Avian pcv2 gene and application thereof
By providing the avian PCV2 gene and the MDCC-MSB1 cell line, the problems of efficient isolation and stable passage of PCV2 were solved. The prepared vaccines and detection methods significantly improved the protective effect and detection accuracy of poultry.
Patent Information
- Application Number
- CN202411172833.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-23
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2044-08-23
AI Technical Summary
In existing technologies, it is difficult to achieve efficient in vitro isolation and passage of PCV2, resulting in low and unstable isolation rates. There is a lack of mature vaccines, making it difficult to effectively control porcine circovirus-related diseases.
This study provides avian PCV2 genes and their applications, including the preparation of ELISA detection plates, inactivated vaccines, and subunit vaccines. It utilizes the MDCC-MSB1 cell line for efficient isolation and culture of PCV2, collects the virus by injecting viral fluid into the allantoic cavity of 8-11 day old avian embryos, and prepares inactivated and subunit vaccines using viral strains containing the aPCV2 gene.
The system achieved efficient isolation and stable passage of PCV2. The inactivated and subunit vaccines prepared have significant protective effects on poultry such as chickens, ducks, and geese. The ELISA detection plate has high specificity and reproducibility. The isolation method is easy to use, has a high isolation rate, and is stable.
Smart Images

Figure CN118956905B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of animal virology and immunology, and particularly relates to an avian PCV2 gene and its application. Background Technology
[0002] Porcine circovirus (PCV) is a small, non-enveloped virus with a single-stranded circular DNA genome, belonging to the genus *Circovirus* of the family Circoviridae. To date, at least four types of porcine circovirus (PCV) have been identified, including PCV1 through PCV4. PCV2 was first discovered in Canada in the early 1990s, and the disease it causes was subsequently named porcine circovirus-associated disease (PCVAD) in North America. PCVAD is characterized by a variety of symptoms, including post-weaning multisystemic wasting syndrome (PMWS), porcine dermatitis and nephropathy syndrome (PDNS), reproductive disorders, enteritis, and respiratory diseases. In addition, subclinical PCV2 infection in pigs suppresses the immune system, making them more susceptible to infection by other viruses, and co-infections result in more severe clinical symptoms (Afghah et al., 2017; Opriessnig et al., 2007; Saha et al., 2011). PCV2 is currently classified into six major genotypes (PCV2a, PCV2b, PCV2c, PCV2d, PCV2e, and PCV2f), with PCV2b and PCV2d being the main strains in China. The complete genome of PCV2 is 1766 or 1768 bp in length, encoding at least 11 predicted open reading frames (ORFs).
[0003] To date, PCV2 has been found to infect many hosts, including pigs, wild boars, mice, calves, mink, dogs, foxes, and goats, with pigs being its natural host. There are currently no reports of PCV2 infecting poultry. Rapid and efficient isolation of the pathogen is crucial for diagnosis and disease control in viral infectious diseases. Cells capable of continuously proliferating the virus are among the most important tools for viral diagnosis and subsequent research. Previously, Zhu et al. (2007) reported that PK-15 cell populations are heterogeneous in terms of PCV2 infection permissibility, with only about 20% of the cell population susceptible (Tischer et al., 1987), and viral titers never exceeding 10. 5 TCID50 titer (Meerts et al., 2005). Currently, efficient in vitro isolation and passage of PCV2 remains challenging, characterized by difficulties in isolation, low isolation rates, and unstable isolation rates. Furthermore, there is currently no mature PCV2 vaccine. Summary of the Invention
[0004] In view of this, the purpose of the present invention is to provide an avian PCV2 (aPCV2) gene and its application in the preparation of PCV2 vaccines.
[0005] Another object of the present invention is to provide an ELISA test strip for detecting PCV2, an inactivated vaccine, and a subunit vaccine.
[0006] Another objective of this invention is to provide a method for efficiently isolating avian or porcine PCV2 and the application of the MDCC-MSB1 cell line in the isolation and culture of PCV2.
[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0008] The present invention provides an aPCV2 gene, wherein the nucleotide sequence of the aPCV2 gene includes any one of the following: (1) SEQ ID NO.1, (2) SEQ ID NO.2, (3) a sequence having more than 90% homology with SEQ ID NO.1, and (4) a sequence having more than 90% homology with SEQ ID NO.2.
[0009] This invention also provides the application of the above-mentioned aPCV2 gene in the preparation of PCV2 vaccines.
[0010] The present invention also provides an expression vector containing either the Cap gene or the Rep gene from the aPCV2 gene described above, wherein the nucleotide sequence of the Cap gene includes SEQ ID NO.3 or SEQ ID NO.4, and the nucleotide sequence of the Rep gene includes SEQ ID NO.5 or SEQ ID NO.6.
[0011] The present invention also provides a host cell containing the above-described expression vector.
[0012] The present invention also provides a recombinant protein, which is obtained by inducing the above-mentioned host cells to express and purify the protein.
[0013] The present invention also provides the use of the above-mentioned expression vector, the above-mentioned host cell or the above-mentioned recombinant protein in the preparation of products for detecting PCV2 or in the preparation of PCV2 vaccines.
[0014] The present invention also provides an ELISA detection plate for detecting PCV2, wherein the ELISA detection plate is coated with the above-mentioned recombinant protein, and the coating concentration of the recombinant protein is 1.0 μg / ml-2.0 μg / ml.
[0015] The present invention also provides an inactivated vaccine comprising a viral strain containing the above-mentioned aPCV2 gene.
[0016] The present invention also provides a subunit vaccine comprising the above-described recombinant protein and adjuvant.
[0017] This invention also provides a method for efficiently isolating PCV2, comprising the following steps: injecting PCV2 virus fluid into the allantoic cavity of 8-11 day old poultry embryos, incubating, collecting allantoic fluid to obtain PCV2 virus, wherein the PCV2 virus fluid includes poultry PCV2 virus fluid or porcine PCV2 virus fluid, and the poultry PCV2 virus fluid is a virus fluid containing the above-mentioned aPCV2 gene.
[0018] This invention also provides the application of the MDCC-MSB1 cell line in the isolation and culture of porcine PCV2 or avian PCV2, wherein the avian PCV2 is a viral strain containing the aforementioned aPCV2 gene.
[0019] The beneficial effects of this invention are:
[0020] This invention provides, for the first time, an aPCV2 gene. Viral strains containing the aPCV2 gene exhibit high viral titers and can be stably passaged multiple times. Inactivated vaccines prepared using viral strains containing the aPCV2 gene of this invention have significant protective effects on poultry such as chickens, ducks, and geese. Subunit vaccines prepared using the Cap or Rep genes from the aPCV2 gene of this invention also have significant protective effects on poultry such as chickens, ducks, and geese. ELISA detection plates prepared using the Rep or Cap genes from the aPCV2 gene of this invention can accurately detect PCV2 with high specificity and reproducibility.
