Langerhans' histiocytosis prognostic test kit

Abstract

The present application belongs to the field of gene detection technology, and specifically provides a prognosis detection kit, method and application of Langerhans' histiocytosis. The present application is achieved by detecting BRAF gene mutation through high-depth targeted sequencing, and has the advantages of deep sequencing depth, high sensitivity, strong specificity and good accuracy, and is also simpler and more applicable in clinical operation.

Description

Technical Field

[0001] The present application belongs to the field of gene detection technology, and specifically relates to a prognostic sequencing detection kit for Langerhans' histiocytosis and its application. Background Art

[0002] BRAF gene mutation is an important driver mutation for Langerhans histiocytosis (LCH). The BRAF mutation sites and types in LCH are diverse, including missense mutations, insertion / deletion mutations, splicing mutations or kinase fusions, etc. The mutation sites are dispersed, and the frequency of some mutations is low.

[0003] BRAF-V600E mutation is present in the lesion tissues of about 50% of LCH patients (Badalian-Very et al., Blood 2010, 116(11):1919-1923.), and other activating point mutations in BRAF exon 15 such as BRAF-V600D have been found in some LCH (Kansal et al., Genes Chromosomes Cancer 2013, 52(1):99-106.). In approximately 6% of LCH patients, BRAF in-frame deletion mutations such as L485_P490delinsF, N486_P490del, and N486_T491delinsK were also found, located in the β3-αC loop region of the kinase domain encoded in exon 12. Cells with deletion mutations showed constitutive activation of the MAPK pathway and resistance to first-generation BRAF inhibitors (Chakraborty et al., 2016, 128(21):2533-2537). Heritier et al. also found a functionally activated BRAF splicing mutation R506_K507insLLR in LCH, located in the N-terminus of the BRAF kinase domain encoded in exon 12 of BRAF (Heritier et al., Mol Cancer 2017, 16(1):115-119). Although these mutations are known to exist in LCH patient lesions, it is not entirely clear whether they are also applicable to the prognostic evaluation of LCH patients.

[0004] Existing technologies for detecting BRAF gene mutations mostly use digital PCR, fluorescent quantitative PCR, first-generation sequencing, and whole exome sequencing. However, these methods all have certain shortcomings: the limitation of digital PCR and fluorescent quantitative PCR is that they are only applicable to quantitative analysis of known single mutation sites. Considering the diversity of BRAF gene mutation sites and types in LCH, it is necessary to customize specific primers and probes for each mutation, which greatly increases the detection cost and has high technical requirements for primer and probe design. Some mutation sites are not suitable for quantitative PCR analysis and cannot meet the high sensitivity requirements of detection; first-generation sequencing has low sensitivity and low throughput, and is not suitable for detecting low-frequency gene mutations in patients during diagnosis and treatment; whole exome sequencing has a complex process, too high detection costs, and insufficient specificity.

[0005] It can be seen that in practice, when it is necessary to perform sequencing evaluation on the prognosis of LCH disease, not only very strict requirements are imposed on the detection means, the sequencing depth needs to be deep enough to meet the detection requirements, but also high-standard output of detection specificity and sensitivity is required to avoid clinical false positive and false negative misjudgments. In view of this, the present application is proposed. Summary of the invention

[0006] Taking into account the large number of BRAF mutation sites in LCH, the diverse types and the existence of low-frequency mutations, this application uses high-depth targeted capture sequencing for the first time to detect BRAF gene mutations in the diagnosis and treatment of LCH patients. This method can better judge the patient's treatment response, disease progression and recurrence risk.

[0007] Therefore, this application includes at least the following objectives:

[0008] The first objective of the present application is to seek a highly specific and highly sensitive detection method for the prognosis assessment of Langerhans' histiocytosis.

[0009] The second objective of this application is to seek a high-depth targeted sequencing kit suitable for Langerhans' histiocytosis.

[0010] The third objective of this application is to seek the application of high-depth targeted sequencing in the detection of BRAF mutations in Langerhans' histiocytosis.

[0011] In order to achieve the above objectives, this application specifically provides the following technical solutions:

[0012] This application first provides a method for constructing a high-depth targeted sequencing library, comprising the following steps:

[0013] 1) Obtain cfDNA samples from blood;

[0014] 2) One round of PCR amplification of BRAF hotspot mutation regions in cfDNA;

[0015] 3) Second round of PCR amplification and library construction.

[0016] Further, in step 2), the BRAF hotspot mutation regions include: chr7:140477777-140477885, chr7:140477763-140477832 and chr7:140453113-140453220.

