Early Markers of Animal Aging and Animal Models for Drug Screening

Abstract

The present invention relates to early markers of animal aging and animal models for drug screening. Specifically, the inventors of the present invention found that as adult nematodes age, the expression of fatty acid elongase ELO-6 continuously decreases; in the early stage of nematode aging, the expression levels of ELO-6 among individuals show differences, and the expression level is positively correlated with the lifespan and healthy lifespan of adult worms. Therefore, the lifespan and healthy lifespan of nematode individuals can be predicted by the expression level of ELO-6 at the early stage of aging. In addition, lifespan-extending intervention measures can enhance the expression stability of ELO-6 during the aging process, further verifying that ELO-6 can be used as a predictor of lifespan. Based on the prediction of nematode lifespan by the expression level of ELO-6, an animal model for drug screening was developed.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine, and particularly to early markers of animal aging and animal models for drug screening. Background Art

[0002] In experimental animals and humans, 60 - 90% of the lifespan differences are not related to genotypes. Invertebrate individuals with the same genotype also have individual lifespan differences in a homogeneous environment, indicating that neither genetic nor environmental factors can fully explain the differences in individual lifespan. A single reporter gene would be helpful for studying the random factors that lead to changes in individual lifespan, but so far, single reporter genes as biomarkers for individual aging are still rare. Transcriptome analysis of various organisms such as yeast, nematodes, fruit flies, mice, and humans has found that gene expression profiles change significantly during the aging process. These genes whose expression is regulated by aging are usually related to various biological processes associated with age-dependent physiological changes. Existing studies have shown that the gene transcription profile can be used as an aging clock for measuring age, and gene transcription changes can be used to discover aging biomarkers. Caenorhabditis elegans is a powerful model organism for studying individual lifespan differences, but the single reporter gene that can be used as a biomarker for individual aging in nematodes is still unknown.

[0003] Therefore, there is an urgent need in the art to develop single reporter genes that can predict individual lifespan and animal models constructed therefrom. Summary of the Invention

[0004] The object of the present invention is to provide a single reporter gene that can predict the lifespan of nematode individuals and an animal model constructed therefrom.

[0005] In the first aspect of the present invention, there is provided the use of a fatty acid elongase ELO-6 or a detection reagent thereof for preparing a detection kit for (a) evaluating the lifespan of an animal; and / or (b) evaluating the health status of an animal.

[0006] In another preferred embodiment, the detection reagent is selected from the group consisting of: a reagent for detecting the mRNA level of elo-6, a reagent for detecting the protein level of ELO-6, or a combination thereof.

[0007] In another preferred embodiment, the detection reagent comprises a reagent for directly or indirectly detecting the mRNA level of elo-6 and / or the protein level of ELO-6.

[0008] In another preferred embodiment, the detection reagent detects the level of a fusion protein of ELO-6-fluorescent protein.

[0009] In another preferred embodiment, the detection reagent detects the fluorescence level of a fusion protein of ELO-6-fluorescent protein.

[0010] In another preferred example, the expression level of ELO-6 is positively correlated with the lifespan and / or healthspan of the nematode.

[0011] In another preferred example, the animal is selected from the group consisting of nematodes and mammals.

[0012] In another preferred example, the animal is a nematode.

[0013] In another preferred example, the nematode is Caenorhabditis elegans.

[0014] In another preferred example, the lifespan includes the individual lifespan, population lifespan, and healthspan of the nematode.

[0015] In another preferred example, the healthspan refers to the healthy state of the nematode in the mid-to-late adulthood stage.

[0016] In another preferred example, the healthspan can be measured by the pharyngeal pumping movement frequency and / or the body bending movement frequency in the liquid of the nematode in the mid-to-late adulthood stage.

[0017] In another preferred example, the prediction is to predict the lifespan length at the early stage of nematode aging and / or to predict the healthy state of the nematode in the mid-to-late adulthood stage at the early stage of nematode aging.

[0018] In another preferred example, the early stage of nematode aging refers to the 4th to 9th day after adulthood.

[0019] In another preferred example, the method for detecting the protein level of ELO-6 includes: co-expressing a reporter gene with the elo-6 gene, and using the expression intensity of the reporter gene to indicate the protein level of ELO-6.

[0020] In another preferred example, the reporter gene is knocked into the 5'UTR region of the elo-6 gene by gene editing, so that the reporter gene is co-expressed with the ELO-6.

[0021] In another preferred example, the reporter gene is the green fluorescent protein (GFP) gene.

[0022] In another preferred example, the kit further includes one or more auxiliary detection reagents, and the auxiliary detection reagents are used to detect the expression level of genes selected from the group consisting of:

[0023] (Z1) pqm-1;

[0024] (Z2) smf-2;

[0025] (Z3) B0238.13;

[0026] (Z4) tag-151;

[0027] (Z5)E02H1.1;

[0028] (Z6)C16A3.6;

[0029] (Z7)B0511.6;

[0030] (Z8)T23D8.3.

[0031] In a second aspect of the present invention, there is provided a method for preparing an animal model that can be used to evaluate lifespan, the method comprising the steps:

[0032] By gene editing, introducing an exogenous marker gene to co-express the endogenous elo-6 gene in the animal with the exogenous marker gene, or using the promoter of the elo-6 gene to express the marker gene by transgenic methods, thereby obtaining the animal model,

[0033] wherein, in the animal, the expression level of the marker gene reflects the expression level of the elo-6 gene or the expression activity of the elo-6 promoter in the animal model;

[0034] and the animal is a nematode.

[0035] In another preferred example, the animal is Caenorhabditis elegans.

[0036] In another preferred example, the marker gene is a green fluorescent protein (GFP) gene.

[0037] In another preferred example, the marker gene optionally includes a tag sequence, such as a Flag tag.

[0038] In another preferred example, the method is to insert the GFP gene at the 5'-end of the elo-6 gene using the CRISPR / cas9 gene editing system.

[0039] In another preferred example, the method is to use transgenic methods to express the marker gene GFP with the promoter of the elo-6 gene.