[0021] The method for isolating PCV2 provided by this invention can efficiently isolate porcine PCV2 and aPCV2 in vitro, with advantages such as low isolation difficulty, high isolation rate, and stable isolation rate. Furthermore, this invention is the first to propose that the MDCC-MSB1 cell line can be used for the isolation and culture of PCV2, with the advantage of stable passage. Attached Figure Description
[0022] Figure 1 This is an agarose gel electrophoresis image of PCV2 Cap detection in avian clinical samples. In the image, M represents a 2000bp DNA Marker, 1 and 2 represent chicken kidney tissue samples, 3 and 4 represent chicken serum samples, 5 and 6 represent duck kidney tissue samples, and 7 and 8 represent chicken serum samples. "─" represents a negative control, and "+" represents a PCV2 positive control.
[0023] Figure 2 A diagram illustrating the genetic evolution of avian PCV2 in relation to other species' porcine circoviruses;
[0024] Figure 3The image shows the complete genome of the aPCV2 isolate aPCV2-duck-GDYF1. The yellow part represents the ORF1 gene sequence, and the green part represents the ORF2 gene sequence.
[0025] Figure 4 The image shows the complete genome of the aPCV2 isolate aPCV2-chicken-GDQY2. The yellow part represents the ORF1 gene sequence, and the green part represents the ORF2 gene sequence.
[0026] Figure 5 The image shows a comparison of the amino acid sequences of ORF1 and ORF2 of the five isolated aPCV2 isolates, where A represents the Rep gene and B represents the Cap gene.
[0027] Figure 6 Homology analysis diagram of the five isolated aPCV2 isolates;
[0028] Figure 7 Agarose gel electrophoresis images of aPCV2-duck-GDYF1 strain isolated from MDCC-MSB1 cells at passages F2-F15 for aPCV2 Cap detection;
[0029] Figure 8 Agarose gel electrophoresis image of aPCV2-chicken-GDQY2 strain isolated from MDCC-MSB1 cells at passages F2-F15;
[0030] Figure 9 The results are from transmission electron microscopy (TEM), where Figure A shows the results for aPCV2-duck-GDYF1 and Figure B shows the results for aPCV2-chicken-GDQY2.
[0031] Figure 10 The figures show antibody levels after immunization with inactivated aPCV2. The left figure shows the results of the aPCV2-chicken-GDQY2 inactivated vaccine, and the right figure shows the results of the aPCV2-duck-GDYF1 inactivated vaccine.
[0032] Figure 11 The figures show the aPCV2 virus copy number in different tissues after chicken immunization with inactivated vaccines. The left figure shows the results of aPCV2-chicken-GDQY2 inactivated vaccine (denoted as GDQY2 strain inactivated vaccine), and the right figure shows the results of aPCV2-duck-GDYF1 inactivated vaccine (denoted as GDYF1 strain inactivated vaccine). *** represents extremely significant differences.
[0033] Figure 12 This is a PCR amplification image of aPCV2-duck-GDYF1 Cap, where the left band is a 2000bp DNA marker;
[0034] Figure 13 This is a PCR amplification diagram of aPCV2-duck-GDYF1 Rep, where the left band is a 2000bp DNA marker;
[0035] Figure 14 The results show the purification of YF-aPCV2 Cap recombinant protein, where M is the 8-180 protein marker, 1 is the direct current sample, 2 is the 20 mmol imidazole elution, 3 is the 50 mmol imidazole elution, 4 is the 100 mmol imidazole elution, 5 is the 200 mmol imidazole elution, 6 is the 300 mmol imidazole elution, and 7 is the 500 mmol imidazole elution.
[0036] Figure 15 The results of purification of YF-aPCV2 Rep recombinant protein are shown. M is protein marker 8-180, 1 is direct current sample, 2 is elution with 20 mmol imidazole, 3 is elution with 50 mmol imidazole, 4 is elution with 100 mmol imidazole, 5 is elution with 200 mmol imidazole, 6 is elution with 300 mmol imidazole, and 7 is elution with 500 mmol imidazole.
[0037] Figure 16 The results of Western blot identification of YF-aPCV2 Cap recombinant protein are shown, where M is protein marker 8-180, 1 is elution with 20 mmol imidazole, 2 is elution with 50 mmol imidazole, 3 is elution with 100 mmol imidazole, 4 is elution with 200 mmol imidazole, 5 is elution with 300 mmol imidazole, and 6 is elution with 500 mmol imidazole.
[0038] Figure 17 The results of Western blot identification of YF-aPCV2 Rep recombinant protein are shown, where M is protein marker 8-180, 1 is elution with 20 mmol imidazole, 2 is elution with 50 mmol imidazole, 3 is elution with 100 mmol imidazole, 4 is elution with 200 mmol imidazole, 5 is elution with 300 mmol imidazole, and 6 is elution with 500 mmol imidazole.
[0039] Figure 18 Antibody levels after immunization against aPCV2 Cap protein;
[0040] Figure 19 Antibody levels after immunization against aPCV2 Rep protein;
[0041] Figure 20 The results of PCV2 viral copy number in different tissues after immunization with aPCV2 Cap are shown. **** indicates extremely significant differences.
[0042] Figure 21The results show the PCV2 viral copy number in different tissues after immunization with aPCV2 Rep. **** indicates extremely significant differences.
[0043] Figure 22 The image shows the effect of Western blotting to verify aPCV2 infection of MDCC-MSB1 cells;
[0044] Figure 23 The image shows the effect of aPCV2 infection of MDCC-MSB1 cells for IFA validation;
[0045] Figure 24 The value represents the PCV2 viral copy number in the allantoic fluid; **** indicates a highly significant difference. Detailed Implementation
[0046] The present invention provides an avian PCV2 (aPCV2) gene, wherein the nucleotide sequence of the aPCV2 gene includes any one of the following: (1) SEQ ID NO.1, (2) SEQ ID NO.2, (3) a sequence with more than 90% homology to SEQ ID NO.1, and (4) a sequence with more than 90% homology to SEQ ID NO.2.
[0047] This invention is the first to propose that PCV2 can infect poultry, and to isolate an avian aPCV2 strain from poultry, which was identified as the PCV2b strain. Inactivated vaccines prepared using viral strains containing the aPCV2 gene of this invention, as well as subunit vaccines prepared using the Cap or Rep genes from the aPCV2 gene of this invention, both provide protection against poultry such as chickens, ducks, and geese. ELISA detection plates prepared using the Cap and Rep genes from the aPCV2 gene of this invention can accurately detect serum antibody levels in poultry, exhibiting high specificity and reproducibility.
