A CRISPR / Cas9n high-efficiency editing vector suitable for streptomyces fradiae and application thereof

By optimizing the Cas9 protein coding sequence and sgRNA expression cassette, a high-efficiency CRISPR/Cas9n editing vector pTHF-Cas9n suitable for Streptomyces freundii was designed, solving the problems of low transformation efficiency and cell death in existing technologies, and realizing efficient editing of the Streptomyces freundii genome.

CN118956929BActive Publication Date: 2026-04-14HUBEI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-08-06
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing CRISPR/Cas9 editing vectors cannot effectively transform Streptomyces freundii, leading to bacterial death. Furthermore, traditional homologous recombination-mediated editing plasmids have low transformation efficiency, hindering the development of gene stacking modification work.

Method used

A high-efficiency CRISPR/Cas9n editing vector, pTHF-Cas9n, suitable for Streptomyces freundii, was designed. By optimizing the Cas9 protein coding sequence to Streptomyces' preferred codons and introducing a high-fidelity mutant HF-Cas9n protein, combined with an appropriate sgRNA expression cassette and repair homologous arm size, the expression time and expression level of the vector were optimized, cell death was avoided, and transformation efficiency was improved.

Benefits of technology

It has achieved precise and efficient editing of the Streptomyces freundii genome, with an editing efficiency of 100%, solving the problems of low transformation efficiency and cell death in existing technologies, and providing an efficient gene editing tool.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004981455850000053
    Figure BDA0004981455850000053
  • Figure BDA0004981455850000054
    Figure BDA0004981455850000054
  • Figure BDA0004981455850000071
    Figure BDA0004981455850000071
Patent Text Reader

Abstract

This invention belongs to the field of gene editing technology and discloses a high-efficiency CRISPR / Cas9n editing vector suitable for *Streptomyces freundii* and its applications. The aforementioned editing vector includes P... kasO * indicates the sgRNA expression cassette of the promoter and the thioseriin-induced promoter P. tipA The HF-Cas9n expression cassette regulates expression. The gene editing vector provided by this invention enables precise and efficient editing of the *Streptomyces freundii* genome, with a success rate of up to 100%, providing a reliable tool for efficiently constructing engineered *Streptomyces freundii* strains to improve the industrial production of *Streptomyces freundii* cell products.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of gene editing technology, specifically relating to a CRISPR / Cas9n high-efficiency editing vector suitable for Streptomyces freundii and its application. Background Technology

[0002] Streptomyces fradiae is a prokaryotic microorganism belonging to the genus Streptomyces in the order Actinobacteriaceae. It is currently widely used in the production of various antibiotics, alkaloids, and other microbial fermentation products. However, the yield of these fermentation products is gradually failing to meet the growing market demand. Furthermore, breeding high-yield strains through mutagenesis is time-consuming, involves a large screening workload, and results in random progeny traits, posing significant challenges to practical applications. Therefore, it is necessary to utilize gene editing technology to specifically modify key genes in the synthesis process of the target product, in order to efficiently cultivate engineered Streptomyces fradiae strains that produce high yields of the target product.

[0003] CRISPR / Cas9n-mediated gene editing technology refers to the use of the Cas9n endonuclease to generate single-strand breaks (SSBs) at targeted sites in the genome, inducing homologous recombination repair (HR) in the target strain. The upstream and downstream homologous arms of the target gene carried by the editing plasmid serve as repair templates, thus completing genome editing. Compared with traditional homologous recombination-mediated editing technologies, CRISPR / Cas9n-mediated gene editing technology has significant advantages in terms of high editing efficiency and low workload.

[0004] In its initial work, the applicant first attempted to edit the *Streptomyces freundii* genome using the commercially available editing plasmid pKC1139, a traditional homologous recombination-mediated gene editing method. However, the transformation efficiency of this plasmid was extremely low, hindering subsequent gene stacking modification work. Secondly, the applicant used CRISPR / Cas9 editing vectors applicable to various *Streptomyces* species, but these vectors resulted in cell death after transformation into *Streptomyces freundii*, failing to yield transformants.