[0040] In a third aspect of the present invention, there is provided a method for screening compounds, comprising the steps:

[0041] (a) Providing an animal model prepared by the method described in the second aspect of the present invention;

[0042] (b) In the test group, culture the animal model in the presence of the candidate compound and detect the expression level of the marker gene of the animal model, denoted as E1; in the blank control group, culture the animal model under the condition that the candidate compound is absent and other conditions are the same, and detect the expression level of the marker gene of the animal model in the blank control group, denoted as E0; wherein, the marker gene is a fluorescent gene and co-expresses with ELO-6; or the marker gene encodes a fusion protein, which is a fusion protein formed by the fusion of a fluorescent protein and ELO-6; or the marker gene is expressed by the elo-6 promoter;

[0043] (c) Compare E1 and E0 to determine whether the candidate compound is a potential compound that affects the lifespan of the animal;

[0044] Among them, when E1 increases significantly, it indicates that the candidate compound is a potential compound for extending lifespan; when E1 decreases significantly, it indicates that the candidate compound is a potential compound for shortening lifespan.

[0045] In another preferred example, when E1 / E0 ≥ 1.2, more preferably ≥ 1.5, and most preferably ≥ 2, then the candidate compound is a potential compound for extending lifespan; when E1 / E0 ≤ 0.9, more preferably ≤ 0.7, and most preferably ≤ 0.5, then the candidate compound is a potential compound for shortening lifespan.

[0046] In another preferred example, the animal model is a nematode model.

[0047] In another preferred example, the animal model is an isogenic model.

[0048] In another preferred example, the detection is performed in the early stage of nematode aging.

[0049] In another preferred example, the detection is performed on the 4th - 9th day of nematode adulthood.

[0050] In another preferred example, in step (b), it further includes: in the positive control group, culture the animal model in the presence of the positive compound and other conditions are the same as those in the test group, and detect the expression level of the marker gene of the animal model in the positive control group, denoted as E2;

[0051] And in step (c), it further includes: compare E1 and E2 to determine whether the candidate compound is a potential compound that affects the lifespan of the animal.

[0052] In another preferred example, the positive compound is selected from the group consisting of metformin and PQM-1 inhibitor.

[0053] In another preferred example, the method further includes:

[0054] (d) Further test the efficacy of the potential compound with extended lifespan.

[0055] In another preferred embodiment, the test includes in vitro cell tests and animal tests.

[0056] In the fourth aspect of the present invention, there is provided a use of a PQM-1 inhibitor for preparing a reagent for increasing the expression level of ELO-6.

[0057] In another preferred embodiment, the PQM-1 inhibitor is an RNAi reagent.

[0058] In the fifth aspect of the present invention, there is provided a method for predicting the lifespan of nematodes and / or evaluating the health status of nematodes, comprising the steps of:

[0059] (1) Provide an individual or population of nematodes;

[0060] (2) Determine the expression level of endogenous ELO-6 in the nematodes;

[0061] (3) Based on the expression level of ELO-6, give an evaluation result of the lifespan of the individual or population of nematodes and / or an evaluation result of the health status of the individual or population of nematodes;

[0062] Wherein, compared with the control nematodes, when the ELO-6 level rises significantly, it indicates that the lifespan of the individual or population of nematodes is longer, and / or the health status of the individual or population of nematodes is better;

[0063] While compared with the control nematodes, when the ELO-6 level drops significantly, it indicates that the lifespan of the individual or population of nematodes is shorter, and / or the health status of the individual or population of nematodes is worse.

[0064] In another preferred embodiment, the control nematodes are adult nematodes, preferably nematodes on the 4th, 5th, 6th, 7th, 8th, or 9th day.

[0065] In another preferred embodiment, in step (2), it further includes detecting the expression level of genes selected from the following group:

[0066] (Z1) pqm-1;

[0067] (Z2) smf-2;

[0068] (Z3) B0238.13;

[0069] (Z4) tag-151;

[0070] (Z5) E02H1.1;

[0071] (Z6) C16A3.6;

[0072] (Z7)B0511.6;

[0073] (Z8)T23D8.3.

[0074] It should be understood that within the scope of the present invention, the above-mentioned various technical features of the present invention and the technical features specifically described below (such as in the embodiments) can be combined with each other to form new or preferred technical solutions. Due to space limitations, they will not be elaborated one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1 It shows that the expression level of GFP::ELO-6 in the intestine continuously decreases during the aging process. Figure 1 A shows that the expression of GFP::ELO-6 in the intestine of the MTP27 nematode strain continuously decreases from the 3rd day to the 9th day of adulthood. Figure 1 B shows Figure 1 the quantitative results of the GFP signal of the image in A. Figure 1 C shows that the expression of GFP::ELO-6 in the intestine of the MTP29 nematode strain continuously decreases from the 3rd day to the 7th day of adulthood. Figure 1 D shows Figure 1 the quantitative results of the GFP signal of the image in C.

[0076] Figure 2 It shows that the expression difference of ELO-6 in young adults can predict the lifespan and healthspan of individuals in an isogenic population. Figure 2 A shows the expression of GFP in the nematodes of the GFPL, GFPM, and GFPH groups in the MTP27 strain. Figure 2 B shows the survival curves of the nematodes in the GFPL, GFPM, and GFPH groups. Figure 2 C shows the body movement bending frequencies of the nematodes in the GFPL, GFPM, and GFPH groups on the 6th, 7th, and 8th days. Figure 2 D shows the pharyngeal pumping movement frequencies of the nematodes in the GFPL, GFPM, and GFPH groups on the 7th and 8th days. Figure 2 E shows the survival curves of the nematodes in the GFP1, GFP2, GFP3, and GFP4 groups under the glp-4(bn2) background. Figure 2 F shows the survival curves of the nematodes in the GFP1, GFP2, GFP3, and GFP4 groups under the glp-1(e2141) background. Among them, the nematodes with the N2 background are divided into 3 groups according to the expression level of GFP::ELO-6 on the 5th day of adulthood, namely the low-expression group (GFPL), the medium-expression group (GFPM), and the high-expression group (GFPH); based on the level of GFP on the 5th day of adulthood, the isogenic nematodes are divided into the GFP1, GFP2, GFP3, and GFP4 groups from low to high. Figure 2G shows the expression levels of GFP expressed by the elo-6 promoter in transgenic nematodes on the 6th and 9th days of adulthood. Figure 2 H shows the survival curves of groups of transgenic nematodes GFPL, GFPM, and GFPH. Among them, transgenic nematodes were divided into 3 groups according to the expression level of GFP on the 6th day of adulthood, namely the low-expression group (GFPL), the medium-expression group (GFPM), and the high-expression group (GFPH).