[0048] In this invention, the poultry source includes chicken and duck. Five viral strains were isolated from kidney tissue and serum samples from chicken and duck sources. These strains showed high similarity in their nucleotide sequences. The nucleotide sequence of the aPCV2-duck-GDYF1 strain is shown in SEQ ID NO.1, and the nucleotide sequence of the aPCV2-chicken-GDQY2 strain is shown in SEQ ID NO.2. The nucleotide sequences of the remaining three strains showed high homology to SEQ ID NO.1 or SEQ ID NO.2, respectively.
[0049] This invention also provides the application of the aforementioned aPCV2 gene in the preparation of PCV2 vaccines. In this invention, the types of vaccines include inactivated vaccines and subunit vaccines.
[0050] The present invention also provides an expression vector containing either the Cap gene or the Rep gene from the aPCV2 gene described above, wherein the nucleotide sequence of the Cap gene includes SEQ ID NO.3 or SEQ ID NO.4, and the nucleotide sequence of the Rep gene includes SEQ ID NO.5 or SEQ ID NO.6.
[0051] In this invention, the nucleotide sequence of the Cap gene in the aPCV2-duck-GDYF1 strain (as shown in SEQ ID NO.1) is as shown in SEQ ID NO.3; the nucleotide sequence of the Rep gene in the aPCV2-duck-GDYF1 strain (as shown in SEQ ID NO.1) is as shown in SEQ ID NO.5; the nucleotide sequence of the Cap gene in the aPCV2-chicken-GDQY2 strain (as shown in SEQ ID NO.2) is as shown in SEQ ID NO.4; and the nucleotide sequence of the Rep gene in the aPCV2-chicken-GDQY2 strain (as shown in SEQ ID NO.2) is as shown in SEQ ID NO.6. In this invention, the vector preferably includes the prokaryotic expression vector pET-28a.
[0052] The present invention also provides a host cell containing the above-described expression vector. In the present invention, the host cell preferably comprises *Escherichia coli* DH5α and *Escherichia coli* BL21(DE3).
[0053] The present invention also provides a recombinant protein, which is obtained by inducing the above-mentioned host cells to express and purify the protein.
[0054] This invention also provides the use of the above-described expression vector, host cell, or recombinant protein in the preparation of products for detecting PCV2 or in the preparation of PCV2 vaccines. In this invention, the products for detecting PCV2 preferably include ELISA kits.
[0055] This invention also provides an ELISA plate for detecting PCV2, wherein the ELISA plate is coated with the aforementioned recombinant protein at a concentration of 1 μg / ml to 2.0 μg / ml. In this invention, the preferred method for preparing the ELISA plate includes the following steps: diluting PCV2 cap protein or PCV2 Rep protein to a concentration of 1 μg / ml to 2.0 μg / ml with phosphate buffer, then adding 100 μL / well to the plate, followed by incubation, washing, patting dry, blocking, washing again, and drying.
[0056] The present invention also provides an inactivated vaccine comprising a viral strain containing the aforementioned aPCV2 gene. The inactivated vaccine is obtained by inactivating a viral strain containing the aforementioned aPCV2 gene; in the present invention, the inactivation is preferably performed using diethyleneimine (BEI).
[0057] The present invention also provides a subunit vaccine comprising the above-described recombinant protein and an adjuvant. In the present invention, the adjuvant preferably comprises Freund's adjuvant, and in the subunit vaccine of the present invention, the concentration of the recombinant protein is preferably 0.3 mg / mL to 0.35 mg / mL.
[0058] This invention also provides a method for efficiently isolating PCV2, comprising the following steps: injecting PCV2 virus fluid into the allantoic cavity of 8-11 day old poultry embryos, incubating, collecting allantoic fluid to obtain PCV2 virus, wherein the PCV2 virus fluid includes poultry aPCV2 virus fluid or porcine PCV2 virus fluid, wherein the poultry aPCV2 virus fluid is a virus fluid containing the above-mentioned aPCV2 gene.
[0059] In this invention, the poultry embryo preferably includes a chicken embryo or a duck embryo, the incubation temperature is preferably 37°C, and the incubation time is preferably 72 hours.
[0060] This invention also provides the application of the MDCC-MSB1 cell line in the isolation and culture of porcine PCV2 or avian aPCV2, wherein the avian aPCV2 is a viral strain containing the aforementioned aPCV2 gene.
[0061] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.
[0062] Unless otherwise specified, the following embodiments are all conventional methods.
[0063] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.
[0064] Example 1
[0065] Isolation and identification of porcine circovirus type 2 (aPCV2) from avian origin
[0066] 1.1a PCV2 detection
[0067] PCR amplification detection
[0068] Total viral nucleic acid was extracted from chicken and duck kidney tissues and serum samples that were positive for porcine circovirus type 2 (PCV2). The extraction procedure was strictly performed according to the instructions of the Total Viral DNA / RNA Extraction Kit from Meiji Biotechnology Co., Ltd. The extracted total nucleic acid was amplified by PCR using the primers shown in Table 1. The PCR amplification reaction system is shown in Table 2, and the PCR amplification reaction procedure is shown in Table 3.