[0017] Further, in step 2), the one round of PCR amplification is achieved by high-depth targeted amplicon primer PCR amplification;

[0018] Further, the amplicon primer sequence includes the following:

[0019] Primer pair 1:

[0020] F: CCCTACACGACCTCTTCCGATCTTCACACAAGCTCACCTGAGT (SEQ ID NO. 1);

[0021] R:GTTCAGACGTGTGCTCTTCCGATCTTGCCTTTTAGGTGATGTGGCA (SEQ ID NO. 2);

[0022] Primer pair 2:

[0023] F:CCCTACACGACGCTCTTCCGATCTCCTCAGCAGTTACAAGCCTTCA (SEQ ID NO.3);

[0024] R:GTTCAGACGTGTGCTCTTCCGATCTCTCTGGAAAAGAGTAATTCACACAA (SEQ ID NO.4);

[0025] Primer pair 3:

[0026] F:CCCTACACGACGCTCTTCCGATCTGGGACCCACTCCATCGAGAT(SEQ ID NO.5);

[0027] R: GTTCAGACGTGTGCTCTTCCGATCTTGTTTTCCTTTACTTACTACACCTCA (SEQ ID NO. 6).

[0028] Preferably, step 2) specifically includes the following steps: adding primers to the cfDNA sample for synthesis and then diluting with enzyme-free water; adding amplification enzyme mixture, equal volumes of forward and reverse primers, and cfDNA or gDNA, mixing and then performing PCR amplification;

[0029] Further preferably, the PCR amplification program is as follows: 98°C for 3 min; 98°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min; 4°C Hold. Subsequently, the PCR product is purified by adding an equal volume of DNA purification magnetic beads.

[0030] Further, step 3) is a Barcode secondary amplification step, comprising the following steps: adding PCR amplification enzyme mixture and double-end Barcode to the purified product, mixing and then performing PCR amplification. The Barcode sequence is P7: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC; P5: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT; wherein NNNNNNNN is 8 fixed bases.

[0031] Further preferably, the PCR amplification program is: 98°C for 3 min; 98°C for 30 s, 60°C for 30 s, 72°C for 30 s, 20 cycles; 72°C for 10 min; 4°C Hold. The PCR product is then purified to obtain an NGS library; the obtained library is quality checked using qubit.

[0032] The present application also provides a method for evaluating the prognosis of Langerhans' histiocytosis, which includes the aforementioned steps and further includes the steps of on-machine sequencing of the library and off-machine data bioinformatics analysis, and the prognosis of Langerhans' histiocytosis is evaluated based on the mutation frequency results obtained by the bioinformatics analysis.

[0033] The present application also provides an amplicon primer set suitable for high-depth targeted sequencing, which can prepare a high-depth targeted enrichment sequencing library for use in prognosis detection of Langerhans' histiocytosis.

[0034] Furthermore, the amplicon primers target the hotspot mutation region of the BRAF gene;

[0035] Furthermore, the BRAF hotspot mutation regions include: chr7:140477777-140477885, chr7:140477763-140477832 and chr7:140453113-140453220.

[0036] Further, the amplicon primer sequence includes the following:

[0037] Primer pair 1:

[0038] F:CCCTACACGACCGCTTCCGATCTTCACACAAGCTCACCTGAGT (SEQ ID NO. 1);

[0039] R:GTTCAGACGTGTGCTCTTCCGATCTTGCCTTTTAGGTGATGTGGCA (SEQ ID NO. 2);

[0040] Primer pair 2:

[0041] F:CCCTACACGACGCTCTTCCGATCTCCTCAGCAGTTACAAGCCTTCA (SEQ ID NO.3);

[0042] R:GTTCAGACGTGTGCTCTTCCGATCTCTCTGGAAAAGAGTAATTCACACAA (SEQ ID NO.4);

[0043] Primer pair 3:

[0044] F:CCCTACACGACGCTCTTCCGATCTGGGACCCACTCCATCGAGAT(SEQ ID NO.5);

[0045] R: GTTCAGACGTGTGCTCTTCCGATCTTGTTTTCCTTTACTTACTACACCTCA (SEQ ID NO. 6).

[0046] The present application also provides an amplicon targeted sequencing product for prognosis detection of Langerhans' histiocytosis, comprising any of the aforementioned primer sets;

[0047] Furthermore, the product is a kit; preferably, the kit is a library construction kit or a sequencing kit.

[0048] Furthermore, the kit also includes components such as conventional amplification reagents or sequencing reagents.

[0049] The present application also provides the use of any of the aforementioned primer sets in the prognosis detection of Langerhans' histiocytosis.

[0050] Furthermore, the primer set is used for targeted amplification and then combined with high-depth sequencing to achieve it.

