was infected with baculovirus for the late stage of AAV recombination (5 days), and still maintained a relatively high cell density and cell viability, which is beneficial to the improvement of AAV production and quality.

[0145] Depend on Figure 3 It can be seen that during the cell culture process, the glucose and oxygen consumption of the control cells Sf9-Rha contaminated with rhabdovirus were significantly higher than those of the cell lines without rhabdovirus contamination. Among them, the Sf9-FP02 cell line had the lowest glucose consumption, while the Sf9-FP01 cell line had the lowest oxygen consumption.

[0146] Because Sf9 cells have the characteristics of high oxygen consumption and are not resistant to shear force, in large-scale fermentation tank production, Sf9 cells have an increased demand for oxygen, and the ventilation volume cannot be increased indefinitely (a large number of bubbles will be generated and cell damage will occur). Therefore, reducing the high oxygen consumption characteristics of Sf9 cells is an urgent problem to be solved. While ensuring the removal of rhabdovirus contamination, the present invention further screens through fermentation tanks. The results show that cell strains with low oxygen consumption and low sugar consumption are obtained, which provides better convenience for future large-scale production of recombinant proteins or viral vectors such as AAV viral vectors.

[0147] Example 5 Next-generation sequencing of Sf9-FP01 cell line

[0148] The Sf9-FP01 cell line was selected to establish a sequencing library and perform next-generation sequencing.

[0149] RNA-seq analysis process: Total RNA was extracted from Sf9-FP01 cell line using TIANGEN kit (DP424), and sent to sequencing company (Beijing Berry Genomics Co., Ltd.) for sequencing using Truseq mRNA-seq (EU) platform. The sequencing read data were analyzed using Hisat2, Samtools, R, Python and other software. The results are as follows:

[0150] 1. Test subjects / results

[0151] Data analysis software: Hisat2, Samtools

[0152] Data analysis methods: Hisat2, Samtools depth, Samtools sort, Samtools view

[0153] Sequencing read data volume:

[0154] RNAseq-16: 17,145,416 reads; 5,143,624,800 Nucleotides

[0155] RNAseq-17: 16,497,843 reads; 4,949,352,900 Nucleotides

[0156] RNAseq-18: 27,698,445 reads; 8,309,533,500 Nucleotides

[0157] Data quality standard after filtering: Clean Q30 Bases Rate ≥90%

[0158] Average fragment length: 150bp; GC%, AT% evenly distributed

[0159] Reference sequences: MH926031.1, MH926030.1, MF536978.1, MH926029.1, KF947078.1, MF536979.1 and NC_025382.1, Sf-RV.

[0160] 2. Results and Analysis

[0161] The Q30 of Sf9-FP01 RNA-seq sequencing data was > 90%, indicating that the sequencing data quality was qualified, which means that the data of this analysis was credible.

[0162] Based on the data analysis results, the following conclusions were drawn:

[0163] (1) There is no rhabdovirus homologous sequence in the Sf9-FP01 cell line.

[0164] There is no complete Sf-RV* genome in the Sf9-FP01 (RNAseq-16~RNAseq-18) cell line, with 1X coverage of 0% and 4X coverage of 0%, so it is determined that there is no rhabdovirus homologous sequence in the Sf9-FP01 cell line.

[0165] (2) The complete rhabdovirus genome is not present in the Sf9-FP01 cell line product.

[0166] The sequencing data of Sf9-FP01 cell line were compared with the rhabdovirus genomes of MH926031.1, MH926030.1, MF536978.1, MH926029.1, KF947078.1, MF536979.1 and NC_025382.1, and the 1X coverage was less than 10%, and the 4X coverage was 0%. Therefore, it was determined that there was no complete rhabdovirus genome in the Sf9-FP01 cell line.

[0167] The exemplary embodiments of the present invention are described above, and it should be understood by those skilled in the art that these disclosures are only exemplary, and various other substitutions, adaptations and modifications can be made within the scope of the present invention. Therefore, the present invention is not limited to the specific embodiments listed herein.