[0069] Table 1 Primer sequences
[0070] Primer name Primer sequence (5'-3') Genbank serial number aPCV2CapF ATGGTTTTATTATTCATTAAGGGTTAAGTGGGGG(SEQ ID NO.7) MG732815.1 aPCV2CapR TCAGATATGACGTATCCAAGGAGG(SEQ ID NO.8) MG732815.1 aPCV2RepF AGCAACATGCCCAGCAAAAAGAAT(SEQ ID NO.9) MG732815.1 aPCV2RepR AAAAAGACTCAGTAATTTATTTCATATGGAAATTCAGGGCATG(SEQ ID NO.10) MG732815.1 aPCV2F TCGTAATGGTTTTTTATTCATTAAGGGTTAAGTGGGG(SEQ ID NO.11) MG732815.1 aPCV2R AGTGATAAAAAAGACTCAGTAATTTATTTCATATGG(SEQ ID NO.12) MG732815.1 aPCV2Q1F GTAGAAGCTCTTTATCGGAGG(SEQ ID NO.13) MG732815.1 aPCV2Q1R AACTACTCCTCCCGCCATACCATA(SEQ ID NO.14) MG732815.1 aPCV2Q2F TTTGACTGTGGTTCGCTTGATAGTATATCC(SEQ ID NO.15) MG732815.1 aPCV2Q2R AGGAGCTCCACATTCCATCAGTAAGTT(SEQ ID NO.16) MG732815.1 aPCV2Q3F ACACCCCACCTCCAGGGGTTTCGCTAATTTT(SEQ ID NO.17) MG732815.1 aPCV2Q3R AACAGTATATACGACCAGGAATACAATATC(SEQ ID NO.18) MG732815.1 aPCV2Q4F ATCTAGGACAGGTTTGGGGGTAAAAGTA(SEQ ID NO.19) MG732815.1 aPCV2Q4R AGCCATCTTGGCCAGATCCTC(SEQ ID NO.20) MG732815.1
[0071] Table 2. Reaction system for PCR amplification
[0072] Components Volume (μL) 2×TaqMasterMix 12.5 Forwardprimer 1 RorwardPrimer 1 Total nucleic acid 2 <![CDATA[ddH2O]]> Make up to 20
[0073] Table 3 PCR amplification reaction procedure
[0074] step temperature time Cycle number Pre-variation 95℃ 5min 1 transsexual 95℃ 30s 35 annealing 58℃ 30s 35 extend 72℃ 60s 35 Final extension 72℃ 5min 1 save 4℃ ∞ 1
[0075] After PCR, the PCR amplification products were detected by 1% agarose gel electrophoresis. DEPC water was used as a negative control, and pCDNA3.1-PCV2 plasmid was used as a PCV2 positive control. The results are as follows: Figure 1 As shown, all samples tested positive for specific bands. This indicates the presence of aPCV2 virus in the avian tissue.
[0076] The complete genome of aPCV2 was amplified using the designed primers, and five strains were obtained from the collected pathogen samples. To determine the genetic distance between the PCV2 strains detected in chicken and duck and other species of porcine circoviruses, phylogenetic analysis was performed on the five isolated PCV2 strains. The results showed that the genetic distance between chicken and duck PCV2 and porcine PCV2 was relatively close, belonging to the same branch, specifically the PCV2b branch. Figure 2 As shown. The sequence of the aPCV2-duck-GDYF1 mutant is as follows: Figure 3 As shown, the complete genome sequence of the aPCV2-chicken-GDQY2 strain is as follows: Figure 4 As shown. Then, amino acid alignment was performed on the avian PCV2 ORF1 and ORF2 genes and the porcine PCV2 ORF1 and ORF2 genes in MegAlign. The results of the amino acid alignment are shown in [Figure showing the alignment results]. Figure 5 Then, base homology analysis was performed on avian PCV2 and porcine PCV2 in MegAlign, and the results are shown below. Figure 6 The homology was found to be over 94%, and the highest homology was found with the PCV2b branch strain.
[0077] 1.2 Culture of MDCC-MSB1 cells and isolation of aPCV2
[0078] (1) Cell thawing: The constant temperature water bath was set to 37°C in advance. After the water temperature reached 37°C, the frozen MDCC-MSB1 cells were taken out from the liquid nitrogen tank and thawed by shaking them quickly from side to side in the 37°C water bath. Then, the cryovial was disinfected with 75% medical alcohol. After centrifugation at 800r / min for 5min, the cryopreservation solution was discarded. 1mL of thawed 1640 cell culture medium was added and gently pipetted to mix. Then, the cells were transferred to a T25 cell culture flask and cultured in a constant temperature incubator at 39°C and 5% CO2 for 8h. After that, the cells were transferred to a conical cell culture flask and cultured in suspension at 39°C, 5% CO2, and 100r / min.
[0079] (2) Isolation of aPCV2-duck-GDYF1 and aPCV2-chicken-GDQY2 strains: Positive chicken and duck samples detected by PCR were minced with sterilized scissors, then mixed with autoclaved and chilled PBS, ground on ice, centrifuged at 10000 r / min for 5 min, and the supernatant was transferred to another 5 mL centrifuge tube. The tube was then filtered first through a 0.45 μm filter and then through a 0.22 μm filter in a sterile laminar flow hood, and stored at -80℃ for later use. When the number of MDCC-MSB1 cells reached 2 × 10⁻⁶ cells... 6 Afterwards, the cells were collected by centrifugation at 800 rpm for 5 min. The tissue filtrate was then diluted 10% by volume using sterile 1640 cell culture medium and added to the cell pellet. The cells were gently resuspended and incubated at 39°C in a 5% CO2 incubator for 2 h. The cells were collected by centrifugation at 800 rpm for 5 min, 5 ml of fresh 1640 culture medium was added, followed by 300 mM D-glucosamine. The cells were cultured for another 72 h and then stored at -80°C. This process was repeated blindly until the 15th passage.
[0080] (3) PCR amplification and identification
[0081] The aPCV2-duck-GDYF1 and aPCV2-chicken-GDQY2 viral solutions obtained in step (2) were passaged for 15 generations in MDCC-MSB1 cells. During this process, 200 μL of cell cultures from the 2nd, 5th, 10th, and 15th generations were taken for total viral nucleic acid extraction. The extracted total nucleic acid was then subjected to PCR amplification (total nucleic acid extraction and reaction system and procedure were the same as in step 1.1). The Cap gene was amplified using primers aPCV2Cap F1: ATTATTCATTAAGGGTTAAGTGGGGGGTCTTT (SEQ ID NO. 21) and aPCV2 Cap R1: TCAGATATGACGTATCCAAGGAGGCGT (SEQ ID NO. 22). The results are as follows. Figure 7 , Figure 8 As shown, from the 2nd to the 15th generation, specific positive bands were detected in cell culture samples of the isolated strains described in this invention. This demonstrates that the isolated strains aPCV2-duck-GDYF1 and aPCV2-chicken-GDQY2 of this invention can be continuously passaged in MDCC-MSB1. Sequencing of the PCR amplification products showed that the Cap gene sequence of the aPCV2-duck-GDYF1 isolate is shown in SEQ ID NO.3, and the Cap gene sequence of the aPCV2-chicken-GDQY2 isolate is shown in SEQ ID NO.4.
[0082] (4) Electron microscopy observation
[0083] Take aPCV2-duck-GDYF1 and aPCV2-chicken-GDQY2 viral solutions, centrifuge at 10000 rpm for 30 minutes, collect the supernatant, centrifuge at 40000 rpm for 5 hours, discard the supernatant, dissolve the precipitate in 0.5 mL of deionized water, and then send the samples to the South China Agricultural University Testing Center for sample preparation. Then, observe the results using transmission electron microscopy. Figure 9 As shown in the results, there are a large number of virus particles in the sample, with a diameter of about 16-18 nm and uniform particle size.