[0077] Figure 3 Shows the predicted genetic factors of ELO-6 and the population lifespan regulated by metformin. Figure 3 A shows the effect of RNAi treatment on each group on the expression stability of ELO-6. Figure 3 B shows Figure 3 The quantitative results of the GFP signal of the images in A. Figure 3 C shows the effect of utx-1 and cyc-1 RNAi treatment on the expression stability of ELO-6 during aging. Figure 3 D shows Figure 3 The quantitative results of the GFP signal of the images in C. Figure 3 E shows that metformin treatment enhances the expression stability of ELO-6 during aging. Figure 3 F shows Figure 3 The quantitative results of the GFP signal of the images in E. Figure 3 G shows that metformin treatment extends lifespan.

[0078] Figure 4 Shows the effect of the expression level of ELO-6 and its product on lifespan. Figure 4 A shows that RNAi knockdown of elo-6 expression starting from the 2nd day of adulthood does not affect lifespan. Figure 4 B shows that RNAi knockdown of elo-6 expression starting from the 5th day of adulthood does not affect lifespan. Figure 4 C shows that supplementing C17iso starting from the 4th day of adulthood slightly extends the population lifespan. Figure 4 D shows that supplementing C17iso starting from the 6th day of adulthood does not change the lifespan of animals in the GFPL group.

[0079] Figure 5 Shows the results of transcriptome analysis of short-lived and long-lived individuals. Figure 5 A shows the MDS plot of the transcriptional profile distribution detected by mRNA-seq in animals of groups GFP1, GFP2, GFP3, and GFP4 under the glp-1(e2141) and glp-4(bn2) backgrounds. Figure 5Panel B shows a Venn diagram of genes with differential expression between GFP2 and GFP4 nematodes in the glp-1(e2141) or glp-4(bn2) background. Red: genes highly expressed in GFP2 in the glp-1(e2141) background; Green: genes lowly expressed in GFP2 in the glp-1(e2141) background; Magenta: genes highly expressed in GFP2 in the glp-4(bn2) background; Blue: genes lowly expressed in GFP2 in the glp-4(bn2) background. The number of genes in each group is shown in the Venn diagram. Figure 5 Panel C shows a motif analysis of genes that showed differential expression between GFP2 and GFP4 nematodes in both the glp-1(e2141) and glp-4(bn2) backgrounds. Results of motif analysis of the genomic regions around the TSS [-400, +100] of 65 high genes and 113 low genes in GFP2; TSS: transcription start site. Figure 5 Panel D shows a Venn diagram of the distribution of the PQM-1 / ELT-3 binding motif and the PQM-1 enrichment region among the genes with differential expression between GFP2 and GFP4; The number of genes in each group is shown in the figure.

[0080] Figure 6 It shows that pqm-1 promotes the differential expression of ELO-6 among middle-aged individuals and regulates healthspan. Figure 6 Panel A shows that pqm-1 RNAi treatment enhanced the homogeneity of the inter-individual expression of GFP::ELO-6 in MTP27 on the 6th day of adulthood. The RNAi treatment in this experiment started from the 3rd day of adulthood. There were 38 animals in both the control group and the pqm-1 RNAi group. Under the control RNAi (L4440) treatment, the GFP signal was absent in the partial intestine of 7 nematodes; while under the pqm-1 RNAi treatment, the GFP signal was absent in the partial intestine of only 1 nematode. The yellow signal in the figure is autofluorescence. Figure 6 Panel B shows that the body bending movement frequency of pqm-1 RNAi-treated animals on the 6th day and the 8th day of adulthood was significantly higher than that of the control group. The RNAi treatment started from the 2nd day of adulthood. Figure 6 Panel C shows that the pharyngeal pumping movement frequency of pqm-1 RNAi animals on the 7th day and the 9th day of adulthood was significantly higher than that of the control group. The RNAi treatment started from the 2nd day of adulthood. Figure 6 Panel D shows a comparison of pqm-1 RNAi treatment with the gene expression differences between GFP2 and GFP4 using a Venn diagram. Red: genes with increased expression after pqm-1 RNAi treatment; Green: genes with decreased expression after pqm-1 RNAi treatment; Magenta: genes highly expressed in GFP2; Cyan: genes lowly expressed in GFP2. The number of genes in each group is shown in the figure.

[0081] Figure 7It is shown that knocking down highly expressed genes in short-lived individuals by RNAi can enhance the expression stability of ELO-6 during aging and extend lifespan. Figure 7 A shows that knocking down tag-151 and B0238.13 by RNAi starting from the second day of adulthood can enhance the expression homogeneity of ELO-6 among individuals on the sixth day of adulthood. Figure 7 B and Figure 7 D show that knocking down highly expressed genes in short-lived individuals by RNAi starting from the second day of adulthood enhances the expression stability of ELO-6, and this effect can be observed until the eighth day of adulthood. Figure 7 C and Figure 7 E respectively show Figure 7 B and Figure 7 the quantitative results of the GFP signals in the images in D. Figure 7 E shows that knocking down highly expressed genes in short-lived individuals by RNAi extends the lifespan of C. elegans.

[0082] Figure 8 Genome-wide correlation analysis of mRNA-seq data is shown. The darker the color, the higher the correlation; where, rep represents replication. Detailed implementation manners

[0083] Through extensive and in-depth research, the present inventors unexpectedly found that the expression level of fatty acid elongase ELO-6 during aging can dynamically predict the lifespan of individuals in a population. Therefore, ELO-6 can be used as a marker or predictor for evaluating lifespan. Specifically, the present inventors found that in the C. elegans model, as adult C. elegans age, the expression of ELO-6 continuously decreases; in the early stage of C. elegans aging, the expression levels of ELO-6 among individuals show significant differences. Among them, C. elegans with low expression of ELO-6 have shorter lifespan and poorer healthspan, while C. elegans with high expression of ELO-6 have longer lifespan and better healthspan. Therefore, the lifespan and healthspan of C. elegans individuals can be predicted by ELO-6 in the early stage of aging. In addition, lifespan-extending intervention measures can enhance the expression stability of ELO-6 during aging. Therefore, ELO-6 can also be used as a predictor for population lifespan. The present invention was completed on this basis.

[0084] ELO-6

[0085] ELO-6 is a fatty acid elongase in Caenorhabditis elegans. The research of the present invention unexpectedly found that the expression level of the elo-6 gene continuously decreases with age, and the correlation coefficient between the mRNA level of elo-6 and age is as high as about -0.98.

[0086] In addition, the coding region of the elo-6 gene is enriched with lifespan-related regulatory factors, such as HIS-72, one of the H3 histone variants H3.3.