[0051] Compared with the prior art, this application has at least the following advantages:

[0052] The standard for disease prognosis gene assessment is higher than that required in the disease diagnosis process. It not only requires sufficient sequencing depth to meet the requirements of low-abundance detection, but also needs to meet high standards of specificity and sensitivity to avoid false positives and false negatives in clinical testing. Therefore, sample processing and library construction in the early stage of sequencing become key.

[0053] This application is based on the analysis of the distribution, mutation type and mutation frequency of BRAF gene mutations in LCH, determines the targeted amplification region, and accordingly designs and screens specific efficient amplicon primers, thereby establishing a BRAF high-depth targeted sequencing system based on amplicon targeted sequencing, which can effectively cover the mutation hotspots and potential target regions of exons 12 and 15 of the BRAF gene, and the specific primer combination can effectively enrich the targeted region, ensure the library construction efficiency and sequencing depth, and the maximum sequencing depth can reach 1,000,000×. This application can accurately detect insertions, deletions, single nucleotide variations, etc. in the target region of the gene at one time, and has the advantages of sensitivity, rapidity, efficiency and high throughput. Moreover, this application has confirmed the effectiveness and accuracy of the system through clinical testing, and is very suitable for large-scale clinical promotion and use. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] In order to more clearly illustrate the specific implementation methods of the present application or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0055] Figure 1 , monitoring results of BRAF gene mutation levels in plasma cfDNA during treatment and follow-up of case LCH-22.

[0056] Figure 2 , monitoring results of BRAF gene mutation levels in plasma cfDNA during treatment and follow-up of case LCH-23. DETAILED DESCRIPTION

[0057] The technical solution of the present application will be described clearly and completely below in conjunction with the accompanying drawings. Obviously, the described embodiments are part of the embodiments of the present application, rather than all of the embodiments. Based on the embodiments in the present application, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present application.

[0058] Definition of some terms

[0059] Unless otherwise defined below, the meaning of all technical terms and scientific terms used in the specific embodiments of the present application is intended to be the same as those generally understood by those skilled in the art. Although it is believed that the following terms are well understood by those skilled in the art, the following definitions are still set forth to better explain the present application.

[0060] As used in this application, an indefinite or definite article used when referring to a singular noun eg "a" or "an", "the" includes a plural of that noun.

[0061] As used in this application, the terms "comprises", "comprising", "having", "containing" or "involving" are inclusive or open-ended and do not exclude other unrecited elements or method steps. The term "consisting of" is considered a preferred embodiment of the term "comprising". If a group is defined below as comprising at least a certain number of embodiments, this should also be understood to disclose a group that preferably consists of only these embodiments.

[0062] The term "approximately" in this application indicates an accuracy range that can be understood by those skilled in the art and still ensures the technical effect of the characteristic in question. The term generally indicates ±10%, preferably ±5%, of the indicated value.

[0063] In addition, the terms first, second, third, (a), (b), (c), and the like in the specification and claims are used to distinguish similar elements and are not necessarily required to describe a sequential or chronological order. It should be understood that the terms so used are interchangeable under appropriate circumstances, and the embodiments described in this application can be implemented in other sequences than those described or illustrated in this application.

[0064] The method for constructing a high-depth targeted sequencing library in this article is a method that includes the following basic steps:

[0065] 1) Obtaining cfDNA samples; 2) One round of PCR amplification of the BRAF hotspot mutation region in cfDNA; 3) Two rounds of PCR amplification and library construction.

[0066] It is understandable that the cfDNA samples can be obtained by any conventional acquisition method in the art without limitation. After acquisition, they can be used in subsequent experiments after undergoing conventional quality inspection in the art.

[0067] In some specific embodiments, the acquisition includes the following steps: collecting peripheral blood and obtaining plasma after centrifugation; extracting free cfDNA based on a commercial kit and using Qubit quality inspection for later use.

[0068] Step 2) is the key to this application. The applicant designed and optimized high-depth targeted amplicon primers through preliminary experiments, and PCR amplified the obtained cfDNA samples through primers to achieve effective enrichment of specific regions. The sequence enrichment of this application has good specificity, high amplification efficiency and can meet the needs of subsequent sequencing prognosis evaluation.

[0069] Therefore, in some embodiments, in step 2), the one round of PCR amplification is achieved by high-depth targeted amplicon primer PCR amplification;

[0070] In some embodiments, the BRAF hotspot mutation regions described in the present application include: chr7:140477777-140477885, chr7:140477763-140477832 and chr7:140453113-140453220 regions.