[0084] (5) Virus titer determination
[0085] Take the 5th, 10th, and 15th generation viral solutions of aPCV2-duck-GDYF1 and aPCV2-chicken-GDQY2 and dilute them 10-fold to obtain 10. -1 ~10 -8Virus was inoculated into PK-15 monolayer cells cultured in 96-well plates, with 8 wells per dilution. 0.1 mL of virus diluent was added to each well. The plates were incubated at 37°C in a 5% CO2 incubator. IFA analysis was performed after 96 hours, and the TCID of the virus was calculated using the Reed-Muench method. 50 The test results showed that the viral titers of aPCV2-duck-GDYF1 at generations 5, 10, and 15 were 10. 4.5 TCID 50 / mL, 10 7 TCID 50 / mL, 10 7 TCID 50 / mL, the viral titers of aPCV2-chicken-GDQY2 at passages 5, 10, and 15 were 10. 5 TCID 50 / mL, 10 7.5 TCID 50 / mL, 10 7 TCID 50 / mL.
[0086] Example 2
[0087] Preparation of inactivated vaccines of porcine circovirus type 2 (aPCV2-duck-GDYF1 and aPCV2-chicken-GDQY2 strains)
[0088] 2.1 Preparation of PCV2 seed virus: The preparation method is the same as 1.2 in Example 1.
[0089] 2.2a Preparation of PCV2 inactivated vaccine viral solution:
[0090] (1) Cell thawing: Preheat the constant temperature water bath to 37°C. After the water temperature reaches 37°C, take out the required MDCC-MSB1 cells from the liquid nitrogen tank and thaw them by quickly shaking them left and right in the 37°C water bath. Then disinfect the outside of the cryovial with 75% medical alcohol, centrifuge at 800r / min for 5min, discard the cryopreservation solution, add 1mL of thawed 1640 cell culture medium, gently pipette to mix, and then transfer to a T25 cell culture flask. Incubate at 39°C and 5% CO2 for 8h. Then transfer to a conical cell culture flask and incubate at 39°C, 5% CO2, and 100r / min.
[0091] (2) Cell expansion culture
[0092] Cells were cultured for 72 hours, and the cell density was 5.0 × 10⁻⁶. 6 Cells / ml, prepared with 1640 medium at a density of 1×10⁻⁶. 6Cell suspensions of 100 cells / ml are dispensed into cell shake flasks and cultured in a 39°C, 5% CO2 incubator. After 72 hours, the cells can be passaged at a ratio of 1:3 to 1:4 (equivalent to expanding 100ml of cell suspension to a 400-500ml culture system).
[0093] (3) Virus inoculation
[0094] When the cell density is 5.0 × 10⁻⁶ 6 When the cell density is 100 cells / ml, centrifuge at 800 rpm for 5 minutes, then resuspend the cells in fresh culture medium, transfer the cell suspension to a cell shaker, add four times (40 ml) of culture medium, and simultaneously inoculate with 10% of the culture medium volume of the virus stock solution. After culturing for 72 hours, the virus can be obtained.
[0095] 2.3 Purity Test of PCV2 Inactivated Vaccine Fluid
[0096] According to the current appendix of the Chinese Veterinary Pharmacopoeia, the test results showed that the basic strain was free from bacterial, mycoplasma and exogenous viral contamination.
[0097] 2.4 Inactivation of PCV2 inactivated vaccine virus solution
[0098] (1) Preparation of diethyleneimine (BEI)
[0099] Mix equal volumes of 2 mol / L 2-bromoethylamine hydrobromide (BEA) and 2 mol / L NaOH solution, place in a 37°C water bath, and shake well every 10-15 minutes. After 60 minutes, cyclization will produce diethyleneimine (BEI), with a final concentration of 1 mol / L.
[0100] (2) Virus inactivation
[0101] Take the porcine circovirus type 2 antigen solution after cell disruption, add BEI prepared in step (1) to a concentration of 2 mmol / L, then add formaldehyde at a volume ratio of 0.8‰, place in a constant temperature shaker at 37℃ at 120 rpm / min for 24 hours to inactivate, and finally add sodium thiosulfate to a final concentration of 2 mmol / L to terminate the inactivation.
[0102] 2.5 Vaccine Preparation
[0103] (1) Preparation of oil phase: Take white oil for injection, add Siban-80 and mix, then add aluminum stearate and heat while stirring until transparent.
[0104] (2) Preparation of aqueous phase: Take Tween-80, put it into a bottle with a glass bulb for sterilization, and after cooling, add inactivated porcine circovirus type 2 strain antigen solution and shake thoroughly to completely dissolve Tween-80.
[0105] (3) Vaccine preparation: The oil phase of the emulsion is placed in a high-speed shear press and stirred at 300 rpm for 10 minutes. The aqueous phase is slowly added, and then emulsified at 3000 rpm for 30 minutes. The emulsion is quantitatively dispensed and sealed at 4°C to obtain the vaccine.
[0106] Following the above procedure, aPCV2-chicken-GDQY2 inactivated vaccine and aPCV2-duck-GDYF1 inactivated vaccine were prepared respectively for the following immunoprotective efficacy test.
[0107] 2.6 Detection of Immunoprotective Effect
[0108] Twenty 15-day-old SPF chickens and twenty 15-day-old ducklings were purchased. The 20 SPF chickens were divided into two groups (PBS placebo group and aPCV2-chicken-GDQY2 inactivated vaccine group), and the 20 ducklings were divided into two groups (PBS placebo group and aPCV2-duck-GDYF1 inactivated vaccine group). The first immunization was recorded as day one. The second immunization was given 14 days later. Challenge was performed on day 35. Each duckling in the control group received 400 μl of PBS, and each duckling in the experimental group received 400 μl of virus solution. Antibody detection was performed on serum samples collected from days 0 to 35. The results are as follows: Figure 10 As shown, serum was collected on days 42 and 49 for preliminary viral copy number testing to check whether aPCV2 was replicating in vivo. On day 49, the experimental animals were euthanized and samples were collected for testing. The results are as follows... Figure 11 As shown, this demonstrates that the inactivated vaccine prepared according to the present invention has a protective effect on poultry.