[0087] In addition, the elo-6 gene has a histone modification pattern specific to adult animals, and has a specific H3K4me3 distribution rather than H3K36me3 in its gene coding region.

[0088] In the present invention, detecting the expression level of ELO-6 in the early stage of nematode aging can predict the length of the individual lifespan of nematodes. The early stage of aging is preferably from the 4th day to the 9th day of adulthood, more preferably from the 5th day to the 8th day. Nematodes with a high expression level of ELO-6 in the early stage of aging have a longer lifespan. Therefore, the elo-6 gene can be used as a predictor of nematode lifespan.

[0089] In one embodiment of the present invention, the expression level of ELO-6 in the early stage of aging can further indicate the health status in the middle and late stages of nematode aging, and the health status can be indicated by the pharyngeal pumping movement frequency of nematodes and the body bending movement frequency in liquid. Under the same conditions, the pharyngeal pumping movement frequency and the body bending movement frequency of nematodes with high ELO-6 expression are higher than those of nematodes with low ELO-6 expression, indicating that the elo-6 gene can be used as an auxiliary marker or predictor of nematode health status.

[0090] It should be understood that ELO-6 also includes homologs highly homologous to the elo-6 gene of Caenorhabditis elegans, especially fatty acid elongases with homology ≥ 80%, ≥ 90% or 95%, as long as the homologous fatty acid elongase has the same or substantially the same fatty acid elongation activity as the Caenorhabditis elegans ELO-6 protein.

[0091] Animal model

[0092] In the present invention, by adding a marker gene to the endogenous elo-6 gene of nematodes, the marker gene is fused with the elo-6 gene to express a fusion protein, so as to indicate the expression level of the elo-6 gene by the expression level of the marker gene, or by constructing transgenic nematodes to express GFP using the promoter of elo-6, a nematode animal model that can predict the lifespan of nematodes according to the present invention is obtained.

[0093] In a preferred example of the present invention, green fluorescent protein GFP is added to the N-terminus of the endogenous elo-6 gene of nematodes by gene editing, and the relative expression level of ELO-6 is indicated by the fluorescence intensity.

[0094] In a preferred example of the present invention, the CRISPR / Cas9 gene editing system is used to add green fluorescent protein GFP to the N-terminus of the endogenous elo-6 gene of nematodes.

[0095] In a preferred example of the present invention, the transgenic method is used to express GFP using the promoter of the elo-6 gene.

[0096] As used herein, the term "GFP::ELO-6" refers to the expression level of the fusion protein of green fluorescent protein and ELO-6 in the gene-edited nematodes of the present invention; the term "Pelo-6::GFP" refers to the expression level of GFP expressed by the promoter of the elo-6 gene in the present invention.

[0097] Application

[0098] The present invention also provides a method for screening potential compounds that affect the lifespan of animals.

[0099] A typical screening method includes the steps of:

[0100] (1) Providing the animal model of the present invention of the present invention, and administering a candidate compound to the animal model of the present invention;

[0101] (2) Detecting the expression level of the marker gene of the animal model, denoted as E1; and detecting the expression level of the marker gene of the animal model to which the candidate compound has not been administered, denoted as E0; wherein, the marker gene is a fluorescent gene, and the fluorescent gene co-expresses with ELO-6, or the marker gene encodes a fusion protein, and the fusion protein is a fusion protein formed by the fusion of a fluorescent protein and ELO-6; or the marker gene is expressed by the elo-6 promoter

[0102] (3) Comparing E1 and E0, thereby determining whether the candidate compound is a potential compound that affects the lifespan of animals,

[0103] wherein, when E1 increases significantly, it indicates that the candidate compound is a potential compound for extending lifespan; when E1 decreases significantly, it indicates that the candidate compound is a potential compound for shortening lifespan.

[0104] Preferably, when E1 / E0 ≥ 1.2, more preferably ≥ 1.5, most preferably ≥ 2, then the candidate compound is a potential compound for extending lifespan; when E1 / E0 ≤ 0.9, more preferably ≤ 0.7, most preferably ≤ 0.5, then the candidate compound is a potential compound for shortening lifespan.

[0105] In another preferred example, the animal model is a nematode model.

[0106] In another preferred example, the animal model is an isogenic model.

[0107] In another preferred example, the animal model is an isogenic nematode model, such as selected from the group consisting of: glp-4(bn2), glp-1(e2141).

[0108] In another preferred example, the animal model includes N groups divided from low to high according to the expression level of ELO-6 (or the expression level of a related marker gene), where N is 3, 4, 5 or 6.

[0109] In another preferred example, N is 3 or 4.

[0110] In another preferred example, the animal model includes a low-expression group, a medium-expression group, and a high-expression group divided according to the expression level of ELO-6 (or the expression level of a related marker gene).

[0111] In another preferred example, based on the level of GFP on the 5th day of adulthood, isogenic nematodes are divided into GFP1, GFP2, GFP3, and GFP4 groups from low to high.

[0112] The main advantages of the present invention include:

[0113] (1) elo-6 can be used as a single reporter gene for predicting lifespan, and can predict the lifespan of nematodes at the early stage of aging in animals (such as nematodes).

[0114] (2) ELO-6 also serves as a marker for evaluating health status, and can even predict the health status of nematodes during the aging process at the early stage of nematode aging.

[0115] (3) The present invention provides for the first time an animal model that can predict lifespan and can be applied to drug screening.

[0116] The present invention will be further described below in conjunction with specific embodiments. It should be understood that these embodiments are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without specific conditions noted in the following embodiments are usually carried out under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise stated, percentages and fractions are weight percentages and weight fractions. Experimental materials such as cells, plasmids, nematodes, and culture media are obtained commercially unless otherwise specified.

[0117] Methods

[0118] 1. Caenorhabditis elegans strains and nematode culture

[0119] Caenorhabditis elegans was cultured under standard growth conditions (Brenner, S. The genetics of Caenorhabditis elegans. Genetics 77, 71 - 94, doi:10.1093 / genetics / 77.1.71 (1974).). Except for RNAi experiments, all strains were grown on nematode growth medium (NGM) plates seeded with Escherichia coli OP50. In the metformin treatment experiment, metformin at a final concentration of 50 mM was added to the agar during the NGM plate preparation step. In the ultraviolet irradiation treatment experiment, OP50 was inoculated onto NGM plates and irradiated with 254 nm ultraviolet light at 5 J / cm2 after being left at room temperature overnight. In the C17iso treatment step, C17iso (Cayman) was dissolved in 100% DMSO to make a stock solution at a concentration of 10 mM, and then mixed with OP50 to a final concentration of 1 mM. This mixture was then seeded onto NGM plates, and the experimental control was OP50 containing 10% DMSO.