[0071] In some embodiments, the amplicon primer sequence comprises the following:

[0072] Primer pair 1:

[0073] F:CCCTACACGACCGCTTCCGATCTTCACACAAGCTCACCTGAGT (SEQ ID NO. 1);

[0074] R:GTTCAGACGTGTGCTCTTCCGATCTTGCCTTTTAGGTGATGTGGCA (SEQ ID NO. 2);

[0075] Primer pair 2:

[0076] F:CCCTACACGACGCTCTTCCGATCTCCTCAGCAGTTACAAGCCTTCA (SEQ ID NO.3);

[0077] R:GTTCAGACGTGTGCTCTTCCGATCTCTCTGGAAAAGAGTAATTCACACAA (SEQ ID NO.4);

[0078] Primer pair 3:

[0079] F:CCCTACACGACGCTCTTCCGATCTGGGACCCACTCCATCGAGAT(SEQ ID NO.5);

[0080] R: GTTCAGACGTGTGCTCTTCCGATCTTGTTTTCCTTTACTTACTACACCTCA (SEQ ID NO. 6).

[0081] In some specific embodiments, step 2) specifically includes the following steps: adding primers to the cfDNA sample for synthesis and then diluting with enzyme-free water; adding amplification enzyme mixture, equal volumes of forward and reverse primers, and cfDNA or gDNA, mixing and then performing PCR amplification;

[0082] In some more specific embodiments, the PCR amplification program is as follows: 98°C for 3 min; 98°C for 30 s, 60°C for 30 s, 72°C for 30 s, 30 cycles; 72°C for 10 min; 4°C Hold. Subsequently, the PCR product is purified by adding an equal volume of DNA purification magnetic beads.

[0083] Step 3) is a Barcode secondary amplification step, which in some specific embodiments includes the following steps: adding PCR amplification enzyme mixture and double-end Barcode to the purified product, mixing and then performing PCR amplification. The Barcode sequence is P7: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC; P5: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT; wherein NNNNNNNN is 8 fixed bases.

[0084] In some more specific embodiments, the PCR amplification program is: 98°C for 3 min; 98°C for 30 s, 60°C for 30 s, 72°C for 30 s, 20 cycles; 72°C for 10 min; 4°C Hold. The PCR product is then purified to obtain an NGS library; the obtained library is quality checked using qubit.

[0085] The present application also includes a method for evaluating the prognosis of Langerhans' histiocytosis. The method is based on the aforementioned steps and further includes the steps of on-machine sequencing of the library and off-machine bioinformatics analysis of the data, and the prognosis of Langerhans' histiocytosis is evaluated based on the mutation frequency results obtained by the bioinformatics analysis.

[0086] As mentioned above, the amplicon primer set suitable for high-depth targeted sequencing of the present application is a set of high-depth targeted amplicon primers, which can prepare a high-depth targeted enriched sequencing library for use in the prognosis detection of Langerhans' histiocytosis.

[0087] In some embodiments, the amplicon primer is directed to the hotspot mutation region of the BRAF gene;

[0088] In some embodiments, the BRAF hotspot mutation region includes: chr7:140477777-140477885, chr7:140477763-140477832 and chr7:140453113-140453220.

[0089] Furthermore, the amplicon primer sequence includes the following:

[0090] Primer pair 1:

[0091] F: CCCTACACGACCTCTTCCGATCTTCACACAAGCTCACCTGAGT (SEQ ID NO. 1);

[0092] R:GTTCAGACGTGTGCTCTTCCGATCTTGCCTTTTAGGTGATGTGGCA (SEQ ID NO. 2);

[0093] Primer pair 2:

[0094] F:CCCTACACGACGCTCTTCCGATCTCCTCAGCAGTTACAAGCCTTCA (SEQ ID NO.3);

[0095] R:GTTCAGACGTGTGCTCTTCCGATCTCTCTGGAAAAGAGTAATTCACACAA (SEQ ID NO.4);

[0096] Primer pair 3:

[0097] F:CCCTACACGACGCTCTTCCGATCTGGGACCCACTCCATCGAGAT(SEQ ID NO.5);

[0098] R: GTTCAGACGTGTGCTCTTCCGATCTTGTTTTCCTTTACTTACTACACCTCA (SEQ ID NO. 6).

[0099] The present application also provides an amplicon targeted sequencing product for prognosis detection of Langerhans' histiocytosis, which is a product comprising any of the aforementioned primer sets.

[0100] In some embodiments, the product is a kit.

[0101] It is understood that the kit of the present application can be a preliminary targeted enrichment kit, or a library construction kit including a targeted enrichment function, and the library construction kit further includes the basic components of the second round of PCR, such as amplification enzymes, Barcoded, etc. Of course, the kit of the present application can be the entire post-rain assessment kit, so the kit can also include components such as sequencing reagents, which are not limited here.