[0005] Prior to the submission of this application, there were no reports of the successful application of CRISPR / Cas9n-mediated gene editing technology in Streptomyces freundii. Summary of the Invention

[0006] The purpose of this invention is to provide a CRISPR / Cas9n high-efficiency editing vector suitable for Streptomyces freundii, the vector being shown in SEQ ID NO.1. This vector provides a reliable tool for efficiently constructing engineered strains of Streptomyces freundii to improve the industrial production of Streptomyces freundii cell products.

[0007] Another objective of this invention is to provide the application of a CRISPR / Cas9n high-efficiency editing vector suitable for Streptomyces freundii in gene editing of Streptomyces freundii.

[0008] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0009] In its preliminary work, the applicant discovered that existing CRISPR / Cas9 editing vectors were completely ineffective in successfully editing *Streptomyces freundii*, leading to bacterial death after vector transfer. Further investigation revealed that the expression time and level of the Cas9 protein within the bacteria had a critical impact on bacterial survival. Therefore, after extensive screening and modification of expression elements in the vector, the applicant transformed the Cas9 protein coding sequence into a *Streptomyces freundii*-preferred codon-optimized HF-Cas9n protein-coding gene and introduced a high-fidelity mutation, ultimately obtaining a highly efficient CRISPR / Cas9n editing vector suitable for *Streptomyces freundii*. This editing vector, pTHF-Cas9n, consists of a pKC1139 linear backbone, an HF-Cas9n expression cassette, and an sgRNA expression cassette; the sequence of the pTHF-Cas9n vector is shown in SEQ ID NO.1.

[0010] The scope of protection of this invention also includes:

[0011] Application of the above-mentioned editing vector pTHF-Cas9n in gene editing of engineered strains of Streptomyces freundii;

[0012] In the above-described applications, preferably, during the application process, the size of the repair homologous arm of the target gene to be edited is adjusted according to the size of the target gene, specifically as follows:

[0013] The target gene is less than or equal to 10kb, and the size of the repair homologous arm is 1-1.5kb;

[0014] The target gene is larger than 10kb, and the size of the repair homologous arm is 1.5-2kb.

[0015] In the above-described applications, preferably, during the induction of Cas9n protein expression, the final concentration of thiostreptin added to the solid culture medium is 20-30 μg / mL, with the optimum being 25 μg / mL.

[0016] Compared with the prior art, the present invention has the following advantages:

[0017] This invention provides for the first time a CRISPR / Cas9n high-efficiency editing vector suitable for Streptomyces freundii, which enables precise and efficient editing of the Streptomyces freundii genome with an editing efficiency of up to 100%. Attached Figure Description

[0018] Figure 1 The image shows the pTHF-Cas9n plasmid.

[0019] Figure 2 This is a schematic diagram of the pTHF-Cas9n-mediated genome editing process in Streptomyces freundii. Detailed Implementation

[0020] Unless otherwise specified, the technical solutions described in this invention are all conventional solutions in the art; unless otherwise specified, the reagents or materials described are all from commercial sources.

[0021] The HF-Cas9n expression cassette of this invention includes the thiostreptin resistance gene tsr, the thiostreptin-inducible promoter PtipA, the HF-Cas9n protein-coding gene with optimized Streptomyces codons and high-fidelity mutations, and the terminator fd. Preferably, the HF-Cas9n expression cassette is as follows: Figure 1 As shown, its direction is opposite to that of the sgRNA expression cassette.

[0022] The sgRNA expression cassette described in this invention includes a strong promoter P. kasO * sgRNA encoding gene, terminator T0. Preferably, it contains a HindIII restriction site upstream of its 5' end.

[0023] The repair homologous arm described in this invention preferably has an XbaI restriction site between its upstream and downstream homologous arms; and an EcoRI restriction site is located downstream of the 3' end of the downstream homologous arm.

[0024] The size of the repair homologous arm described in this invention needs to be adjusted according to the size of the target gene being edited, specifically as follows:

[0025] The target gene is less than or equal to 10kb, and the size of the repair homologous arm is 1-1.5kb;

[0026] The target gene is larger than 10kb, and the repair homologous arm size is 1.5-2kb. This invention also provides that, when inducing Cas9n protein expression, the final concentration of thiostreptin added to the solid culture medium in the above-mentioned editing system is 25μg / mL.

