Molecular markers associated with the fatty acid content in Yanhuang cattle muscle and their applications
By identifying the C>T mutation site at chromosome 20849921bp of the cattle reference genome GCF_002263795.3, a molecular marker associated with the content of erectile scalpers was developed, which solved the problem of insufficient muscle fatty acid content of existing erectile scalpers and achieved efficient screening of the muscle fatty acid content of erectile scalpers.
Patent Information
- Application Number
- CN202411349677.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-26
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2044-09-26
AI Technical Summary
The existing scalpers have insufficient muscle fatty acid content, making it difficult to effectively screen out individuals rich in high-quality fatty acids.
By identifying the C>T mutation site at chromosome 20849921bp of the bovine reference genome GCF_002263795.3, a molecular marker associated with the fatty acid content of scalpers was developed, and a primer set was designed for PCR amplification and genotyping screening.
The efficient screening of fatty acid content of scalpers muscles was achieved, especially the content of linoleic acid and arachidonic acid was significantly higher than that of other genotype individuals, providing technical support for molecular breeding.
Smart Images
Figure CN118932087B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the technical field of Yanhuang cattle breeding production, and specifically relates to molecular markers associated with the muscle fatty acid content of Yanhuang cattle and their applications. Background Art
[0002] Yanhuang cattle is a new beef cattle breed cultivated by introducing Limousin cattle blood on the basis of the Yanbian cattle breed. On the basis of maintaining the original flavor characteristics of the Yanbian cattle breed, the meat production capacity has been increased, meeting the dual demands of consumers in terms of quantity and quality. Selective breeding and improvement on the basis of the existing Yanhuang cattle breed to provide better quality beef products for society is the key point of the current Yanhuang cattle breeding work. Molecular breeding technology is one of the main technical means to accelerate the selective breeding and improvement of Yanhuang cattle, and the screening of gene markers is an indispensable part of molecular breeding work. Summary of the Invention
[0003] This application discloses a SNP locus at position 20849921bp on chromosome 20 of the bovine reference genome GCF_002263795.3 where C>T occurs. Different genotypes formed by this SNP locus are linked to the muscle fatty acid content of Yanhuang cattle. This molecular marker can be applied to the breeding of high-quality Yanhuang cattle rich in high-quality fatty acids, such as selecting high-quality Yanhuang cattle individuals with high linoleic acid and arachidonic acid content in their muscles for breeding. Therefore, the embodiments of this application disclose at least the following technical solutions:
[0004] In the first aspect, the embodiment discloses a molecular marker associated with the muscle fatty acid content of Yanhuang cattle, including a nucleotide sequence formed by a base C>T mutation at position 20849921bp on chromosome 20 (GenBank: CM008187.2, RefSeq: NC_037347.1) of the bovine reference genome GCF_002263795.3.
[0005] In the second aspect, the embodiment discloses a primer set. The primer set includes: DNA molecules shown in SEQ ID NO:1 and 2. SEQ ID NO:1 and 2 in the primer set are used to amplify a target fragment containing the molecular marker described in the first aspect.
[0006] In the third aspect, the embodiment discloses a nucleic acid, including a nucleotide sequence formed by a base C>T mutation at position 20849921bp on chromosome 20 of the Yanhuang cattle reference genome GCF_002263795.3.
[0007] In the fourth aspect, the embodiment discloses a kit. The kit includes the primer set described in the second aspect.
[0008] Fifth aspect, the embodiments disclose a method for screening excellent individuals of Yanhuang cattle with high muscle fatty acid content using molecular markers. The method includes: extracting genomic DNA from the muscle tissue of candidate Yanhuang cattle; performing PCR amplification on the genomic DNA using the primer set described in the second aspect; sequencing the PCR amplification product; determining the genotype of the Yanhuang cattle at position 20849921 bp on chromosome 20 of the reference genome GCF_002263795.3; and screening out Yanhuang cattle individuals containing the dominant genotype based on the genotype.
[0009] In some embodiments, the method further includes performing PCR amplification on the genomic DNA using the DNA molecules shown in SEQ ID NO: 1 and 2; the PCR reaction system is calculated based on 20 μL and includes: 1.0 μL of Yanhuang cattle genomic DNA template (<250 ng / 50 μL), 0.5 μL of the DNA molecule shown in SEQ ID NO: 1 at 0.5 μmol / L, 0.5 μL of the DNA molecule shown in SEQ ID NO: 2 at 0.5 μmol / L, 10 μL of 2×TaqMaster Mix and the balance of ddH 2 O.
[0010] In some embodiments, the fatty acid is selected from at least one of linoleic acid and arachidonic acid.