[0102] Based on the above understanding of the content of this application, it can be undoubtedly confirmed that the primer set of this application is used in the prognosis detection of Langerhans' histiocytosis, and is used in the preparation of a Langerhans' histiocytosis prognosis detection kit.

[0103] The above terms or definitions are provided only to help understand the present application. These definitions should not be construed as having a scope less than that understood by those skilled in the art.

[0104] Example 1. Amplicon screening and design

[0105] Amplicon screening: This application is based on all BRAF sequences in Genebank, including various mutation sequences. Through comparative analysis, the BRAF gene mutations in LCH are mainly concentrated in exons 12 and 15. The in-frame deletion mutations in exon 12 include L485_P490delinsF, N486_P490del, N486_T491delinsK, and V487_T491del. There is also a splicing mutation R506_K507insLLR. In addition to the BRAF-V600E mutation, there are also V600D, K601Q, and V600delinsDATV mutations in exon 15.

[0106] At the same time, this application also discovered for the first time mutation sites such as BRAFT599_V600insEIAT and D594N on the BRAF gene in the gene mutation screening of lesion tissues of children with LCH. These known and new sites are crucial for the comprehensiveness and accuracy of prognostic evaluation.

[0107] In addition, in order to improve the efficiency of clinical application, the primer pairs designed and used in this application should cover as long a genomic DNA region as possible. Therefore, under the premise of meeting the amplification efficiency and sensitivity, the amplicon region should be expanded as much as possible and the primer pairs should be reduced.

[0108] Based on the above considerations and combined with the preliminary experimental system evaluation, this application finally screened and determined the BRAF target regions on chromosomes chr7:140477777-140477885, chr7:140477763-140477832 and chr7:140453113-140453220 for targeted enrichment for subsequent library construction and sequencing.

[0109] Example 2: Design, screening and sequence optimization of high-depth targeting primers

[0110] 1. Primer Design

[0111] For the aforementioned determined amplicon regions chr7:140477777-140477885, chr7:140477760-140477834 and chr7:140453113-140453220, this embodiment extends the upstream and downstream of the selected sites by 100 bp respectively, and then downloads the corresponding sequences from databases such as NCBI or UCSC, and designs primers after downloading sequence analysis:

[0112] 1. The preliminary design of primers must at least meet the following requirements:

[0113] 1) Primer length is 18-30bp;

[0114] 2) GC content is 40-60%;

[0115] 3) The primer cannot have more than 4 consecutive repeated bases;

[0116] 4) There should not be more than 5 reverse complements between primers;

[0117] 5) The primer annealing temperature should be controlled between 55-65°C, and the difference between the two primers should not be too large;

[0118] 6) Primer specificity was evaluated by NCBI Blast to ensure that the primers would not amplify other regions;

[0119] 7) Primers do not form primer dimers, hairpin structures, etc.;

[0120] 2. To reduce the pressure of the multiple targeting system, the use of primer pairs should be minimized, and a pair of targeted primers should preferably cover a mutation hotspot region of the BRAF gene. In addition, such a pair of targeted primers should also cover all possible mutations in all amplicon regions, especially in the boundary region of the amplicon (corresponding to the primer sequence part), to ensure the compatibility of various mutations, and avoid the loss of individual sequences during the enrichment process due to individual mutations.

[0121] 3. Other considerations

[0122] Using blood as a test specimen has the advantages of minimally invasive and repeated sampling, overcoming the disadvantages of difficulty in sampling lesion tissues and spatial heterogeneity of the disease in LCH patients, and is more conducive to tracking and monitoring the development of the disease and the treatment process. Free nucleic acids (cfDNA) in plasma carry genetic variations from tumor cells and can be used as an important indicator for tumor screening, companion diagnosis, efficacy evaluation, and prognostic risk stratification. Accurately obtaining the proportion of mutant and wild-type at specific sites in cfDNA, that is, the variant allele frequency (VAF), can measure the level of circulating tumor DNA. Considering the above, plasma cfDNA samples from LCH patients were selected for dynamic monitoring of LCH-specific BRAF gene mutations. The cfDNA in plasma comes from DNA released after cell damage and rupture, which is cleaved into fragments of about 160nt by nucleases, so the fragment size amplified by the targeted primers in this application should be controlled within 160bp.