[0109] Example 3
[0110] (1) Construction of recombinant expression plasmids pET-28a-YF-aPCV2 cap and pET-28a-YF-aPCV2 Rep
[0111] Using the nucleic acid of porcine circovirus type 2 (aPCV2-duck-GDYF1) as a template, the aPCV2 Cap and Rep gene fragments were amplified by PCR. The primers are shown in Table 4, and the amplification reaction system and procedure are shown in Tables 2 and 3, respectively. Then, Cap was digested with ScaI and XhoI, and Rep was digested with XhoI and BmtI before ligation with the similarly digested prokaryotic expression vector pET-28a to construct the prokaryotic expression plasmids pET-28a-YF-aPCV2 Cap and pET-28a-YF-aPCV2 Rep. These recombinant plasmids were transformed into *E. coli* DH5α, and multiple single colonies were randomly selected and inoculated into 2 mL of LB / Ampr medium, incubated at 37°C for 8 h with shaking. PCR and enzyme digestion identification were then performed, and the results are shown below. Figure 12 and Figure 13As shown, the PCR products were simultaneously sent to the company for sequencing confirmation. Then, the verified bacterial culture was shaken vigorously (200 mL) before plasmid extraction.
[0112] The construction of the recombinant expression plasmids pET-28a-QY-aPCV2 cap and pET-28a-QY-aPCV2 Rep is the same.
[0113] Table 4 Amplification Primers
[0114]
[0115]
[0116] (2) Induction and purification of recombinant proteins
[0117] The correctly sequenced recombinant expression plasmids pET-28a-YF-aPCV2 cap and pET-28a-YF-aPCV2 Rep were transformed again into E. coli BL21(DE3). Single colonies were picked and inoculated into 10 mL of LB / Ampr medium and cultured overnight at 37°C with shaking. The next day, the bacterial culture was inoculated into LB / Ampr medium at a 1:100 ratio and cultured at 37°C with shaking for 2–4 hours until OD. 600 When the pH value reached 0.5–0.6, IPTG was added to a final concentration of 0.5 mmol / L, and the mixture was incubated at 37°C with shaking for 12 h to induce expression. The induced expression samples were purified according to the His.tag protein purification kit instructions. The target protein was eluted stepwise, and the eluent was collected to obtain purified recombinant YF-aPCV2 cap and YF-aPCV2 Rep proteins. The purified recombinant YF-aPCV2 cap and YF-aPCV2 Rep proteins were analyzed by SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). The results are as follows: Figure 14 , Figure 15 As shown.
[0118] The preparation methods for recombinant proteins QY-aPCV2 cap and QY-aPCV2 Rep are the same as those for recombinant proteins YF-aPCV2 cap and YF-aPCV2 Rep.
[0119] (3) Identification of recombinant proteins
[0120] The purified recombinant YF-aPCV2 cap and YF-aPCV2 Rep proteins were subjected to SDS-PAGE electrophoresis and membrane transfer, followed by blocking with 5% (m / v) skim milk powder overnight at 4°C. The mice-derived PCV2 Cap and PCV2 Rep primary antibodies were incubated, and HRP-labeled goat anti-mouse IgG was used as the secondary antibody for Western blot identification. The results are as follows: Figure 16 ,17 As shown, the recombinant proteins YF-aPCV2 cap and YF-aPCV2 Rep were successfully obtained.
[0121] The identification of QY-aPCV2 cap and QY-aPCV2 Rep proteins is consistent with that of YF-aPCV2 cap and YF-aPCV2 Rep proteins.
[0122] Example 4
[0123] Preparation of ELISA test plates for PCV2
[0124] The purified YF-aPCV2 Rep protein obtained in Example 3 was used as an antigen for coating. The YF-aPCV2 Rep protein was diluted to 2.0 μg / mL with ELISA coating buffer. 100 μL of the diluted antigen was added to a 96-well ELISA plate and stored at 4°C overnight. After coating with the antigen, the coating buffer (ELISA coating buffer) was discarded. The plate was washed three times with 350 μL PBST (PBS containing 0.05% Tween-20), and then blocked with bovine serum albumin (BSA) (PBS containing 1% BSA) at 4°C for 12 h. After blocking, the plate was washed three times with 350 μL PBST and dried at 37°C for 60 min.
[0125] Example 5
[0126] Establishment of an indirect ELISA detection method for aPCV2 Rep
[0127] (1) Determination of the concentration of the coating antigen and the antibody dilution concentration
[0128] The purified prokaryotically expressed YF-aPCV2 Rep protein from Example 3 was used as the antigen for coating. The antigen was serially diluted to 2.0, 1.0, 0.5, 0.25, and 0.1 μg / mL with coating diluent, 100 μL per well, and coated overnight at 4°C. After coating, the coating solution was discarded, and blocking buffer was added for overnight blocking. Positive and negative sera were diluted 1:25, 1:50, and 1:100, respectively. An orthogonal method was used to set the combination of coating concentration and dilution factor. Three replicates were set for each negative and positive sample, and subsequent procedures followed standard protocols. The optimal working concentration was the antigen coating concentration with a serum OD positive value of approximately 1.0 and the highest positive OD / negative OD (P / N) ratio. The orthogonal experimental results (see Table 5) show that when the coating antigen concentration is 2.0 μg / mL and the serum dilution ratio is 1:50, the OD450nm value of aPCV2 positive serum is close to 1.0, and the P / N ratio is the largest, meeting the selection criteria. Therefore, the optimal coating antigen concentration is 2.0 μg / mL, and the optimal serum dilution ratio is 1:50.
[0129] Table 5. Results of the orthogonal experiment on the concentration of YF-aPCV2 Rep antigen and the antibody dilution concentration.
[0130]
[0131]
[0132] Note: P / N* = Positive serum OD450nm value / Negative serum OD450nm value.
[0133] (2) Optimization of working concentration of enzyme-labeled secondary antibody
[0134] Enzyme-labeled secondary antibody was optimized using an antigen-coating concentration of 2.0 μg / mL and a serum dilution ratio of 1:50. Goat anti-chicken enzyme-labeled secondary antibody was used at three dilutions: 1:10000, 1:20000, and 1:30000 for indirect ELISA. Each reaction step was carried out at 37℃ for 30 min, followed by 12–15 min of color development. The OD value of the samples was measured at 450 nm. The enzyme-labeled secondary antibody concentration with the highest P / N ratio was considered the optimal working concentration. The results are shown in Table 6. The P / N ratio was highest at a dilution ratio of 1:20000; therefore, the optimal working concentration of the secondary antibody was 1:20000.
[0135] Table 6. Results of enzyme-labeled secondary antibody dilution
[0136]
[0137] (3) Determination of positive and negative cutoff values for indirect ELISA
[0138] Thirty SPF-grade poultry serum samples were selected as negative controls. PCV2 antibody levels were detected using an optimized ELISA procedure. The OD450 value of each sample was recorded, and the mean OD450 and standard deviation of the 30 SPF-grade poultry serum samples were calculated. The formula is: mean OD450 + 3 times the standard deviation (SD). The P / N ratio is the OD450 value of positive serum / OD450 value of negative serum. The identification cutoff for the P / N serum sample is 3 SDs of the negative control. The average absorbance of the 30 negative serum samples at 450 nm was 0.133, and the standard deviation of the absorbance was 0.039. Therefore, the ELISA cutoff value is 0.133 + 3 × 0.039 = 0.250. Serum samples with an OD450 nm value equal to or higher than this cutoff value are considered positive.