[0011] In some embodiments, the genotypes at position 20849921 bp on chromosome 20 of the Yanhuang cattle reference genome GCF_002263795.3 include CC, TT, and CT. The linoleic acid content of TT genotype individuals is extremely significantly higher than that of CC type and CT type individuals (P < 0.01). The arachidonic acid content of TT genotype individuals is significantly higher than that of CC type and CT type individuals (P < 0.05). The TT genotype is the dominant genotype related to the muscle fatty acid content of Yanhuang cattle and can be used for the screening of Yanhuang cattle.
[0012] Sixth aspect, the embodiments disclose the application of the molecular marker described in the first aspect, the primer set described in the second aspect, or the kit described in the third aspect in screening excellent individuals of Yanhuang cattle with high muscle fatty acid content. Description of the Drawings
[0013] Figure 1 It is an electrophoresis diagram for PCR amplification of the target sequence containing the Chr20:20849921C>T locus of Yanhuang cattle provided for the embodiments. M: DL2000 Marker; 1 - 3: PCR product amplification bands.
[0014] Figure 2Sequencing map of the PCR amplification product of the target sequence containing the Chr20:20849921C>T locus of Yanhuang cattle provided for the example. Detailed implementation manners
[0015] In order to make the objectives, technical solutions and advantages of the present application clearer, the present application will be further described in detail below in conjunction with embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application. The reagents not specifically described in detail in the present application are all conventional reagents and can be obtained from commercial channels; the methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.
[0016] Mining of molecular markers
[0017] 1. Experimental animals
[0018] 96 healthy Yanhuang cattle were uniformly raised by Yanbian Animal Husbandry Development Group Co., Ltd. until they were slaughtered at 30 months of age. Samples of the longissimus dorsi muscle tissue of the 12th to 13th ribs were collected into cryotubes, taken back to the laboratory in liquid nitrogen, and stored at -80°C for extracting tissue genomic DNA; another 7 cm long longissimus dorsi muscle of the 12th to 13th ribs of the cattle was sent to the Quality Supervision and Inspection and Testing Center for Agricultural Products and Processed Products (Changchun), Ministry of Agriculture and Rural Affairs for fatty acid content determination.
[0019] 2. Extraction of genomic DNA
[0020] The genomic DNA of the longissimus dorsi muscle tissue of Yanhuang cattle was extracted using an animal tissue DNA extraction kit. After dissolution with TE, the DNA purity and D260 nm / D280 nm value were measured with a ultra-micro spectrophotometer, and the integrity was detected by 1.5% agarose gel electrophoresis. The DNA meeting the quality requirements was stored at -80°C for standby.
[0021] 3. Design and synthesis of PCR primers
[0022] The sequence near 20849921 bp on chromosome 20 (GenBank: CM008187.2, RefSeq: NC_037347.1) of the bovine reference genome (GCF_002263795.3) published in the GenBank database was used as the target sequence (the fragment length is 774 bp (SEQ ID NO: 3 or SEQ ID NO: 4)), and primer pairs shown in SEQ ID NO: 1 (AGGAGAAGGTAAGAGTCAGAAGGATA) and SEQ ID NO: 2 (CAGGAGCCAGCAATGAAGAG) were designed and synthesized by Suzhou Genewiz Biotechnology Co., Ltd.
[0023] 4. PCR reaction system and amplification program
[0024] PCR reaction system (20 μL): 10 μL of 2× Taq Master Mix (1×), 0.5 μL each of forward and reverse primers (0.5 μmol / L), 1 μL of template DNA (<250 ng / 50 μL), 8 μL of ddH 2 O. PCR amplification program: pre-denaturation at 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 56.1°C for 30 s, extension at 72°C for 24 s, a total of 34 cycles, extension at 72°C for 5 min, and the product was stored at 4°C.
[0025] 5. Sequencing and genotyping of polymorphic sites of the PLK2 gene in Yanhuang cattle
[0026] Take 5 μL of the PCR product. After being detected as qualified by 1.5% agarose gel electrophoresis, the remaining PCR product was sent to Suzhou Genewiz Biotechnology Co., Ltd. for Sanger sequencing. The sequencing results were used to genotype the tested population using DNAMAN and Chromas software, and the genotype frequencies and allele frequencies were calculated.
[0027] 6. Data statistics and analysis
[0028] Using software for genetic analysis of domestic animals, analyze population genetic parameters including the number of effective alleles (Ne), expected heterozygosity (He), genetic homozygosity (Ho), and polymorphic information content (PIC). Perform one-way ANOVA and LSD multiple comparisons on the experimental data through SPSS 21.0 software to conduct a significance test for differences in meat quality traits among different genotypes of Yanhuang cattle, and find the correlations between different genotypes and meat quality traits and fatty acid contents. The results are expressed as "mean ± standard deviation", and P < 0.05 indicates significant differences, while P < 0.01 indicates extremely significant differences.