[0123] Based on the above principles and considerations for primer design, the applicant preliminarily designed the following sets of primers (see Table 1):

[0124] Table 1. Primer combinations and sequences designed in the early stage

[0125]

[0126]

[0127] 2. Evaluation and screening of primer sequences

[0128] In view of the extremely high requirements for sensitivity or sensitivity in the application scenario of prognosis evaluation, the applicant synthesized the above-designed primers and diluted them to a low concentration of 10 μM respectively. After extracting plasma cfDNA, the primers were mixed according to the above combination. After PCR amplification and sequencing, each set of primers was analyzed with similar data volume (200M), and the proportion of reads in the target area of ​​each set of primers was compared.

[0129] The evaluation results are shown in Table 2. Among all the designed primer pairs, primer pair 1-combination 3, primer pair 2-combination 1, and primer pair 3-combination 4 had the highest proportion of target region reads after sequencing evaluation, which were 98.45%, 97.82%, and 95.68%, respectively, and their advantages were very obvious compared with other groups.

[0130] Table 2. Statistics of read proportions in the target region of sequencing evaluation primers

[0131]

[0132] Based on the results, the optimal primer sequence pairs for high-depth targeted sequencing used for prognosis evaluation of this application were finally screened and determined as shown in Table 3 below.

[0133] Table 3. Determined targeted amplicon primer sets

[0134]

[0135] Example 3. Kit preparation and method establishment

[0136] The basic box of the present application is a targeted enrichment kit, and the specific preparation method is to include the aforementioned targeted primers together with basic PCR amplification reagents (including PCR amplification enzyme mixture, enzyme-free water, etc.) into the kit; in addition, the kit may further include purification components, such as purified magnetic beads. In order to ensure that low-frequency gene mutations in patients can be detected quantitatively with high sensitivity during the detection and treatment process and follow-up, two rounds of PCR amplification and library construction are required during the entire detection process of the present application, followed by sequencing analysis. Therefore, in addition to the aforementioned targeted enrichment components, the kit of the present application may further include components for the second round of amplification, including PCR amplification enzymes and Barcodes.

[0137] The specific detection method of this application is as follows:

[0138] 1) Nucleic acid preparation: peripheral blood was collected and plasma was obtained after centrifugation; free cfDNA was extracted based on a commercial kit and then used for quality inspection by Qubit.

[0139] 2) One round of PCR amplification: add primers to the cfDNA sample for synthesis and dilute to 10 μM with enzyme-free water; add 25 μL PCR amplification enzyme mixture, 0.5 μL F primer, 0.5 μL R primer, 24 μL cfDNA or 500 ng gDNA (total system 50 μL) to the PCR tube, pipette and mix well, and then perform PCR amplification; PCR amplification program: 98°C 3 min; 98°C 30 s, 60°C 30 s, 72°C 30 s, 30 cycles; 72°C 10 min; 4°C Hold; then, add an equal volume of DNA purification magnetic beads to the PCR product for purification.

[0140] 3) Second round of PCR amplification: Add 25 μL PCR amplification enzyme mixture and 5 μL double-end Barcode to the purified product, pipette and mix well, and then perform PCR amplification. The Barcode sequence is P7: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTTCCGATC; P5: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT; where NNNNNNNN are 8 fixed bases. The PCR amplification program is: 98℃3min; 98℃30s, 60℃30s, 72℃30s, 20 cycles; 72℃10min; 4℃Hold. Then PCR product purification is performed to obtain NGS library; the obtained library is quality checked using qubit.

[0141] 4) High-throughput sequencing and bioinformatics analysis: The obtained library is sequenced on an Illumina sequencer, and the data is interpreted through bioinformatics analysis.

[0142] Example 4: Sensitivity evaluation

[0143] At present, in addition to the BRAF-V600E mutation, there is a lack of cfDNA standards with known BARF mutation frequencies. The applicant used gDNA samples from LCH patient lesion tissues, which have been used to determine the BRAF mutation frequency based on high-throughput sequencing results. The applicant used gDNA samples from healthy people with known negative mutations as negative controls, and used healthy people's gDNA to grade dilute the gDNA samples of LCH patients to obtain standards with different mutation frequencies, which were tested after library construction to determine the sensitivity of the sequencing method.

[0144] The specific evaluation includes the following aspects:

[0145] 1) For primer pair 1 (chr7:140477777-140477885)

[0146] The gDNA samples of lesion tissues of LCH patients with known BRAF N486_P490del mutation were selected as standards, and the mutation frequency was 5.66% by high-throughput sequencing. The gDNA samples of normal people with known negative mutations were used as negative controls. The patient gDNA was diluted in sequence according to the mutation frequencies of 1%, 0.5%, 0.1%, 0.09%, and 0.08%, and the library was sequenced. The concentrations of 0.1%, 0.09%, and 0.08% were repeated ten times each.

