mRNA molecules and their uses, viral hemorrhagic septicemia virus vaccine
By designing mRNA molecules encoding the G protein of infectious hematopoietic organ necrotic virus and packaging them into lipid nanoparticles, an effective mRNA vaccine was constructed, solving the problem of lack of fish mRNA vaccines in the prior art and achieving effective immune protection against IHNV.
Patent Information
- Application Number
- CN202411091313.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-09
- Publication Date
- 2025-05-30
- Estimated Expiration
- 2044-08-09
AI Technical Summary
There is a lack of effective mRNA vaccines in the prior art for preventing diseases caused by infectious hematopoietic organ necrosis virus (IHNV), especially in the fish field.
An mRNA molecule containing the G-protein coding sequence of infectious hematopoietic organ necrosis virus is designed, including the 5’UTR region, the kozak sequence, the CDS region, the 3’UTR region and poly A tail, and mRNA is synthesized by in vitro transcription technology and packaged into lipid nanoparticles (LNPs) for vaccine preparation.
This mRNA vaccine is able to successfully express G protein in rainbow trout cells, stimulate rainbow trout to produce antibodies that neutralize IHNV, and provides significant specific protection, significantly reducing the mortality rate of viral infection.
Smart Images

Figure CN118956907B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical fields of molecular biology and immunology, and particularly relates to an mRNA molecule and its uses, and an infectious haematopoietic necrosis virus vaccine. Background Art
[0002] Infectious haematopoietic necrosis (IHN) is a viral disease that seriously endangers salmonids. After an outbreak, it can cause a mortality rate as high as 80% - 100%. The pathogen of this disease is Infectious haematopoietic necrosis virus (IHNV), which was first discovered in a red salmon fry hatchery in the western part of North America in the early 1950s, and then quickly spread to Europe and Asia, bringing heavy losses to the world salmon aquaculture industry. Therefore, IHN is listed as a disease that must be reported by the World Organization for Animal Health (WOAH), and is listed as a class II disease in China. It is the main bottleneck faced by the development of the cold-water fish aquaculture industry in China.
[0003] Infectious haematopoietic necrosis virus (IHNV) belongs to the family Rhabdoviridae and is the virus that causes IHN. Its genome length is about 11 kb and it belongs to a single-stranded negative-strand RNA virus. The genome of IHNV encodes six genes, which encode the viral nucleoprotein (N), phosphoprotein (P), matrix protein (M), glycoprotein (G), non-structural protein (NV), and polymerase protein (L) respectively. Among them, the glycoprotein (G) is the surface protein of the virus, contains abundant antigenic epitopes, and is regarded as the protective antigen of IHNV. In antiviral immunity and vaccine development, researchers often use the G protein as the antigen target protein.
[0004] mRNA vaccines refer to novel nucleic acid vaccines that are synthesized by in vitro transcription technology to produce mRNA carrying pathogen proteins, delivered to target cells through a delivery system, and translated into the target antigen in cell ribosomes, thereby initiating an immune response in the body. They have been vigorously developed in recent years. There are already mRNA vaccines approved for marketing, and a large amount of research is also being carried out on other mammalian mRNA vaccines, but there are no relevant reports in the field of fish. Although there are already highly efficient IHNV DNA nucleic acid vaccines available, due to the advantages of higher safety and faster action of mRNA vaccines compared to DNA vaccines, mRNA vaccines have broad research prospects in the development of IHN vaccines and even in the field of fish vaccines. Summary of the Invention
[0005] To solve the above problems in the prior art, the present invention provides an mRNA molecule and its uses, as well as an infectious hematopoietic necrosis virus vaccine.
[0006] To achieve the above object, a first aspect of the present invention provides an mRNA molecule, the main feature of which is that the mRNA molecule includes: a 5'UTR region, a kozak sequence, a CDS region, a 3'UTR region, and a poly A tail; the nucleotide sequence of the CDS region is as shown in SEQ ID NO.1.
[0007] Preferably, the nucleotide sequence of the 5'UTR region is as shown in SEQ ID NO.2, and the nucleotide sequence of the 3'UTR region is as shown in SEQ ID NO.3.
[0008] Preferably, the mRNA molecule encodes the G protein of the infectious hematopoietic necrosis virus, and the amino acid sequence of the G protein is as shown in SEQ ID NO.4.
[0009] Preferably, the kozak sequence is: GCCACC; the poly A tail consists of 100 bases of A.
[0010] A second aspect of the present invention provides the use of the mRNA molecule in the preparation of an infectious hematopoietic necrosis virus vaccine.