[0027] Example 1:

[0028] Obtaining pTHF-Cas9n:

[0029] The inducible editing vector pTHF-Cas9n has the following plasmid structure: Figure 1 As shown in SEQ ID NO.1, the full sequence of pTHF-Cas9n consists of a pKC1139 linear backbone, an HF-Cas9n expression cassette, and an sgRNA expression cassette (excluding a 20bp sequence with targeting function).

[0030] 1. Amplification of the backbone: Using plasmid pKC1139 as a template and LacZa-GF / LacZa-GR as primers, its linearized backbone was amplified.

[0031] The primers used are as follows:

[0032] LacZa-GF: AGGGTTTTCCCAGTCACGACG

[0033] LacZa-GR:CAAAGTGCCGATCAACATAAC.

[0034] 2. Construction of the HF-Cas9n expression cassette: The nucleic acid fragments of the HF-Cas9n protein and the terminator fd were artificially synthesized by Sangon Biotech (Shanghai) Co., Ltd.; using the above HF-Cas9n fragment as a template and TC9-F / TC9-R as primers, the HF-Cas9n protein nucleic acid fragment that can link with the promoter PtipA and the terminator fd was amplified; using the plasmid pUC15-PtipA-tsr as a template and PtipA-F / PtipA-R as primers, the thiostreptin-inducible promoter PtipA and the thiostreptin resistance gene t were amplified. The plasmid pUC15-PtipA-tsr was purchased from Sangon Biotech (Shanghai) Co., Ltd. Using the terminator fd fragment as a template and C9fd-F / C9fd-R as primers, a terminator fd nucleic acid fragment capable of linking with the HF-Cas9n protein fragment and linearized backbone was amplified. Then, using the three nucleic acid fragments obtained above as a template and TC9-F / C9fd-R as primers, the nucleic acid fragment carrying the HF-Cas9n expression cassette was obtained by SOE-PCR. Finally, the vector carrying the HF-Cas9n expression cassette was obtained through Gibson assembly.

[0035] The primers used are as follows:

[0036] TC9-F: AGAGAAGGGAGCGGACATATGGACAAGAAGTACTCCATCG

[0037] TC9-R:GCTGGTACATCCTGTAGATCAGTCCCCGCCGAGCTG

[0038] PtipA-F:CGTCGTGACTGGGAAAACCCTTTATCGGTTGGCCGCGAGATT

[0039] PtipA-R:ATGGAGTACTTCTTGTCCATATGTCCGCTCCCTTCTCTGA

[0040] C9fd-F:CAGCTCGGCGGGGACTGATCTACAGGATGTACCAGC

[0041] C9fd-R:GTTATGTTGATCGGCACTTTGAGCCTCAGCGACCGAATATA

[0042] 3. Construction of sgRNA expression cassette: The sgRNA fragment (excluding the 20bp target region) was artificially synthesized by Sangon Biotech (Shanghai) Co., Ltd.; using the above sgRNA fragment as a template and H3-F / E1-R as primers, the sgRNA fragment that can be linked to the backbone was amplified.

[0043] The primers used are as follows:

[0044] H3-F: TAAAACGACGGCCAGTGCCAAGCTT

[0045] E1-R: TATGACATGATTACGAATTCTTCTCCTCCTCTCTCCTCT

[0046] 4. Preparation of pTHF-Cas9n vector: The HF-Cas9n expression cassette-carrying plasmid vector obtained in step 2 was double-digested with restriction endonucleases HindIII and EcoRI to obtain a linearized backbone; the sgRNA expression cassette fragment obtained in step 3 was assembled with the above double-digested linearized backbone using Gibson to obtain the pTHF-Cas9n plasmid vector, as shown in SEQ ID NO.1.

[0047] 5. During the exploration process, the applicant modified the vector by trying various promoters, including the constitutive promoter P. ermE *(its sequence is shown in SEQ ID NO.2), constitutive promoter P SF14 (Its sequence is shown in SEQ ID NO.3), mannose-inducible promoter P manPA (Its sequence is shown in SEQ ID NO.4).