[0139] (4) Perform ELISA testing based on the optimal results selected in (1)-(3) above, including the following steps:
[0140] 100 μL of serum diluted with sample dilution buffer (1×PBS) was added to each well of a 96-well ELISA plate (obtained in Example 4). Negative and positive controls were included, and the plate was incubated at 37°C for 60 min. After washing five times with PBST for 2–3 min each time, 120 μL of horseradish peroxidase-labeled (HRP) goat anti-pig IgG secondary antibody, horseradish peroxidase-labeled (HRP) goat anti-chicken IgG secondary antibody, and horseradish peroxidase-labeled (HRP) goat anti-duck IgG secondary antibody diluted with PBST were added respectively. The plate was incubated at 37°C for 30 min, and then washed five times with 350 μL of PBST for 2–3 min each time. Finally, the peroxidase reaction was observed using 100 μL of tetramethylbenzidine-hydrogen peroxide (TMB) solution as a substrate. After incubating at room temperature in the dark for 15 minutes, add 50 μL of 2M sulfuric acid to each well to stop the reaction. Use a 450nm microplate reader to read the optical density (OD450) at 450nm. Serum samples with OD450 nm equal to or higher than 0.250 are considered positive, otherwise they are considered negative.
[0141] Example 6
[0142] Specificity and repeatability of the detection method described in Example 5
[0143] Clinical sera specific to each of the following viruses were used: porcine circovirus type 3 (PCV3), avian porcine circovirus type 2 (aPCV2), porcine circovirus type 2 (PCV2), porcine pseudorabies virus (PRV), porcine epidemic diarrhea virus (PEDV), porcine reproductive and respiratory syndrome virus (PRRSV), and classical classical swine fever virus (CSFV). These sera were identified using commercially available kits. Three sera samples for each pathogen were tested using the ELISA assay procedure in step (4) of Example 5, with negative and blank controls included. OD450 values were statistically analyzed to determine positive or negative results and assess specificity. The results are shown in Table 7. The OD450 nm values of positive sera for porcine circovirus type 2, porcine pseudorabies virus, porcine reproductive and respiratory syndrome virus, porcine epidemic diarrhea virus, and classical classical swine fever virus were all less than the critical value of 0.250. Therefore, the indirect ELISA method established under these conditions has high specificity.
[0144] Table 7 Specific detection results
[0145]
[0146]
[0147] To assess the repeatability of the experiment, four negative and four positive sera with different levels of avian antibodies were taken and three intra-batch and inter-batch replicates were performed using the ELISA detection steps in step (4) of Example 5. The results are shown in Table 8. The coefficients of variation of the intra-batch and inter-batch experimental results were all less than 10%, which shows that the detection method of the present invention has high repeatability.
[0148] Table 8 Repeatability Test Results
[0149]
[0150]
[0151] Example 7
[0152] Preparation of ELISA detection plates for aPCV2 cap
[0153] The purified YF-aPCV2 cap protein obtained in Example 3 was used as an antigen for coating. The YF-aPCV2 cap protein was diluted to 2.0 μg / mL with ELISA coating buffer. 100 μL of the diluted antigen was added to a 96-well ELISA plate and stored at 4°C overnight. After coating with the antigen, the coating buffer (ELISA coating buffer) was discarded. The plate was washed three times with 350 μL PBST (PBS containing 0.05% Tween-20), and then blocked with bovine serum albumin (BSA) (PBS containing 1% BSA) at 4°C for 12 h. After blocking, the plate was washed three times with 350 μL PBST and dried at 37°C for 60 min.
[0154] Example 8
[0155] Preparation and immunoprotective efficacy of subunit vaccines
[0156] 8.1 Vaccine Preparation
[0157] (1) Calculate the amount and volume of antigen required for each injection. For subcutaneous or intramuscular injection, administer 50-200 μg of antigen per chick per injection, with an injection volume of less than 50 μL; for intraperitoneal injection, administer 200-400 μL per chick per injection. Strong detergents will weaken the emulsification effect and should be avoided. Prepare approximately 50% more vaccine than the final required amount.
[0158] (2) Select the syringe based on the total volume of the added materials. The total volume of the adjuvant and the QY-aPCV2 cap or QY-aPCV2 Rep or YF-aPCV2 cap or YF-aPCV2 Rep protein (antigen) obtained in Example 3 should be approximately half the volume of the syringe. For example, when preparing 2.5 ml of vaccine, use a 5 ml syringe for emulsification.
[0159] (3) Before use, preheat Freund's complete adjuvant (or Freund's incomplete adjuvant) to 37°C, shake for 1-2 minutes or invert the bottle several times by hand to resuspend the adjuvant evenly. Draw the required volume of Freund's complete adjuvant or Freund's incomplete adjuvant into the syringe, connect the syringe to the two-hole connector, and expel the air (excessive air will hinder the formation of a stable emulsifier).
[0160] (4) Draw water-soluble antigen into another syringe and expel air (excessive air can hinder the formation of a stable emulsion).
[0161] (5) Connect the syringe containing the antigen to one end of the two-hole connector. Ensure that both syringes are securely fixed to the two-hole emulsification connector using Luer-lock.
[0162] (6) Smoothly push the piston to allow all the antigen solution to pass through the two-hole connector and mix with Freund's complete adjuvant or Freund's incomplete adjuvant. Alternate between the two, continuously transferring the mixture from one syringe to another.
[0163] (7) Continue emulsifying as described above until a stable emulsifier is formed. This will take several minutes. Dispense a small drop of emulsifier into a beaker containing water; the drop should form a stable oil droplet on the water surface. If the emulsion disperses on the water surface, reassemble the syringe and continue emulsifying.
[0164] (8) Push all the emulsifier into a syringe. Remove the two-hole connector and attach the injection needle. Alternatively, you can remove the empty syringe and replace it with a 1ml sterile syringe. At this point, the emulsifier can be transferred into the 1ml syringe for injection.