[0011] A third aspect of the present invention provides an infectious hematopoietic necrosis virus vaccine, the main feature of which is that it contains the mRNA molecule.
[0012] A fourth aspect of the present invention provides the application of a recombinant plasmid or a recombinant microbial cell containing a DNA molecule encoding the mRNA molecule in the preparation of an mRNA vaccine for preventing or treating infectious hematopoietic necrosis.
[0013] A fifth aspect of the present invention provides the application of a lipid nanoparticle containing the mRNA molecule in the preparation of an mRNA vaccine for preventing or treating infectious hematopoietic necrosis.
[0014] The beneficial effects of the mRNA molecule and its uses, as well as the infectious hematopoietic necrosis virus vaccine of the present invention are as follows: the mRNA vaccine constructed by the present invention has corresponding immunogenicity, can stimulate rainbow trout to produce non-specific immune responses, can stimulate the specific immune response of rainbow trout, and enable the immunized rainbow trout to produce antibodies that neutralize IHNV, providing significant specific protection for the immunized rainbow trout. BRIEF DESCRIPTION OF THE DRAWINGS
[0015] Figure 1This is the result diagram of the expression of the mRNA vaccine of the present invention in HEK293T and CHSE-214 cells.
[0016] Figure 2 A and Figure 2 B are the result diagrams of the stability of the mRNA vaccine of the present invention in HEK293T and CHSE-214 cells respectively.
[0017] Figure 3 This is the result diagram of the generation of neutralizing antibodies in immune sera.
[0018] Figure 4 A to Figure 4 F are the result diagrams of the expression of immune gene transcription levels. Detailed implementation manners
[0019] In order to make the technical means, creative features, achieved purposes and effects of the present invention easy to understand, the present invention will be further described below in conjunction with specific embodiments.
[0020] This study was based on the IHNV isolate GS21 isolated from a Gansu fish farm in 2021. The mRNA vaccine was designed by using the IHNV G protein's own UTR as the vaccine mRNA UTR and optimizing the codons of the G protein in the CDS region, and immunizing rainbow trout with LNP-wrapped, which better improved the immune protection effect.
[0021] The experimental materials involved in the following examples are:
[0022] The IHNV isolate GS21 (preserved in the China Center for Type Culture Collection CCTCC on July 10, 2024, with the strain preservation number CCTCC NO: V202467) was isolated from diseased rainbow trout in Gansu. HEK293T and CHSE-214 cells were preserved in this laboratory. Antigen, untranslated region and other sequences were synthesized by Nanjing GenScript. mRNA in vitro transcription reagents were all purchased from Novoprotein. The transfection reagent Lipofectamine MessengerMAX (LMRNA001) was purchased from Thermo Fisher. The main reagents for Western Blotting experiments were all purchased from Beyotime. 6*His-tag Rabbit Polyclonal Antibody (R1207-2) was purchased from Huaan Biotech. The quantitative PCR kit MonAmp SYBR×green qPCR Mix (MQ10701S) was purchased from Mona.
[0023] Example 1
[0024] Design and verification of the mRNA vaccine
[0025] Molecular design of the mRNA vaccine
[0026] The G protein on the surface of the selected IHNV isolate GS21 virus (preserved in the China Center for Type Culture Collection CCTCC on July 10, 2024, with the strain preservation number CCTCC NO: V202467) (the amino acid sequence of the G protein is shown in SEQ ID NO.4) was used as the target antigen, and according to the codon bias of rainbow trout protein translation, its antigen sequence was codon-optimized. The optimized G protein antigen sequence was used as the CDS region of the mRNA vaccine, and its nucleotide sequence (antigen coding sequence) is shown in SEQ ID NO.1.
[0027] To increase the stability and translation effect of the mRNA vaccine, the UTR sequences carried by the G protein itself were used as the untranslated regions 5’UTR and 3’UTR of the mRNA vaccine respectively. Among them, the 5’UTR region: GCACUUUUGUGCUUUGAGACCGAACGCAACUCGCAGAGACCCACC (SEQ ID NO.2); the 3’UTR region: AGGACCUCAAUCUUCACUUCCUCACCACCAGACAGAAAAAAA (SEQ ID NO.3); at the same time, a Kozak sequence was added after the 5’UTR, and a poly A tail composed of 100 bases A was added after the 3’UTR. The Kozak sequence is: GCCACC; the poly A tail is composed of 100 bases A.
[0028] In vitro transcription to produce the mRNA vaccine
[0029] Based on the above design, the pVAX1 plasmid was selected as the vector, and the Nanjing Genscript Corporation was entrusted to synthesize the plasmid template pVAX1-mRNA for the production of the mRNA vaccine. The pVAX1-mRNA was linearized and transcribed in vitro to generate the mRNA vaccine, denoted as G protein-mRNA.