[0029] 7. PCR amplification results of the PLK2 gene in Yanhuang cattle
[0030] As Figure 1 can be seen, the electrophoresis bands of the PCR amplification products of the primers for the sixth exon of the PLK2 gene are clear and bright, without heterobands or trailing, indicating good primer characteristics, and the amplified fragment is consistent with the size of the target fragment, and can be used for direct sequencing.
[0031] 8. Sequence analysis
[0032] The sequencing results were aligned with the original sequences in DNAMAN and NCBI. One mutation site was detected in the sixth exon of the PLK2 gene in Yanhuang cattle: a C>T mutation at Chr20:20849921 bp. Three genotypes were found through Chromas software ( Figure 2 ).
[0033] 9. Analysis of population genetic parameters
[0034] Statistical analysis found that the dominant genotype of the PLK2 gene at the Chr20:20849921C>T locus was CC, and the dominant alleles were C and T, respectively. According to Table 1, the homozygosity (Ho) at this locus was higher than the heterozygosity (He); the effective number of alleles (Ne) was relatively large; the polymorphism information content (PIC) was 0.298, indicating moderate polymorphism (0.25 < PIC < 0.5).
[0035] Table 1 Statistical results of allele frequencies of Chr20:20849921C>T in Yanhuang cattle
[0036]
[0037] Table 2 Statistical results of population genetic parameters of the Chr20:20849921C>T gene in Yanhuang cattle
[0038] Homozygosity Ho Heterozygosity He Effective number of alleles Ne Polymorphism information content PIC 0.635 0.364 1.573 0.298
[0039] Note: PIC < 0.25 indicates low polymorphism; 0.25 < PIC < 0.5 indicates moderate polymorphism; PIC > 0.5 indicates high polymorphism
[0040] 10. Association analysis between different genotypes at the Chr20:20849921C>T locus in Yanhuang cattle and fatty acid content
[0041] As shown in Table 3, the linoleic acid content of individuals with the TT genotype was extremely significantly higher than that of CC and CT individuals (P < 0.01), and the arachidonic acid content of individuals with the TT genotype was significantly higher than that of CC and CT individuals (P < 0.05).
[0042] Table 3 Association analysis between Chr20:20849921C>T in Yanhuang cattle and fatty acid content in Yanhuang cattle
[0043]
[0044] Note: Different lowercase letters in the superscripts of the same row of data indicate significant differences (P < 0.05), and different capital letters indicate extremely significant differences (P < 0.01).
[0045] Application of molecular markers
[0046] Based on the above research, the primer group is disclosed in the embodiment. The primer group includes: the DNA molecules shown in SEQ ID NO:1 and 2. SEQ ID NO:1 and 2 in the primer group are used to amplify the target fragment containing the molecular marker described in the first aspect.
[0047] The embodiments also disclose a kit. The kit includes the primer set described above. Using the primer set to perform PCR amplification on the genomic DNA of Yanhuang cattle, the genotype at position 20849921 bp on chromosome 20 can be determined based on the PCR amplification product, and then Yanhuang cattle individuals containing the dominant genotype can be screened according to the genotype. In some embodiments, the length of the amplification product is 774 bp, and the base C>T mutation at position 20849921 bp on chromosome 20 of GCF_002263795.3 is located at 518 bp of the amplification product with a length of 774 bp.
[0048] In other words, the embodiments disclose a method for screening excellent individuals of Yanhuang cattle with high muscle fatty acid content using molecular markers. The method includes: extracting genomic DNA from the muscle tissue of the candidate Yanhuang cattle; performing PCR amplification on the genomic DNA using the primer set described in the second aspect; sequencing the product of the PCR amplification; determining the genotype of the Yanhuang cattle at position 20849921 bp on chromosome 20 of the reference genome GCF_002263795.3 according to the sequencing result; and screening out Yanhuang cattle individuals containing the dominant genotype according to the genotype.
[0049] In some embodiments, the method further includes performing PCR amplification on the genomic DNA using the DNA molecules shown in SEQ ID NO: 1 and 2; the PCR reaction system is calculated as 20 μL and includes: 1.0 μL of Yanhuang cattle genomic DNA template (<250 ng / 50 μL), 0.5 μL of the DNA molecule shown in SEQ ID NO: 1 at 0.5 μmol / L, 0.5 μL of the DNA molecule shown in SEQ ID NO: 2 at 0.5 μmol / L, 10 μL of 2×TaqMaster Mix and the balance of ddH 2 O.
[0050] In some embodiments, the fatty acids are linoleic acid and arachidonic acid.