[0048] 6. Using the above P ermE *、P SF14 P manPA The promoter PtipA of the pTHF-Cas9n editing vector Cas9n was replaced to construct the editing vectors pEHF-Cas9n, pSHF-Cas9n, and pMHF-Cas9n, which served as control groups for the CRISPR / Cas9n editing vectors of Streptomyces freundii.

[0049] 7. In addition, P is used. ermE*For the sgRNA promoter P of the four editing vectors mentioned above, including pTHF-Cas9n kasO *Replaced the vectors to construct editing vectors pTHF-Cas9n-2, pEHF-Cas9n-2, pSHF-Cas9n-2, and pMHF-Cas9n-2; these served as control groups for the CRISPR / Cas9n editing vectors of Streptomyces freundii.

[0050] The primers used are as follows: PEC9n is obtained using P ermE *Replace the Cas9n promoter; PSC9n uses P... SF14 Replacing the Cas9n promoter, PMC9n uses P manPA Replace the Cas9n promoter; PEsg is used with P ermE *Replacing the sgRNA promoter, this pair of primers can replace the sgRNA promoters of this invention and three controls.

[0051] PEC9n-R:ATGGAGTACTTCTTGTCCATTATGGGTCCTCCTGTGGAGT

[0052] PEC9n-F: GGGAAAACCCTGCGGTCGATCTTGACGGCTG

[0053] PSC9n-R:ATGGAGTACTTCTTGTCCATCATCACCTGCCTCCTGACTCAG

[0054] PSC9n-F: GGGAAACCCTCGACCTACGCCTTGACCTTG

[0055] PMC9n-R:ATGGAGTACTTCTTGTCCATAAGCAAGGAATAATCCCTGC

[0056] PMC9n-F:GGGAAAACCCTTGTCTCAACTGTATACCGAA

[0057] PEsg-F: GTAGCCTCAGGAGTTGTAGCCAGCCGTCAAGATCGACCGC

[0058] PEsg-R: TATGGGTCCTCCTGTGGAGT Example 2:

[0059] Application of pTHF-Cas9n in editing genes in Streptomyces freundii:

[0060] This embodiment uses the knockout of the sfb5190 (Pulvomycin core biosynthesis gene) gene as an example to illustrate the use of the efficient editing vector provided by the present invention, but it should not be construed as a limitation on the scope of protection of the present invention.

[0061] I. Construction of pTHF-Cas9n-Δsfb5190 editing plasmid

[0062] 1. Preparation of the backbone: pTHF-Cas9n was double-digested with HindIII and EcoRI to obtain its linearized backbone vector.

[0063] 2. Cloning Fragments: Using the genome of *Streptomyces freundii* Sf01 (CN114703201A, CCTCC NO: M 2022111) as a template, and Δsfb5190-UF / Δsfb5190-UR and Δsfb5190-DF / Δsfb5190-DR as primers, the upstream and downstream gene fragments of the sfb5190 gene were amplified, serving as repair homologous arms. Simultaneously, using pTHF-Cas9n plasmid as a template, and H3-F / Δsfb5190-sgR and Δsfb5190-sgF / T0-agR as primers, the upper and lower halves of the sgRNA carrying the sfb5190 targeting sequence were amplified, respectively.

[0064] The primer sequences are shown below:

[0065] Δsfb5190-UF:GAGAGAGAGAGAGGAGAGAGGGCGTTCGGTCCTGGT

[0066]

[0067] Δsfb5190-DR:CAGGAAACAGCTATGACATGATTACGAATTCCACGTGGTGCTGGCC

[0068]

[0069] Δsfb5190-sgR: GGTGTCGCGTTTCCAGTTCT GGCCACGACTTTACAACACC

[0070] Δsfb5190-sgF: AGAACTGGAAACGCGACACC GTTTTAGAGCTAGAAATAGCAAG

[0071] T0-agR:TCCAGTAATGACCTCAGAACTCCATC

[0072] The bolded sequences in the above gene sequences are restriction enzyme sites, of which TCTAGA is the XbaI restriction site and AAGCTT is the HindIII restriction site;

[0073] The underlined sequence in the above gene sequence is the sfb5190 gene target sequence.

[0074] 3. Enzyme-linked plasmids: The reaction system was prepared on ice (using the 2×MultiF Seamless Assembly Mix kit, purchased from ABclonal Technology), reacted at 50°C for 30 min, and then immediately cooled on ice to obtain the recombinant editing vector.