[0120] The nematode strains used in this invention are: Bristol N2, glp - 1(e2141), glp - 4(bn2), MTP27

[0121] (gfp::3xflag::elo - 6(S2A), MTP29(gfp::3xflag::elo - 6(S2A)); glp - 1(e2141)), MTP30(gfp::3xflag::elo - 6(S2A); glp - 4(bn2)), MTP315(kmgIs7[Pelo - GFP - unc - 54 3’UTR]). The characteristics of each strain are shown in Table 1.

[0122] Table 1 Nematode strains and characteristics used in this invention

[0123]

[0124] Nematode strain construction process: The endogenous elo - 6 was edited using CRISPR / Cas9 gene editing in the experimental method. After obtaining homozygous gene - edited nematodes, they were backcrossed with N2 three times to obtain MTP27. MTP27 was crossed with glp - 1(e2141) and glp - 4(bn2) respectively to generate MTP29 and MTP30.

[0125] 2. RNA - seq library preparation and data analysis

[0126] Collect nematode samples, wash the nematodes off the culture plates with pre-cooled M9 buffer, repeat the washing 2 times to remove OP50, and after sucking away the M9 buffer, quickly freeze the nematode samples with liquid nitrogen and then store them at -80°C. Extract total RNA from the frozen nematodes using TRI reagent (Molecular Research Center). The mRNA libraries from the 2nd to 12th day of adults were sequenced by Annoroad Gene with PE150. Each GFP group and pqm-1RNAi-treated samples were sequenced by Novogene with PE150.

[0127] The mRNA-seq data analysis is as follows: First, use Bowtie to filter out tRNA and rRNA sequences in the sequencing results, and then align the remaining sequences with WBcel235 through TopHat2 (v2.1.1), and retain the sequences with at most two mismatches and unique localization for differential expression analysis. FPKM is calculated using Cufflinks (software version 2.2.1); differential gene expression is identified by edgeR analysis.

[0128] 3. CRISPR / Cas9 gene editing

[0129] Use the CRISPR / cas9 gene editing system to insert the gfp::3xflag coding sequence at the 5' end of elo-6. Use the following primers to amplify the repair template from the genome and clone it into pDD282 (Addgene 66823):

[0130] Forward primer for the upstream arm:

[0131] ACGTTGTAAAACGACGGCCAGTCGCCGGCATTGGCGCACAAATCACAAAA (SEQ ID NO:1);

[0132] Reverse primer for the upstream arm:

[0133] TCCAGTGAACAATTCTTCTCCTTTACTCATTTTTACCTGCAATTTTAAACTTAAA AAAA (SEQ IDNO:2);

[0134] Forward primer for the downstream arm (introducing S2A mutation to remove the PAM site):

[0135] CGTGATTACAAGGATGACGATGACAAGAGAATGaCACAGGGAGAAGTCTCA (SEQ ID NO:3);

[0136] Reverse primer for the downstream arm:

[0137] TCACACAGGAAACAGCTATGACCATGTTATTCACATCGCATTTCTGGCCC (SEQ ID NO:4).

[0138] The sgRNA was cloned into the pDD162 plasmid (purchased from Addgene 47549) using the following primers:

[0139] CAGGGAGAAGTCTCATTCTTGTTTTAGAGCTAGAAATAGCAAGT (SEQ ID NO:5).

[0140] The repair template, sgRNA, and the pharyngeal fluorescent marker expression plasmid pCFJ90 plasmid (purchased from Addgene 19327) were mixed and injected into the gonads of N2. Homozygotes with gene editing were verified by Sanger sequencing.

[0141] 4. Construction of transgenic nematode strains

[0142] The elo-6 promoter region was amplified by PCR with the forward primer TTCTTCTTCTGCTGGATACCG (SEQ ID NO:6) and the reverse primer TTTTACCTGCAATTTTAAACTTAAAA (SEQ ID NO:7).

[0143] The elo-6 promoter region was inserted into the nematode expression vector pPD95.77-GFP by seamless cloning to construct the expression plasmid pPD95.77-Pelo-6::GFP. Stable integration transgenic nematodes expressing GFP under the elo-6 promoter were constructed by microinjection into N2 followed by UV irradiation-induced integration. This nematode strain was backcrossed with wild-type nematodes 8 times to obtain the transgenic nematode strain MTP315.

[0144] 5. Lifespan experiments

[0145] Nematode strains with an N2 background completed all steps of lifespan detection at 20°C. For nematode strains with a temperature-sensitive mutant glp-1(e2141) and glp-4(bn2) background, adults laid embryos at a culture temperature of 16°C, and then the embryos hatched and developed into germline-less adults at 25°C, and lifespan detection was carried out at 25°C.

[0146] Nematodes with differentially expressed GFP levels were first sorted and grouped according to GFP levels using a stereomicroscopic fluorescence microscope equipped with ET485 / 10x and 69000m GFP filters, and then continued to be cultured and subjected to lifespan experiments under the corresponding conditions according to their genetic background (N2, glp-1(e2141) or glp-4(bn2)).

[0147] For RNAi treatment, nematodes of a specific age stage were transferred to RNAi plates of the iOP50 or xu363 strains freshly induced with IPTG for dsRNA expression, and subsequently transferred to fresh IPTG-induced RNAi plates every 1 or 2 days until approximately day 10.

[0148] During the life span test, for strains with germ lines or nematodes treated with RNAi, they were transferred to new plates every day or every other day. The head of the nematode was touched with a wire every day or every other day, and the animal was considered dead if the nematode was completely still. The survival time of individuals who died abnormally due to non-aging reasons was not used for life span statistical analysis.

[0149] 6. RNAi Treatment for mRNA-seq

[0150] All RNAi clones in the present invention are from the Ahringher RNAi bacterial library. The control plasmid L4440 and the RNAi plasmid were transformed into iOP50 or xu363. The iOP50 or xu363 into which the plasmid was transferred was cultured overnight at 37°C in LB containing 50 μg / mL carbenicillin, then concentrated 10 times and inoculated on NGM plates. The RNAi bacteria were first induced with 4 mM IPTG for 4 hours, and then the nematodes were transferred to the RNAi plates. The nematodes were subsequently transferred to the newly induced RNAi plates every day or every other day.

