InDel molecular markers related to sheep growth traits and their applications

Abstract

The present invention discloses an InDel molecular marker associated with sheep growth traits and its application, belonging to the field of genetic engineering. The InDel molecular marker sequence is TTAGGATTTTCCTCATGGACTATGATAAT, located between sites 202225118-202225146 on sheep chromosome 1, according to the reference genome version ARS-UI_Ramb_v2.0. When this InDel molecular marker sequence is absent, sheep have relatively high growth performance. This InDel molecular marker provides a new molecular marker site for measuring sheep growth traits.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to an InDel molecular marker related to sheep growth traits and an application thereof. Background Art

[0002] Sheep are an important source of animal protein for humans (Goldansaz et al., 2022). Improving sheep growth performance has significant economic benefits for sheep farming. Growth traits are one of the most important indicators for selecting and breeding meat sheep breeds. Breeding sheep with fast growth rates and larger bodies is beneficial for improving production efficiency and industrialization. If growth traits are to be applied to meat sheep breeding, molecular markers are needed to identify individuals with good growth traits for breeding. Currently, there are few molecular markers suitable for selecting growth rates in domestic sheep breeds.

[0003] IGF2BP2 (insulin-like growth factor 2 mRNA binding protein 2), whose family members also include IGF2BP1 and IGF2BP3, is a post-transcriptional regulator of RNA localization, stability, and translation, playing important roles in physiological functions such as embryonic development, muscle growth, and cancer. However, the direct effects of this gene on sheep growth and development and its mechanism of action have not been reported. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide an InDel molecular marker related to sheep growth traits and its application.

[0005] The technical solution of the present invention is: application of InDel molecular markers in assisted breeding of sheep growth traits, the InDel molecular marker sequence is TTAGGATTTTCCTCATGGACTATGATAAT, located at sites 202225118-202225146 of sheep chromosome 1, reference genome version ARS-UI_Ramb_v2.0, when the InDel molecular marker sequence is missing, the sheep has relatively higher growth performance.

[0006] A specific primer pair for identifying sheep growth performance, the nucleotide sequences of the primer pair are shown as SEQ ID No. 1 and SEQ ID No. 2.

[0007] A kit containing the specific primer pair described above.

[0008] Application of the above-mentioned specific primer pair or kit in assisting the prediction of sheep growth performance.

[0009] Furthermore, the application method is: using the genomic DNA of the sheep to be tested as a template, and performing PCR amplification with the primer pair shown in SEQ ID No. 1 and SEQ ID No. 2, if only an amplification product of 421bp is obtained, the sheep to be tested is a wild type and has relatively low growth performance; if both amplification products of 421bp and 392bp are obtained, the sheep to be tested is a heterozygous mutant type and has relatively high growth performance.

[0010] Furthermore, the nucleotide sequence of the 421 bp amplification product is shown as SEQ ID No. 3, and the nucleotide sequence of the 392 bp amplification product is shown as SEQ ID No. 4.

[0011] Compared with the prior art, the present invention has the following beneficial effects:

[0012] The present invention found that there is an insertion / deletion (InDel) in the sheep IGF2BP2 gene. Compared with the wild type (insertion), the mutant with a 29bp sequence deletion has higher growth performance. The InDel molecular marker provides a new molecular marker site for measuring sheep growth traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0013] Figure 1 : Select signal analysis to locate the IGF2BP2 gene;

[0014] Figure 2 : PCR result diagram containing the target SNP site; the wild-type sheep genome PCR product with the g.202225118-202225146 mutation molecular marker is 421bp in size, and the mutant sheep genome PCR product with the g.202225118-202225146 mutation molecular marker is 392bp in size;

[0015] Figure 3 : Sanger sequencing results of PCR product fragments; A indicates a heterozygous sheep individual lacking the g.202225118-202225146 mutation molecular marker; B shows a wild-type individual containing this sequence;

[0016] Figure 4 : The body weights of mutant sheep rams (MUT) and wild-type rams (WT) were compared at different ages. The body weights of mutant sheep rams were higher than those of wild-type sheep rams. DETAILED DESCRIPTION

[0017] The experimental methods in the following examples are conventional methods unless otherwise specified. The experimental materials used in the following examples are purchased from commercial channels unless otherwise specified.