[0030] mRNA vaccine stability detection
[0031] Western Blotting detection:
[0032] Twenty-four hours before transfection, HEK293T and CHSE-214 cells were seeded in 24-well plates. When the cells grew to a confluence of 60-70%, the medium in the wells was replaced with serum-free medium, and the transfection system was prepared according to the instructions for the transfection reagent. 1 μg of mRNA was transfected into each well. Six hours after transfection, the medium was replaced with medium containing 10% serum, and the cells were cultured statically. The cell samples were collected 24 hours after transfection, and the expression of G antigen was detected by Western Blotting and 6*His-tag rabbit antibody.
[0033] The expression of the mRNA vaccine of the present invention in HEK293T and CHSE-214 cells is as Figure 1 shown, indicating that the G protein can be successfully expressed by the mRNA vaccine designed in the present invention in HEK293T cells and CHSE-214 cells.
[0034] mRNA vaccine stability detection:
[0035] Cell samples were collected at 6, 12, 24, 48, and 72 h after transfection. Total cellular RNA was extracted using an RNA extraction kit, and the degradation rate of G protein-mRNA in the cells was detected using the Mona quantitative PCR kit MonAmp SYBR×green qPCR Mix (F: CACAAGGGCAGCATCTACCA, R: CCGTGAAATCCCTCCCACTC).
[0036] The stability of the mRNA vaccine of the present invention in HEK293T and CHSE-214 cells is as Figure 2 A and Figure 2 B shown, indicating that the mRNA vaccine designed in the present invention was significantly degraded from 6 h to 12 h after transfection of HEK293T cells and CHSE-214 cells with the Lipo-MessengerMax reagent, and slowly degraded and tended to be stable after 12 h.
[0037] Example 2
[0038] LNP-mRNA nanoparticles
[0039] The following LNP protocol was used in this Example 2 for the packaging and preparation of mRNA.
[0040] Preparation of the lipid solution: All ionizable lipids and helper lipids were prepared with absolute ethanol. Among them, the stock solution concentrations of the four components of the ionizable lipid SM-102, cholesterol, phospholipid, and distearoylphosphatidylethanolamine-polyethylene glycol 2000 (DSPE–PEG2000) were all 10 mg / mL, and they could be diluted according to actual needs when used.
[0041] Preparation of lipid nanoparticles: The molar ratio of each component of the lipid nanoparticles is ionizable lipid SM-102: helper phospholipid: cholesterol: DSPE-PEG = 50:10:38.5:1.5. Take two enzyme-free EP tubes and label them as I and II respectively. Dissolve the lipids of the four components in an ethanol solution according to the corresponding ratio and add them to EP tube I for mixing. The total volume is recorded as V1. Pipette sodium citrate buffer (50 mM, pH = 4.0) and G protein-mRNA into II for mixing. The total volume is recorded as V2, where V2 = 3V1. Use a microfluidic machine to control the flow rate ratio of sodium citrate buffer phase: ethanol phase = 3:1, control the total flow rate, and assemble stable LNP through electrostatic adsorption. After preparation, immediately place it in a 4°C refrigerator for dialysis using a 100 kDa dialysis tube, change the dialysis fluid every 2 h for a total of 4 h to remove residual ethanol. After dialysis, perform ultrafiltration. Set the rotation speed to 3000g for ultrafiltration for 15 min, and perform it 3 times in total. After concentrating the LNP concentration to the expected concentration, filter it through a 0.22 μm filter head and characterize it using a DLS dynamic light scattering analyzer.
[0042] In the LNP protocol: Control the total flow rate to be 4 mL / min, the lipid concentration to be 4 mg / mL, prepare G protein-mRNA-LNP1, and characterize it using a DLS dynamic light scattering analyzer. The particle size and PDI are 112.3 nm and 0.118 respectively.
[0043] Example 3
[0044] Fish immunization
[0045] Immunization
[0046] Randomly divide 5 ± 0.1 g rainbow trout into groups of 40 tails each, and temporarily raise them in a circulating water tank (65 cm × 65 cm × 70 cm) with the water temperature maintained at (13.5 ± 1)°C. After domestication for 14 d, perform injection immunization with the mRNA vaccine obtained in Example 2 of the present invention (the injection site is the base of the dorsal fin), and fast for 3 d before the experiment. The immunization dose of the mRNA vaccine is 25 μg / tail, and a blank control group (50 μL / tail phosphate solution) is set up at the same time.