[0151] In the pqm-1 RNAi experiment, MTP29 strain nematodes were cultured at 16°C and laid embryos on NGM plates seeded with OP50. The embryos were then transferred to 25°C to hatch and culture until the second day of adulthood. They were then transferred to RNAi plates and continued to be cultured at 25°C. The fifth day adults were collected for RNA extraction.

[0152] 7. Measurement of the Frequency of Body Bending Movements of C. elegans in Liquid

[0153] The nematodes were transferred to S buffer (100 mM NaCl and 50 mM potassium phosphate, pH 6.0) and allowed to stand for 1 min, after which the number of body bends of the nematodes in the liquid was counted every 30 seconds. A single-blind experiment was used to avoid subjective bias of the counter.

[0154] 8. Pharyngeal pumping frequency measurement

[0155] Pharyngeal pumping frequency was measured directly on NGM plates. Pharyngeal contractions were counted in 1 minute using a Leica M205FCA stereo microscope in bright field.

[0156] 9. Data Analysis

[0157] Data analysis was performed using SPSS software or Excel. Kaplan Meier in SPSS software was used for lifespan analysis, and log-rank test or Breslow test was used for significance analysis of differences. (***) P value < 0.001, (**) P value < 0.01, (*) P value < 0.05, (ns) P value > 0.05.

[0158] 10. Motif analysis

[0159] Homer was used to perform motif analysis and motif annotation on the gene promoter region. Motif analysis: findMotifs.pl genelist.txt worm output directory / , with parameters using default settings (-start -400 -end 100 -len 8,10); Motif annotation: (findMotifs.pl genelist.txt worm motifdirectory -find motiffile > output).

[0160] 11. Image acquisition

[0161] The nematodes were first anesthetized with 10 mM levamisole and then fixed on a 3% agarose pad. Their images were acquired using Olympus BX53 / DP74. For the active nematodes on the NGM plate, the images were acquired using Leica M205FCA / K3C. Both Olympus BX53 and Leica M205FCA were equipped with ET485 / 10x and 69000m filters to distinguish GFP signals and autofluorescence. ImageJ was used for fluorescence quantitative analysis.

[0162] 12. Sequencing data

[0163] All sequencing data involved in the present invention are available. The mRNA sequencing data set generated by the present invention has been uploaded to the National Genomics Data Center (NGDC) and is stored in the Genome Sequence Archive under PRJCA021128.

[0164] Example 1: Screening and validating lifespan predictors

[0165] 1.1 Screening lifespan predictors

[0166] To identify genes with lifespan prediction functions, a somatic whole-genome expression profile of the 2nd day (D2A), 4th day (D4A), 6th day (D6A), 8th day (D8A), 10th day (D10A), and 12th day (D12A) of adult Caenorhabditis elegans glp-1(e2141) without germline grown at 25°C was constructed using mRNA-seq method, and longitudinal analysis was performed.

[0167] Analysis yielded 44 genes whose expression decreased with age. Further, through the correlation coefficient between gene expression abundance and age, it was found that the expression level of elo-6 was most negatively correlated with age, with a correlation coefficient of -0.98. Therefore, the present inventors further investigated whether elo-6 could be used as a lifespan prediction factor.

[0168] 1.2 Verification of lifespan prediction factor

[0169] The GFP-tagged endogenous ELO-6 nematode strain MTP27 was used to study the change in ELO-6 expression with age. The MTP27 nematode strain was engineered to add GFP and 3xFLAG tags to the N-terminus of ELO-6 by CRISPR / Cas9 gene editing, thereby expressing the GFP::ELO-6 fusion protein. MTP27 can develop normally and has a lifespan similar to that of N2. The intensity of GFP fluorescence signal in nematodes was detected, and the mRNA expression level of the elo-6 gene was measured by mRNA-seq.

[0170] The results are as Figure 1 shown. GFP::ELO-6 is mainly expressed in intestinal cells, as Figure 1 shown in Figure 1 A and Figure 1 C. The results showed that the expression of GFP::ELO-6 decreased during the aging process in both the N2 strain and the glp-1(e2141) strain ( Figure 1 ). The expression level of GFP::ELO-6 showed inter-individual differences on the 5th day of adulthood (D5A) in the N2 background ( Figure 1 A), and showed differences in expression level on the 4th day of adulthood (D4A) in glp-1(e2141) ( Figure 1 C). In N2 on the 9th day and glp-1(e2141) on the 7th day, almost no GFP signal was observed under a stereomicroscope with fluorescence ( Figure 8 ). This was consistent with the mRNA-seq results, where the mRNA expression level of elo-6 on D10A was 10% of that on the second day (

[0171] From the above data, it can be seen that the expression of ELO-6 decreases during the aging process. ELO-6 can be used as a marker for evaluating lifespan and for effectively monitoring aging.

[0172] Example 2: Differences in ELO-6 expression in young adults can predict the lifespan and healthspan of individuals in an isogenic population

[0173] From the results of Example 1, it can be seen that the expression of ELO-6 decreases with aging. This suggests that differences in ELO-6 expression reflect differences in the aging process among individuals. In this example, the following experiments were further conducted for verification:

[0174] 2.1 GFP::ELO-6 Expression Level Predicts Lifespan

[0175] Nematodes with an N2 background were divided into three groups according to the expression level of GFP::ELO-6 in D5A, namely the low-expression group (GFPL), the medium-expression group (GFPM), and the high-expression group (GFPH), and their lifespan was measured ( Figure 2 B).

[0176] The results are as Figure 2 shown. The experimental results show that the lifespan of nematodes in the GFP::ELO-6 low-expression group (GFPL) was significantly shorter than that in the medium-expression group (GFPM) and the high-expression group (GFPH), and the average lifespan differences were 15.23% and 17.20% respectively, as shown in Figure 2 B. The results show that the expression of ELO-6 successfully predicted the lifespan of nematodes.

[0177] In addition, the present inventors also measured the pharyngeal pumping movement frequency representing the healthy lifespan and the body bending movement frequency in the liquid.

[0178] The results are shown as Figure 2 C and Figure 2 D. Compared with the GFPM and GFPH groups, the body bending movement frequency of the GFPL group from day 6 to day 8 ( Figure 2 C) and the pharyngeal pumping movement frequency on day 7 and day 8 ( Figure 2 D) were significantly lower than those of the former two groups, indicating that the healthy lifespan of the GFPL group with low ELO-6 expression was also shorter. In addition, the pharyngeal pumping movement frequency of the GFPH group on day 8 was significantly higher than that of the GFPM group ( Figure 2 D), indicating that its aging process was relatively slower. In addition, the present inventors found that the GFP expression of the offspring of GFPL, GFPM, and GFPH was similar on day 5, indicating that the differences in the expression levels among individuals of ELO-6 on day 5 were not caused by genetic factors.