[0147] The sequencing analysis results data show (see Table 3 for details): First, the sequencing depth of this application can reach more than 100,000×, and the highest is more than 1,000,000×; secondly, the lowest limit of quantification (LLoQ) of this application is 0.09% (10 repeats, detection rate 100%), and the lowest limit of detection (LoD) is 0.08% (10 repeats, detection rate 60%).

[0148] Table 3. Sensitivity evaluation results for chr7:140477777-140477885

[0149]

[0150]

[0151]

[0152] 2) For primer pair 2 (chr7:140477763-140477832)

[0153] Based on the same logic, gDNA samples of lesion tissues of LCH patients with known BRAF R506_K507insLLR mutation were selected as standards, and the mutation frequency was determined to be 4.64% by high-throughput sequencing. Normal human gDNA samples with known negative mutations were used as negative controls, and the patient gDNA was diluted in sequence according to the mutation frequencies of 1%, 0.5%, 0.1%, and 0.09%, and then the library was sequenced. 0.5%, 0.1%, and 0.09% were repeated ten times each.

[0154] The sequencing result data are shown in Table 4. The sequencing depth of this application can also reach more than 100,000×, the lowest limit of quantification (LLoQ) is 0.1% (10 repeats, detection rate 100%), and the lowest limit of detection (LoD) is 0.09% (10 repeats, detection rate 40%).

[0155] Table 4. Sensitivity evaluation results for chr7:140477763-140477832

[0156]

[0157]

[0158] 3) Primer pair 3 (chr7:140453113-140453220)

[0159] Similarly, gDNA samples of lesion tissues from patients with known BRAF-V600E mutation-positive LCH were selected as standards, and the mutation frequency was determined to be 12.6% by high-throughput sequencing. Normal human gDNA samples known to be mutation-negative were used as negative controls, and the patient gDNA was diluted in sequence according to mutation frequencies of 1%, 0.5%, 0.1%, 0.09%, 0.07%, 0.05%, 0.03%, and 0.01%, and the library was sequenced, with 0.1%-0.01% repeated ten times each.

[0160] According to the sequencing results data shown in Table 5, the sequencing depth generally reached more than 1,000,000×, the lowest limit of quantification (LLoQ) was 0.03% (repeated 10 times, detection rate 100%), and the lowest limit of detection (LoD) was 0.01% (repeated 10 times, detection rate 70%).

[0161] Table 5. Sensitivity evaluation results for chr7:140453113-140453220

[0162]

[0163]

[0164]

[0165]

[0166] Example 5. Correlation analysis between plasma BRAF gene mutation detection results and clinical treatment response and prognosis in LCH patients

[0167] From January 1, 2023 to March 31, 2024, the applicant used the above method to detect BRAF gene mutations in plasma free DNA (cfDNA) in a total of 18 children with LCH. Among them, there were 17 boys and 1 girl, with a median age of 5.58 years at diagnosis (range 0.17-11 years). Clinical classification showed: 7 cases (38.9%) in the single system involvement group (SS), 2 cases (38.9%) in the multi-system group without risk organ involvement (MS RO — ) 8 cases (44.4%), multiple system group with risk organ involvement (MS RO +) 3 cases (0.17%). The most common affected organ was bone (incidence 94.4%), followed by lymph node (16.7%), skin (16.7%), lung (11.1%), liver (11.1%), pituitary (5.6%), etc. All these children were diagnosed with LCH by biopsy pathological examination at the initial diagnosis, and BRAF gene mutations were detected in the lesion tissue by second-generation sequencing at the initial diagnosis. The specific mutation sites are shown in Table 6, including multiple deletion mutations such as L485_P490delinsF, N486_P490del, R506_K507insLLR on exon 12.

[0168] Table 6. BRAF mutations in lesion tissues of 15 children with LCH

[0169]

[0170] Among the 18 children, 12 had BRAF mutation levels in plasma cfDNA tested at diagnosis, 8 (66.7%) were positive, and the median positive mutation level was 0.136%, ranging from 0.009% to 1.165%. 16 patients had plasma BRAF mutation levels monitored during treatment and follow-up, of which 2 had significantly increased BRAF mutation levels at the time of disease recurrence or progression, and 1 had positive results 2 months before recurrence. The results of the two cases are as follows:

[0171] Case LCH-22 (see Figure 1 ): Boy, first diagnosed at age 8 years and 3 months, affected organs: multiple bones (thoracic vertebra 4, left scapula, left humerus, left humerus, thoracic vertebra 8). At the first diagnosis, the BRAF486_491del mutation was detected in the biopsy tissue gene mutation of the child, with a mutation ratio of 2.6%; at the same time, the BRAF mutation level in plasma cfDNA detected by the method of this application was 0.07%. After 5 weeks of first-line chemotherapy, the condition improved, and the plasma BRAF mutation turned negative; after 11 to 25 weeks of first-line chemotherapy, the condition was stable or improved, and the plasma BRAF mutation continued to be negative; after stopping the drug for 3 months, the condition was evaluated as stable, but the plasma BRAF mutation turned positive, with a level of 0.063%; after stopping the drug for 5 months, the disease relapsed, and the plasma BRAF mutation level increased significantly to 0.443%; after re-first-line chemotherapy, the condition was stable, and the plasma BRAF mutation turned negative.