[0165] 8.2 Immunoprotection test
[0166] Fifty 15-day-old SPF chickens were purchased and randomly divided into five groups (control group, QY-aPCV2 cap group, QY-aPCV2Rep group, YF-aPCV2 cap group, and YF-aPCV2 Rep group). After one week of rest, blood was collected on day 0 (the first immunization was recorded as day 1). A second immunization was administered 14 days later, with 300 μl of emulsified vaccine injected intramuscularly and subcutaneously each time. Blood was collected every 7 days. On day 35, PCV2 challenge was performed. The control group received 400 μl of PBS, while the experimental groups received 400 μl of virus solution per chicken. Antibody levels were measured in serum collected on days 0, 7, 14, 21, 28, and 35. On day 49, the experimental animals were sacrificed and samples were collected for testing. Antibody levels in the Cap group were detected using the Jinno Diagnostics PCV2-dCap ELISA kit, and in the Rep group, the ELISA method prepared in this patent was used. The antibody level results are as follows: Figure 18 and Figure 19 As shown, immune protection is as follows Figure 20 and Figure 21 As shown, this invention's subunit vaccine has a protective effect on poultry.
[0167] Example 9
[0168] MDCC-MSB1 can be used to isolate and culture aPCV2.
[0169] 9.1 Effects of aPCV2 infection on MDCC-MSB1 cells
[0170] After resuscitation, MDCC-MSB1 cells were cultured in RPMI 1640 medium containing 10% fetal bovine serum in culture flasks until the cells grew to 2 × 10⁶ cells / year. 6 Afterward, centrifuge at 800 r / min for 5 min, discard the supernatant, add a small amount of fresh culture medium, and gently resuspend the cells.
[0171] The aPCV2 virus solution (obtained from 1.2 in Example 1) was diluted 10% by volume using sterile 1640 medium and added to the resuspended cell culture. The mixture was incubated for 1 hour, centrifuged at 800 rpm for 5 minutes, the supernatant was discarded, and 10 ml of fresh culture medium was added. Then, 300 mM D-glucosamine was added, and the mixture was incubated for 24 and 48 hours. After centrifugation at 800 rpm for 5 minutes, the supernatant was discarded, and Western blotting (WB) lysis buffer or 4% paraformaldehyde was added. The control group was PK-15 cells. When PK-15 cells reached approximately 70% confluence, they were inoculated with the virus, and the medium was changed to 2% DMEM. The cells were incubated at 37°C for 24 and 48 hours, after which WB lysis buffer or 4% paraformaldehyde was added. Western blotting and in vitro anabolism (IFA) were then performed for validation.
[0172] 9.2WB Verification
[0173] (1) Sample preparation: Discard the cell culture medium, add WB cell lysis buffer and 1% protease phosphatase inhibitor (operation on ice), repeatedly pipette to detach the cells from the cell wall, and transfer to a 1.5 mL centrifuge tube. (2) Electrophoresis: Load the protein sample, first run electrophoresis at a constant voltage of 85V until the protein bands move from the stacking gel to the separating gel, then adjust the voltage to 100V and stop when the protein bands reach the appropriate position. (3) Transfer: Activate the PVDF membrane in formaldehyde solution (pre-cooled to -20℃), use wet transfer method (transfer buffer must be pre-cooled to -20℃), transfer under ice bath conditions, 100V for 2 hours. (4) Blocking: After the transfer is completed, take out the membrane, place it face up in a box containing skim milk powder blocking solution, and block at room temperature for 2 hours. (5) Washing: Wash the membrane five times with PBST elution buffer on a shaker, 5 minutes each time. (6) Incubation with primary antibody: Incubate overnight at 4℃. The primary antibody was diluted 1:1000 using primary antibody diluent. (7) Washing the membrane: Same as step (5). (8) Incubating the secondary antibody: Place the membrane in the diluted secondary antibody solution and incubate at room temperature on a shaker for 1 hour. Goat anti-mouse secondary antibody was used and diluted 1:5000 using secondary antibody diluent. (9) Washing the membrane: Same as step (5). (10) Exposing the membrane: Mix solution A and solution B in the ultrasensitive ECL chemiluminescence kit at a 1:1 ratio, place the membrane in the solution, expose the membrane using the instrument, take a picture and save the result. The result is as follows. Figure 22 As shown (three parallel experiments were conducted).
[0174] 9.3 IFA Identification
[0175] Cells were fixed with 4% paraformaldehyde, followed by IFA detection. Fluorescence was observed under a fluorescence microscope, and the results were photographed and stored. The results are as follows: Figure 23 As shown.
[0176] Depend on Figure 22 and Figure 23 It can be seen that MDCC-MSB1 can infect avian aPCV2 virus and its infection efficiency is higher than that of PK-15. Therefore, MDCC-MSB1 can be used to isolate and culture avian porcine circovirus type 2.
[0177] Example 10
[0178] Chicken embryo isolation PCV2 test
[0179] Forty SPF-grade fertilized eggs were purchased and incubated at 37°C. On day 8, the eggs were randomly divided into two groups (experimental group and control group). In the experimental group, porcine PCV2 virus isolated by PK-15 was injected into the allantoic cavity in a sterile laminar flow hood (the method for isolating porcine circovirus type 2 with PK-15 was based on the method described by Xu Pengli et al. (Xu Pengli, 2018)). 200 μl of virus solution was injected into each egg. The control group received no treatment. The eggs were then returned to the 37°C incubator for 72 hours. The allantoic fluid was collected under sterile conditions to obtain the virus, and total viral nucleic acid was extracted and detected by q-PCR. The method for isolating porcine circovirus type 2 with PK-15 described by Xu Pengli et al. was used as the control group. The results are as follows: Figure 24 As shown, the viral load isolated from chicken embryos was higher than that isolated from traditional PK-15 cells.
[0180] This example demonstrates that porcine PCV2 can infect poultry, and that high titers of porcine circovirus can be detected in allantoic fluid, indicating that this method can be used to isolate porcine circovirus type 2.
[0181] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. An aPCV2 gene, characterized in that, The nucleotide sequence of the aPCV2 gene is shown in SEQ ID NO.
1.
2. The use of the aPCV2 gene as described in claim 1 in the preparation of PCV2 vaccines.
3. An inactivated vaccine, characterized in that, This includes viral strains containing the aPCV2 gene as described in claim 1.
4. A method for efficiently separating PCV2, characterized in that, The procedure includes the following steps: injecting PCV2 virus into the allantoic cavity of 8-11 day old avian embryos, incubating, collecting allantoic fluid to obtain PCV2 virus, wherein the PCV2 virus is a virus strain containing the aPCV2 gene as described in claim 1.
5. Application of the MDCC-MSB1 cell line in the isolation and culture of PCV2, wherein the PCV2 is a viral strain containing the aPCV2 gene as described in claim 1.
Citation Information
Patent Citations
Gene for encoding Cap protein of porcine circovirus 2 and application thereof
CN107337718A
Poultry source PCV3 gene and application thereof
CN118497227A