[0179] In addition, in germline-less glp-4(bn2) and glp-1(e2141) nematodes, nematodes were divided into GFP1 to GFP4 groups from low to high according to the GFP expression level on day 5. Figure 2 E and Figure 2 The results of F show that nematodes with low GFP::ELO-6 expression on day 5, such as the GFP1 group and the GFP2 group, had a shorter lifespan, while nematodes with high GFP::ELO-6 expression on day 5, such as the GFP3 group and the GFP4 group, had a longer lifespan.

[0180] The above results show that in an isogenic population, the expression level of ELO-6 on the 5th day is positively correlated with the individual lifespan and healthspan. Therefore, the expression level of ELO-6 in the early stage of aging (such as on the 5th day) can predict the individual lifespan and healthspan of nematodes.

[0181] 2.2 The expression level of GFP driven by the elo-6 promoter predicts lifespan

[0182] In addition to detecting the expression of GFP::ELO-6, the present inventors also constructed transgenic nematodes to detect whether the expression activity of the elo-6 promoter itself can predict the individual lifespan. In the transgenic nematode strain MTP315 in which GFP is driven by the elo-6 promoter, the expression level of GFP decreases during aging ( Figure 2 G), and there are differences among individuals in GFP expression on the 6th day of adulthood ( Figure 2 G). The expression level of GFP on the 6th day of adulthood is positively correlated with the lifespan of nematodes. According to the expression level of GFP on the 6th day of adulthood, the transgenic nematodes were divided into three groups: low-expression group (GFPL), medium-expression group (GFPM), and high-expression group (GFPH), and their lifespans were measured. The GFP high-expression group (GFPH) had the longest lifespan, and the GFP low-expression group (GFPL) had the shortest lifespan ( Figure 2 H). Therefore, the expression activity of the elo-6 promoter itself has the function of predicting the individual lifespan.

[0183] Example 3: ELO-6 predicts population lifespan

[0184] In this example, it was further detected whether ELO-6 can predict the lifespan regulated by genetic factors in addition to predicting the individual lifespan differences caused by non-genetic factors.

[0185] 3.1 RNAi-mediated knockdown of the expression of aging-related genes to extend lifespan

[0186] By applying RNAi technology, the expression of daf-2, cyc-1, set-2, and utx-1 was reduced respectively starting from the hatching of nematodes. The reduction of the expression levels of these genes all led to an extension of lifespan.

[0187] Detect the expression of GFP::ELO-6 in nematodes treated with RNAi against daf-2, cyc-1, set-2, and utx-1 during aging.

[0188] The results are as Figure 3 shown.

[0189] daf-2 RNAi enhanced the stability of ELO-6 expression as early as the 4th day, and still showed a higher GFP level than the control on the 7th day ( Figure 3A and 3B). The above phenotypes depend on daf-16. In the short-lived daf-16(mu86) mutants, the expression level of ELO-6 was not affected by daf-2 RNAi and there was no difference compared with the control ( Figure 3 A and 3B). In addition, the expression level of ELO-6 in daf-16(mu86) on the 6th day was decreased compared with N2 worms ( Figure 3 A and 3B).

[0190] Under utx-1 RNAi treatment, the expression stability of ELO-6 was enhanced during aging ( Figure 3 C and 3D), and the expression of GFP::ELO-6 could still be observed on the 9th day, while the expression of GFP was hardly detectable under the control condition ( Figure 3 C).

[0191] Under cyc-1 RNAi treatment, the expression level of GFP::ELO-6 decreased more slowly during aging from the 2nd day to the 8th day ( Figure 3 C and 3D), indicating that cyc-1 RNAi also enhanced the expression stability of ELO-6.

[0192] Set-2 RNAi extended lifespan, and set-2 RNAi only enhanced the expression level of ELO-6 on the 4th day, while the decrease in the expression of ELO-6 from the 6th day to the 8th day was not affected by set-2 RNAi ( Figure 3 A and 3B).

[0193] 3.2 Treatment with the drug metformin to extend lifespan

[0194] Studies have shown that metformin treatment can extend the lifespan of C. elegans. Therefore, the expression stability of ELO-6 during the aging process of metformin-treated C. elegans was further detected.

[0195] The results are as Figure 3 E and Figure 3 shown in F. Metformin treatment that extended lifespan ( Figure 3 G) also enhanced the expression stability of GFP::ELO-6 during aging.

[0196] These results all indicate that the expression of ELO-6 can predict lifespan changes regulated by genetic factors and chemical drugs, and the expression stability of ELO-6 during aging is a predictor of population lifespan.

[0197] Example 4: Relationship between ELO-6 expression and lifespan

[0198] Since the expression of ELO-6 during the aging process is related to lifespan, the present inventors further investigated whether ELO-6 is a lifespan regulator. The present inventors reduced the expression of elo-6 starting from the 2nd or 5th day by RNAi method.

[0199] The results showed that elo-6 RNAi did not affect lifespan (RNAi starting from the 2nd day, P value = 0.166; RNAi starting from the 5th day, P value = 0.667) ( Figure 4 A and 4B).

[0200] C17iso is a product of ELO-6. The present inventors supplemented C17iso starting from the 4th day and only slightly extended the population lifespan (average lifespan extended by 3%, P value = 0.03) ( Figure 4 C). Treating the nematodes in the GFP-L group starting from the 6th day did not affect the lifespan of the GFP-L group (P value = 0.851) ( Figure 4 D). The above results indicate that the product C17iso of ELO-6 has no significant effect on lifespan.

[0201] Therefore, the expression of the elo-6 gene in the intestine is not a lifespan regulator, but only a lifespan predictor.

[0202] Example 5: Transcriptome difference analysis between short-lived and long-lived individuals in an isogenic population

[0203] The present inventors achieved the distinction between short-lived and long-lived animals in an isogenic population by using the expression difference of ELO-6 on the 5th day of adult worms, so as to study the molecular mechanism related to the prediction of individual nematode lifespan by ELO-6.