[0018] Example 1 Discovery of InDel Molecular Markers

[0019] According to the results of resequencing and haplotype analysis, the important variant sites in the selected region of IGF2BP2 were obtained ( Figure 1 Targeting the mutation site, blood samples of over 200 sheep from core groups of different breeds with significant differences in growth performance were collected. Genotyping of the mutation site was performed using Sequenom MassArray and KASP probes. Combined with known pedigree and phenotypic information, statistical methods were used to conduct association analysis of growth phenotypes, such as weight, at different growth stages. This study identified an inDel molecular marker in the IGF2BP2 gene that was associated with the growth phenotype.

[0020] This InDel molecular marker is located on sheep chromosome 1 at positions 202225118-202225146 (reference genome version GCF_016772045.1, ARS-UI_Ramb_v2.0) and has an insertion / deletion sequence of TTAGGATTTTCCTCATGGACTATGATAAT. When this sequence is missing, sheep have higher growth performance.

[0021] Example 2 Detection of InDel Molecular Markers

[0022] 1. Design specific primers

[0023] Upstream primer IGF2BP2F1: GTGGCTCTGCTGGTAAAGAATCA (SEQ ID No. 1)

[0024] Downstream primer IGF2BP2R1: GCCTTGACAAGCCCAAGGAGATA (SEQ ID No. 2)

[0025] 2. Use the specific primers to perform PCR amplification on sheep DNA samples:

[0026] The amplification system is as follows: the high-fidelity PCR enzyme ( Max Master Mix) was used for amplification, catalog number P525-02.

[0027] Table 1 IGF2BP2 exon2 amplification system

[0028]

[0029] The amplification conditions were as follows: amplification was performed using a PCR amplifier, with the first stage being pre-denaturation at 95°C for 2 min; the second stage being denaturation at 95°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 30 s, for 35 cycles; the third stage being final extension at 72°C for 5 min, and storage at 4°C.

[0030] 3. The amplified products were subjected to gel electrophoresis. The wild-type amplified product was 421 bp, while the mutant amplified product was 392 bp due to the deletion of 29 bp sequence. Figure 2 ).

[0031] 4. The amplified product was subjected to Sanger sequencing and compared with the reference gene sequence (SEQ ID No. 3). The comparison results showed that the missing base in this segment was TTAGGATTTTCCTCATGGACTATGATAAT (SEQ ID No. 4), indicating that the sheep had higher growth performance. ( Figure 3 )

[0032] Example 3 Application of InDel Molecular Markers

[0033] The genomes of 92 sheep (Hu sheep) were amplified using the same primers, conditions, and system as in Example 2. After sequencing the PCR products, 3 sheep were found to be heterozygous mutants harboring the SNP site, and 89 were found to be wild-type individuals (genotypes consistent with the reference genome). The birth weights and weights at different ages of all individuals were compared, and growth curves were drawn. It was found that heterozygous mutant individuals weighed more at the time of measurement than wild-type individuals at the same age ( Figure 4 ).

Claims

1. Application of InDel molecular markers in assisted breeding for growth traits in sheep. The InDel molecular marker sequence is TTAGGATTTTCCTCATGGACTATGATAAT, located at sites 202225118-202225146 on sheep chromosome 1, with reference to the genome version ARS-UI_Ramb_v2.

0. When the InDel molecular marker sequence is missing, sheep have relatively higher growth performance.

2. A specific primer pair for identifying sheep growth performance, characterized in that: The nucleotide sequences of the primer pair are shown in SEQ ID No. 1 and SEQ ID No.

2.

3. A kit comprising the specific primer pair according to claim 2.

4. Use of the specific primer pair according to claim 2 or the kit according to claim 3 in assisting the prediction of sheep growth performance.

5. The use according to claim 4, characterized in that The application method comprises the following steps: using the genomic DNA of the sheep to be tested as a template and performing PCR amplification using the primer pair shown in SEQ ID No. 1 and SEQ ID No. 2; if only an amplification product of 421 bp is obtained, the sheep to be tested is a wild type and has relatively low growth performance; if both amplification products of 421 bp and 392 bp are obtained, the sheep to be tested is a heterozygous mutant and has relatively high growth performance.

6. The use according to claim 5, characterized in that The nucleotide sequence of the 421 bp amplified product is shown in SEQ ID No. 3, and the nucleotide sequence of the 392 bp amplified product is shown in SEQ ID No. 4.

Images