[0051] In some embodiments, the genotypes at position 20849921 bp on chromosome 20 of the Yanhuang cattle reference genome GCF_002263795.3 include CC, TT, and CT. The linoleic acid content of TT genotype individuals is extremely significantly higher than that of CC and CT genotype individuals (P<0.01). The arachidonic acid content of TT genotype individuals is significantly higher than that of CC and CT genotype individuals (P<0.05). The TT genotype is the dominant genotype for the muscle fatty acid content of Yanhuang cattle and can be used for the screening of Yanhuang cattle.
[0052] The embodiments disclose the application of the molecular marker described in the first aspect, the primer set described in the second aspect, or the kit described in the third aspect in screening excellent individuals of Yanhuang cattle with high muscle fatty acid content.
[0053] The quality of beef mainly includes the color, tenderness, flavor, and taste of the meat. The indicators affecting the quality of beef mainly include physical indicators and chemical indicators. The composition and content of fatty acids are important indicators for evaluating the quality and nutritional value of meat. The fatty acid composition in beef is closely related to its eating quality. Fatty acids can be divided into saturated fatty acids and unsaturated fatty acids, and different fatty acids have different effects on the composition of meat flavor. This application found that there are differences in the composition of some fatty acids among individuals with different genotypes, mainly including linoleic acid and arachidonic acid. Linoleic acid and arachidonic acid belong to polyunsaturated fatty acids. They will be decomposed into volatile carbonyl compounds such as ketones, aldehydes, and acids through high-temperature oxidation, which are important components of the volatile flavor substances in meat, and can produce different odors through oxidative degradation, thereby affecting the meat flavor.
[0054] This application takes the Yanhuang cattle population as the research object and found that the contents of linoleic acid and arachidonic acid in TT genotype individuals at 20849921bp on chromosome 20 of the reference genome GCF_002263795.3 are significantly higher than those of other genotype individuals. Therefore, the molecular marker provided by this application is beneficial to screening individuals with higher contents of linoleic acid and arachidonic acid in Yanhuang cattle, providing technical support for the molecular breeding of Yanhuang cattle, and being applied to the molecular-assisted selection breeding of Yanhuang cattle strains with high contents of linoleic acid and arachidonic acid in muscle.
[0055] As mentioned above, it is only the preferred specific implementation manner of this application, but the protection scope of this application is not limited thereto. Any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by this application should be covered within the protection scope of this application.
Claims
1. A method for screening high-quality individuals with high muscle fatty acid content in Yanhuang cattle using molecular markers, wherein the molecular marker is a nucleotide sequence formed by a base C>T mutation at 20849921bp of chromosome 20 of the Yanhuang cattle reference genome GCF_002263795.3, and the fatty acid is selected from at least one of linoleic acid and arachidonic acid, including: Extracting genomic DNA from muscle tissue of Yanhuang cattle to be selected; The genomic DNA is amplified by PCR using the DNA molecules shown in SEQ ID NOs: 1 and 2, wherein the PCR reaction system includes 1.0 μL of Yanhuang cattle genomic DNA template with <250 ng / 50 μL, 0.5 μL and 0.5 μmol / L of the DNA molecule shown in SEQ ID NO: 1, 0.5 μL and 0.5 μmol / L of the DNA molecule shown in SEQ ID NO: 2, 10 μL of 2×TaqMaster Mix and the balance of ddH2O in 20 μL; Sequencing the product amplified by the PCR; According to the sequencing results, the genotype of the Yanhuang cattle at 20849921bp of chromosome 20 of the reference genome GCF_002263795.3 is determined; According to the genotype, excellent individuals with high muscle fatty acid content of the Yanhuang cattle were screened out. The genotypes at 20849921bp of chromosome 20 of the Yanhuang cattle reference genome GCF_002263795.3 included CC, TT and CT. The linoleic acid content of the TT genotype individual was significantly higher than that of the CC genotype individual and the CT genotype individual, and the arachidonic acid content of the TT genotype individual was significantly higher than that of the CC genotype individual and the CT genotype individual.
2. Use of a primer set in screening high-quality individuals with high muscle fatty acid content in Yanhuang cattle, the primer set being a DNA molecule as shown in SEQ ID NO: 1 and 2, the fatty acid being selected from at least one of linoleic acid and arachidonic acid, and the screening steps being: Performing PCR amplification using the primer set; The PCR amplification product was sequenced to obtain the genotype at 20849921 bp of chromosome 20 of the Yanhuang cattle reference genome GCF_002263795.3, and the genotype at 20849921 bp of chromosome 20 of the Yanhuang cattle reference genome GCF_002263795.3 included CC, TT and CT; The linoleic acid content of individuals with TT genotype is extremely significantly higher than that of individuals with CC type and CT type, and the arachidonic acid content of individuals with TT genotype is significantly higher than that of individuals with CC type and CT type. The TT genotype is screened as a dominant genotype related to the fatty acid content in the muscle of Yanhuang cattle.