[0075] 4. Recombinant plasmid transformation: Ca 2 + The recombinant product was transformed into *E. coli* XL10-gold competent cells using the transformation method. The transformed product was plated on apramycin-resistant plates and incubated at 37°C for 20 h. Single colonies of transformants were picked and subjected to colony PCR using primers Δsfb5190-YF and Δsfb5190-YR. If the target band of 294 bp appeared, the next step of sequencing could be performed. The nucleotide sequence of the vector was determined by Sangon Biotech (Shanghai) Co., Ltd. Analysis of the sequencing results showed that if the sequence matched the design, the vector was successfully constructed and named pTHF-Cas9n-Δsfb5190. The sequences of the primers used for colony PCR are shown below:

[0076] Δsfb5190-YF:CTCGCGGGCTTCCACC

[0077] Δsfb5190-YR:GAGGAGGCCGGTGGAC

[0078] II. Construction of engineered strains of Streptomyces freundii

[0079] 1. Preparation of conjugation transfer intermediates: The constructed pTHF-Cas9n-Δsfb5190 plasmid was extracted from the host XL10-gold and then processed again using Ca... 2+ The plasmid was transformed into Escherichia coli ET12567 / pUZ8002 by transformation method. The obtained transformation products were plated on a plate with three antibiotics: apramycin, kanamycin, and chloramphenicol, and incubated at 37°C for 20 h. The resulting transformants do not need to be verified and can be used directly for subsequent experiments.

[0080] 2. Escherichia coli-Streptomyces conjugation transfer: The above conjugation transfer intermediate was transformed into Streptomyces freundii Sf01 (CN114703201A, CCTCC NO: M 2022111) via Escherichia coli-Streptomyces conjugation transfer.

[0081] The specific steps are as follows: Resuspend and centrifuge the Streptomyces spores twice with TES buffer at 5000 rpm for 5 min, then resuspend the washed spores in an appropriate amount of TES buffer and heat-shock them in a 50℃ water bath for 10 min; add an equal volume of germination medium to the TES buffer and place the spore suspension in a shaker at 30℃ and 110 rpm for 3 h for pre-germination; simultaneously, transfer Escherichia coli cultured in liquid for 20 h to a new liquid culture medium at a 10% inoculation rate and culture at 37℃ and 230 rpm for 3 h; wash the pre-germinated spores and E. coli cells twice with LB solution at 3000 rpm for 5 min; use 1 mL of TES buffer to resuspend the spores in a shaker at 3000 rpm for 5 min, then centrifuge again. LB resuspension of Streptomyces spores was mixed with Escherichia coli at a ratio of 20:1 to Streptomyces freundii Sf01. The mixed bacterial suspension was spread on SFMM plates and incubated at 30°C for 5–7 days until the transformants matured. 18–20 hours after the completion of conjugation transfer, apramycin and naphthylamine ketone acid were added to the culture medium.

[0082] The SFMM plate formulation is: 2% soybean meal, 2% mannitol, 2% agar, and MgCl2 with a final concentration of 25-30 mM.

[0083] 3. Positive clone screening: Transformants were selected and cultured on apramycin-resistant SFMC plates at 30°C for 5–7 days for single-colony amplification. Successfully amplified single colonies were selected for colony PCR using primers Δsfb5190-YF and Δsfb5190-YR. Simultaneously, the Sf01 genome was used as a control, and PCR was performed on the same single colonies. The obtained control band was 2137 bp.

[0084] A positive clone must contain both 2137bp and 294bp bands;

[0085] The SFMC solid culture medium formula is: 2% soybean meal, 2% mannitol, 2% agar, and a final concentration of 30-50 mM CaCl2.

[0086] 4. Induction of expression: Select the above positive clones into SFMC plates resistant to thiostreptomycin and apramycin, and incubate at 30℃ for 5-7 days to induce Cas9n expression; select the transformed cloning agents and perform colony PCR verification again, and select colonies containing only 294bp bands for the next step of the experiment.

[0087] The final concentration of the thiostreptomycin added was 25 μg / mL.