[0172] Case LCH-23 (see Figure 2): A boy, first diagnosed at the age of 5 years and 10 months, the affected organs were evaluated as: lung, multiple bones (C3, C6, T1, T4, T8, T10, T12, L1, S1 vertebral body and accessories, bilateral temporal bones, right mastoid, left ilium, right scapula, sacrum, left 2nd rib, right 8th posterior rib). The BRAF 486_491del mutation was detected in the biopsy tissue gene mutation at the first diagnosis, with a mutation ratio of 6.29%; the condition improved after first-line chemotherapy, and the condition was evaluated as stable or improved after 3-6 months of drug withdrawal, and plasma BRAF mutation was negative; the disease relapsed after 1 year of drug withdrawal, and the plasma BRAF gene mutation level was significantly increased to 0.294%. After 3 months of targeted therapy with trametinib, the condition improved, and the plasma BRAF gene mutation turned negative; the condition improved after 6 months of targeted therapy, and the plasma BRAF gene mutation continued to be negative. The child is still receiving targeted therapy.

[0173] The above results indicate that the method of the present application can effectively detect the BRAF gene mutation level in the plasma cfDNA of LCH patients during targeted therapy or chemotherapy, and the detection results are closely related to the patient's treatment response and prognosis. In particular, patients with significantly elevated BRAF gene mutation levels should be alert to the progression or recurrence of the disease, and the method is suitable for clinical promotion and use.

[0174] Finally, it is noted that the above embodiments are only used to illustrate the technical solution of the present application, rather than to limit it. Although the present application has been described in detail with reference to the aforementioned embodiments, it should be understood in the art that the technical solutions described in the aforementioned embodiments can still be modified, or some or all of the technical features therein can be replaced by equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solution to deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A method for constructing a high-depth targeted sequencing library for prognostic detection of Langerhans' histiocytosis, characterized in that: The steps include: 1) Obtain cfDNA samples from blood; 2) One round of PCR amplification of BRAF hotspot mutation regions in cfDNA; 3) Second round of PCR amplification and library construction; In step 2), the one round of PCR amplification is achieved by high-depth targeted amplicon primer amplification; The amplicon primer sequences include the following: Primer pair 1: F:CCCTACACGACGCTCTTCCGATCTTCACACAAGCTCACCTGAGT; R:GTTCAGACGTGTGCTCTTCCGATCTTGCCTTTTAGGTGATGTGGCA; Primer pair 2: F:CCCTACACGACGCTCTTCCGATCTCCTCAGCAGTTACAAGCCTTCA; R:GTTCAGACGTGTGCTCTTCCGATCTCTCTGGAAAAGAGTAATTCACACAA; Primer pair 3: F:CCCTACACGACGCTCTTCCGATCTGGGACCCACTCCATCGAGAT; R:GTTCAGACGTGTGCTCTTCCGATCTTGTTTTCCTTTACTTACTACACCTCA.

2. An amplicon primer set suitable for high-depth targeted sequencing, characterized in that: The primer set can prepare a high-depth targeted enrichment sequencing library, which is used for prognosis detection of Langerhans' histiocytosis; the amplicon primer targets the hotspot mutation region of the BRAF gene; the amplicon primer sequence includes the following: Primer pair 1: F:CCCTACACGACGCTCTTCCGATCTTCACACAAGCTCACCTGAGT; R:GTTCAGACGTGTGCTCTTCCGATCTTGCCTTTTAGGTGATGTGGCA; Primer pair 2: F:CCCTACACGACGCTCTTCCGATCTCCTCAGCAGTTACAAGCCTTCA; R:GTTCAGACGTGTGCTCTTCCGATCTCTCTGGAAAAGAGTAATTCACACAA; Primer pair 3: F:CCCTACACGACGCTCTTCCGATCTGGGACCCACTCCATCGAGAT; R:GTTCAGACGTGTGCTCTTCCGATCTTGTTTTCCTTTACTTACTACACCTCA.

3. A product for prognosis detection of Langerhans' histiocytosis, characterized in that: The product comprises the amplicon primer set according to claim 2; the product is a kit.

Images