Claims

1. A method for screening a Sf9 cell line with low oxygen and sugar consumption and no rhabdovirus contamination, characterized in that: The steps include: 1) Preparation of cell suspension: The Sf9 cells contaminated with rhabdovirus are cultured in a basic serum-free insect cell culture medium supplemented with 10% FBS to prepare a cell suspension, wherein the basic serum-free insect cell culture medium is selected from ESF AF™ insect cell culture medium, Grace insect cell culture medium, ESF 921 culture medium, Sf 900 II SFM culture medium and Sf 900 III SFM culture medium; 2) Preparation of monoclonal screening culture medium: A monoclonal screening culture medium is prepared using 60% of a first basic serum-free insect cell culture medium supplemented with whey protein hydrolysate and Yeasolate, 20% of a second basic serum-free insect cell culture medium, and 20% of FBS, wherein the first basic serum-free insect cell culture medium supplemented with whey protein hydrolysate and Yeasolate is an insect cell culture medium supplemented with Grace, and the second basic serum-free insect cell culture medium is an Sf 900 II SFM culture medium; 3) Dilution and plating of cell suspension Centrifuge the cell suspension obtained in step 1 and wash the cells several times with basic serum-free insect cell culture medium to remove the culture medium containing rhabdovirus; then take the monoclonal screening culture medium freshly prepared in step 2 and dilute the cells to 0.1×10 4 / ml-1×10 6 Cells / ml, then dilute to 25-100 cells / ml, inoculate in a culture plate at 1-10 cells / well, and place in a constant temperature incubator at 27-28°C for static culture; or The cell suspension obtained in step 1 was centrifuged and the cells were washed several times with basic serum-free insect cell culture medium to remove the culture medium containing rhabdovirus; then the monoclonal screening culture medium freshly prepared in step 2 was added with the antiviral compound to a final concentration of 10 ng / ml, and the cells were diluted to 0.1×10 4 / ml-1×10 6 cells / ml, and then gradiently diluted to 25-100 cells / ml, inoculated into a culture plate at 1-10 cells / well, and placed in a constant temperature incubator at 27-28°C for static culture, wherein the antiviral compound is ribavirin; 4) Cell culture, rhabdovirus detection and cell passaging From the second day to the tenth day after plating, the well plate is observed every day to find single cell wells; the cell growth of the monoclonal cell wells obtained by limiting dilution is observed regularly, and rhabdovirus detection is performed at the same time; according to the cell growth and rhabdovirus detection results, the well plate cells are replaced with medium or expanded culture and passaged, wherein the medium replacement is to replace the culture medium with the monoclonal screening culture medium corresponding to the cells in each well plate or the monoclonal screening culture medium with the antiviral compound ribavirin added at a final concentration of 10 ng / ml; 5) Expanding the culture of cells free of rhabdovirus contamination The cells obtained in step 4 that were initially tested to be free of rhabdovirus contamination were expanded and cultured using the monoclonal screening culture medium corresponding to the cells in each well plate or the monoclonal screening culture medium supplemented with the antiviral compound ribavirin at a final concentration of 10 ng / ml; rhabdovirus detection was performed to obtain an Sf9 cell line free of rhabdovirus contamination.

2. The method for screening a Sf9 cell line with low oxygen and glucose consumption and no rhabdovirus contamination according to claim 1, wherein: In step 3, the gradient diluted cells are seeded into a 96-well culture plate at 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 cells per well, and placed in a constant temperature incubator at 27.5° C. for static culture.

3. The method for screening a Sf9 cell line with low oxygen and glucose consumption and no rhabdovirus contamination according to claim 1, wherein: The rhabdovirus detection is performed by a technique selected from the group consisting of reverse transcription-polymerase chain reaction, RT-PCR combined with nested PCR, quantitative PCR, RT-PCR combined with quantitative PCR, probe hybridization techniques, electron microscopy techniques, and antibody-based detection techniques, plaque assays and cytopathic effects, and bioinformatics techniques.

4. A method for acclimating an Sf9 cell line free of rhabdovirus contamination, characterized in that: The Sf9 cell strain without rhabdovirus contamination obtained by the screening method for the Sf9 cell strain without rhabdovirus contamination and low oxygen and sugar consumption according to any one of claims 1 to 3 is cultured until the cell adhesion reaches more than 60%, and trypsin digestion is performed to prepare a cell suspension; then, a basic serum-free culture medium supplemented with Pluronic™ F-68 is used to perform suspension culture in a shaking incubator at 27-28°C and 100-130rpm; the suspension cultured cells are stably cultured for 4-20 generations to obtain a serum-independent suspension Sf9 cell strain without rhabdovirus contamination, wherein the basic serum-free insect cell culture medium supplemented with Pluronic™ F-68 is Vigor-S101 culture medium.

5. The method for acclimating the Sf9 cell line free of rhabdovirus contamination according to claim 4, wherein: The suspension culture is carried out at 27.5°C and 100-130 rpm; the suspension cultured cells are stably cultured for 4-20 generations to obtain a serum-independent suspension Sf9 cell line free of rhabdovirus contamination.

6. An Sf9 cell line free of rhabdovirus contamination, characterized in that: The cell line is named Sf9-FP01 cell line, and its biological preservation number is CGMCC No.46033. It is obtained according to the method of claim 4 or 5. 7 . The Sf9 cell line free of rhabdovirus contamination according to claim 6 , which has low oxygen consumption and low glucose consumption during cell culture.

8. The use of the Sf9 cell line free of rhabdovirus contamination according to claim 6 or 7, characterized in that: Used for recombinant protein production or AAV viral vector production.

9. The use of the Sf9 cell line free of rhabdovirus contamination according to claim 6 or 7, characterized in that: Used in insect cell-baculovirus expression vector system.

10. A method for screening a Sf9 cell line with low oxygen and sugar consumption and no slug-like contamination, characterized in that: The method comprises inoculating a serum-independent, rhabdovirus-free suspended Sf9 cell strain obtained by the acclimation method according to claim 4 or 5 into a fermenter, culturing the cell strain in a basic serum-free medium supplemented with Pluronic™ F-68, and screening a Sf9 cell strain with low oxygen and sugar consumption.

11. Use of the Sf9 cell line with low oxygen and sugar consumption and no rhabdovirus contamination obtained by the screening method of claim 10, characterized in that: Used for recombinant protein production or AAV viral vector production.

12. Use of the Sf9 cell line with low oxygen and sugar consumption and no rhabdovirus contamination obtained by the screening method of claim 10, characterized in that: Used in insect cell-baculovirus expression vector system.

Images