[0088] 5. Plasmid removal: Dilute the above colonies by streaking on SFMC plates and incubate at 42℃ for 5–7 days.

[0089] 6. Negative clone screening: Select the above colonies and inoculate them at the same position on SFMC plates without antibiotics and apramycin-resistant plates, respectively, and incubate at 30℃ for 5-7 days; select colonies that can only grow on the non-antibiotic plates and perform colony PCR verification again. The colonies with a 294bp band are the successfully edited Streptomyces freundii engineered strain; name this strain Sf01Δsfb5190.

[0090] III. Verification of Editing Results

[0091] Positive clones of *Streptomyces freundii* constructed as described in step 3 were selected and plated on SFMC plates resistant to thiotetracycline and apramycin, and incubated at 30°C for 5–7 days. All transformed strains were collected using 10 mL ddH2O, and the bacterial suspension was diluted 10⁻⁶ times. 7 The diluted bacterial suspension was spread onto SFMC plates and incubated at 30°C for 5–7 days. The single colonies that grew were counted, and single colonies were selected for PCR verification. The editing efficiency was calculated as (number of positive transformants / total number of transformants) × 100%.

[0092] The PCR verification primers were Δsfb5190-YF / Δsfb5190-YR.

[0093] The remaining editing plasmids were constructed using the same method described above, and the resulting editing plasmids were named as follows: pTHF-Cas9n-2-Δsfb5190, pEHF-Cas9n-Δsfb5190, pEHF-Cas9n-2-Δsfb5190, pFHF-Cas9n-Δsfb5190, pFHF-Cas9n-2-Δsfb5190, pMHF-Cas9n-Δsfb5190, and pMHF-Cas9n-2-Δsfb5190, respectively. The engineered strain Sf01Δsfb5190 was then constructed using the same method, and its editing efficiency was calculated.

[0094] The editing results and editing efficiency are shown in the table below:

[0095]

[0096] The results showed that the sfb5190 knockout plasmid pTHF-Cas9n-Δsfb5190 constructed based on the vector pTHF-Cas9n described in this invention achieved an editing efficiency of up to 100% for Streptomyces freundii Sf01; the editing effect of other vectors was not significantly correlated with the strength of the promoter used, and their efficiency was much lower than that of the pTHF-Cas9n-mediated editing plasmid.

[0097] The *Streptomyces freundii* described in this invention is not limited to *Streptomyces freundii* Sf01; it can also be wild-type *Streptomyces freundii* screened from nature, or artificially modified *Streptomyces freundii*.

[0098] The sfb5190 gene and its upstream and downstream gene sequences described in this invention are published in the gene bank of the National Center for Biotechnology Information (NCBI). Methods for obtaining the sfb5190 gene and its upstream and downstream gene sequences include, but are not limited to, PCR amplification using the genomic DNA of *Streptomyces f. f. 1* as a template, or artificial synthesis. Of course, theoretically, the sfb5190 gene and its upstream and downstream gene sequences can be obtained from any other microorganism containing the aforementioned gene. Different strains may have slight differences in individual bases in their nucleotide sequences, but theoretically they possess essentially the same function.

Claims

1. A CRISPR / Cas9n high-efficiency editing vector pTHF-Cas9n suitable for Streptomyces freundii, the vector sequence of which is shown in SEQ ID NO.

1.

2. The application of the editing vector pTHF-Cas9n as described in claim 1 in gene editing of engineered strains of Streptomyces freundii.

3. The application according to claim 2, characterized in that: During application, the size of the repair homology arm of the target gene to be edited is adjusted according to the size of the target gene, specifically as follows: The target gene is less than or equal to 10 kb, and the size of the repaired homologous arm is 1~1.5 kb; The target gene is larger than 10 kb, and the repair homologous arm size is 1.5~2 kb.

4. The application according to claim 2, characterized in that: When inducing Cas9n protein expression during application, the final concentration of thiostreptin added to the solid culture medium is 20-30 μg / mL.

5. The application according to claim 4, characterized in that, The final concentration of the thiostreptomycin is 25 μg / mL.

Citation Information

Patent Citations

  • Vitreoscilla hemoglobin expression cassette suitable for streptomyces fradiae and application thereof

    CN114703201A