[0047] Generation of serum neutralizing antibodies
[0048] Collect the caudal fin blood of rainbow trout (n = 5) at 14 and 28 days after immunization. Since the amount of blood obtained is small, mix the blood of 5 fish into the same sample, place it at 4°C for 3 - 4 h, centrifuge it at 3,000 × g for 10 min, take the supernatant as the serum sample, and store it at -80°C for later use.
[0049] Take the serum sample stored in the refrigerator and inactivate it in a 56°C water bath for 30 minutes. Dilute the serum sample by 2 times, from 1:20 to 1:40, 1:80, 1:160 and 1:320 respectively. Incubate the above diluted samples with 100TCID50 of IHNV at 15°C for 1 hour. Add the mixed sample after incubation to a 96-well plate with a single layer, and make 8 replicates for each gradient. At the same time, set up normal cell blank control, virus control, negative serum control and positive serum control wells. Place it in a 15°C incubator for static culture, and observe whether CPE occurs after 7 to 10 days. The highest serum dilution that makes half of the samples free from infection is taken as the neutralizing antibody titer of the sample, and the neutralizing antibody titer <20 is considered a negative sample.
[0050] The results of the neutralizing antibody production in immune serum are as follows Figure 3 As shown, both the immunized groups (LNP / mG) produced neutralizing antibodies on the 14th and 28th days, and gradually increased. This result shows that the vaccine constructed by the present invention can stimulate the specific immune response of rainbow trout, and the immune rainbow trout produces antibodies that neutralize IHNV. After the attack, the mortality rate of the control group was 86.9%, the mortality rate of the immune group was 13.0%, and the relative immune protection rate reached 85.0%, which can provide significant specific protection for the immune rainbow trout.
[0051] Expression of immune gene transcription level
[0052] In order to detect the immunogenicity of the constructed vaccine, spleens of immune rainbow trout were collected on days 14 and 28 after immunization for Real time-PCR quantitative detection of immune gene expression levels. Blank rainbow trout samples were used as negative controls.
[0053] Specifically, rainbow trout head kidney and spleen samples were collected 14 and 28 days after immunization, and total RNA of tissues was extracted using RNA extraction kit, and quantitative analysis of Mx-1, MHCⅠ, IgM, CD4, CD8 and IFN-γ was performed using MonAmp SYBR×green qPCR Mix, a quantitative PCR kit. The control group was rainbow trout injected with PBS. The head kidney samples of each group were taken from 5 rainbow trout head kidney samples.
[0054] The expression of immune gene transcription level is as follows Figure 4 A to Figure 4 As shown in F, the results show that on the 14th and 28th days after immunization, the expression levels of CD8, MHCI, Mx-1, and IFN-γ are all upregulated, which can effectively activate the MHCI immune pathway and promote cellular immune response; the expression levels of CD4 and IgM are also significantly upregulated, which can effectively activate the MHCII immune pathway and promote humoral immune response. This result shows that the vaccine constructed by the present invention has corresponding immunogenicity and can stimulate rainbow trout to produce nonspecific immune response.
[0055] In this specification, the invention has been described with reference to specific embodiments thereof. However, it will be apparent that various modifications and variations can be made without departing from the spirit and scope of the invention. Accordingly, the specification and drawings are to be regarded as illustrative rather than restrictive.
Claims
1. An mRNA molecule, characterized in that The mRNA molecule comprises: a 5'UTR region, a kozak sequence, a CDS region, a 3'UTR region and a poly A tail; the nucleotide sequence of the CDS region is shown in SEQ ID NO.1, the nucleotide sequence of the 5'UTR region is shown in SEQ ID NO.2, the nucleotide sequence of the 3'UTR region is shown in SEQ ID NO.3, the kozak sequence is: GCCACC; the poly A tail is composed of 100 base A.
2. Use of the mRNA molecule according to claim 1 in the preparation of an infectious hematopoietic necrosis virus vaccine.
3. An infectious hematopoietic necrosis virus vaccine, characterized in that: Contains the mRNA molecule according to claim 1.
4. Use of a recombinant plasmid or recombinant microbial cell containing a DNA molecule encoding the mRNA molecule according to claim 1 in the preparation of an mRNA vaccine for preventing or treating infectious hematopoietic necrosis.
5. Use of lipid nanoparticles containing the mRNA molecule according to claim 1 in the preparation of mRNA vaccines for preventing or treating infectious hematopoietic necrosis.
Citation Information
Patent Citations
Infectious hematopoietic necrosis (IHN) nucleic acid vaccines for Chinese rainbow trout and application thereof
CN105816871A
Nucleic acid vaccine for infectious hemopoietic necrosis of Chinese rainbow trouts and application of nucleic acid vaccine
CN105861450A