[0204] The present inventors detected differentially expressed genes (DEGs) between short-lived and long-lived animals by transcriptome sequencing. The present inventors divided the isogenic nematodes into GFP1, GFP2, GFP3 and GFP4 groups according to the level of GFP from low to high on the 5th day of adult worms, and 100 nematodes were taken from each group for mRNA-seq.

[0205] The results showed that the gene expression differences between different GFP groups were not significant, and the correlation coefficients were all greater than 0.85. The MDS plot of the mRNA-seq data showed that the differences in the transcriptome followed a trend similar to the GFP signal intensity ( Figure 5A). Analysis of mRNA-seq data of adjacent GFP groups in the context of glp-1(e2141) showed that when applying FDR < 0.1, there were 73 significantly differentially expressed genes between GFP1 group and GFP2 group, while only 40 genes were significantly differentially expressed between GFP2 and GFP3, and 10 genes had differential expression between GFP3 and GFP4. Since the present inventors observed that in the context of glp-1(e2141) and glp-4(bn2), a large proportion of the GFP1 group died on the 6th day ( Figure 2 E and 2F), thus the transcriptome of GFP1 may reflect the characteristics occurring before death.

[0206] Considering the highly similar transcriptomes of GFP3 and GFP4, the present inventors compared the transcriptomes between GFP2 and GFP4 to identify differentially expressed genes (DEGs) between the short-lived group and the long-lived group. The present inventors found that in the context of glp-1(e2141) and glp-4(bn2), compared with long-lived nematodes, 65 genes were significantly highly expressed and 113 genes were significantly lowly expressed in short-lived nematodes ( Figure 5 B).

[0207] Functional clustering analysis showed that genes related to xenobiotic metabolic processes and cuticle structural components were enriched among the genes significantly lowly expressed in short-lived nematodes, and genes related to ribosome biogenesis and CUB domain were enriched among the genes significantly highly expressed.

[0208] The present inventors further studied whether there were gene regulation rules for DEGs between short-lived and long-lived transgenic animals. Motif analysis showed that the promoter regions of 65 highly expressed genes and 113 lowly expressed genes were both enriched with PQM-1 / ELT-3 binding motifs ( Figure 5 C), indicating that these differentially expressed genes may be regulated by common transcription factors.

[0209] In addition to motif analysis, the present inventors also analyzed the PQM-1 ChIP-seq profiles of L3-stage nematodes. Among the 65 genes with increased expression, there were PQM-1 enrichment regions upstream of 26 genes, and 12 of them overlapped with the predicted PQM-1 / ELT-3 binding motifs. Among the 113 genes with decreased expression, 43 had PQM-1 enrichment regions in the upstream gene regions, and 19 of them conformed to the predicted PQM-1 / ELT-3 binding motifs ( Figure 5 D). Therefore, the transcriptome differences between short-lived and long-lived individuals may be regulated by PQM-1 / ELT-3.

[0210] Example 6: pqm-1 Promotes the Expression Difference of ELO-6 among Middle-aged Individuals and Regulates Healthspan

[0211] To investigate whether PQM-1 or ELT-3 regulates the inter-individual expression differences of ELO-6 on the 5th day of adulthood and the subsequent aging process, the inventors knocked down pqm-1 or elt-3 by RNAi starting from the 2nd or 3rd day of adulthood and detected the expression of GFP::ELO-6. The inventors found that pqm-1 RNAi reduced the differences in ELO-6 expression among individuals on the 6th day. Compared with the control group, fewer nematodes with low expression of GFP::ELO-6 were observed on the 6th day of adulthood ( Figure 6 A), and this phenotype was more obvious than that of elt-3 RNAi. Therefore, the inventors focused on further research on pqm-1.

[0212] To test whether pqm-1 regulates the aging process, the inventors measured the pharyngeal pumping movement frequency and body bending movement frequency of middle-aged nematodes treated with pqm-1 RNAi.

[0213] The results showed that the reduction of pqm-1 expression delayed the aging process. The body bending movement frequency of the pqm-1 RNAi group was significantly higher than that of the control group on the 6th and 8th days ( Figure 6 B), and the pharyngeal pumping movement frequency was also higher than that of the control group on the 7th and 9th days ( Figure 6 C).

[0214] The inventors further detected the changes in the transcriptome of the 5th day of adulthood caused by pqm-1 RNAi treatment starting from the 2nd day of adulthood in the germline mutant glp-1(e2141) grown at 25°C. After pqm-1 RNAi treatment, compared with the control group, 267 genes had increased expression (fold change > 0.5, FDR < 0.05), and 124 genes had decreased expression (fold change > 0.5, FDR < 0.05).

[0215] The inventors further compared the correlation between the differential gene analysis ( Figure 5 B) between short-lived and long-lived individual animals and the gene expression changes caused by pqm-1 RNAi treatment.

[0216] The inventors found that among the 65 genes highly expressed in short-lived nematodes, 10 genes had decreased expression after pqm-1 RNAi treatment. Among the 113 genes lowly expressed in short-lived nematodes, pqm-1 RNAi treatment increased the expression of 25 genes and decreased the expression of 8 genes ( Figure 6 D). Therefore, pqm-1 RNAi reduced the gene expression differences between short-lived and long-lived individuals that may occur during the aging process by affecting the transcriptome.

[0217] Example 7: Reducing the highly expressed genes in short-lived individuals enhances the stability of ELO-6 expression and regulates lifespan

[0218] The present inventors further studied whether the differentially expressed genes of short-lived and long-lived isogenic nematodes on the 5th day of adulthood regulate the aging process, and the expression stability of GFP::ELO-6 during aging. In this example, the highly expressed genes in the short-lived GFP2 group were focused on. The present inventors knocked down 61 out of 65 genes in the N2 background starting from the 2nd day of adulthood by RNAi method, and detected the GFP level and lifespan.

[0219] The present inventors found that RNAi of 18 genes delayed the decline in the expression of GFP::ELO-6 during the aging process ( Figure 7 A- Figure 7 E), and among them, 10 genes had a PQM-1 binding motif and / or enrichment of PQM-1 in the upstream region of the gene.

[0220] Interestingly, among these 18 genes, the expression of smf-2 and B0238.13 decreased after pqm-1 RNAi treatment, although they did not have a PQM-1 binding motif and / or PQM-1 enrichment.

[0221] Among these 18 genes, RNAi of ribosomal genes tag-151, E02H1.1, C16A3.6, B0511.6, and T23D8.3 led to an extended lifespan. RNAi of tag-151 enhanced the GFP signal on the 6th day of adulthood compared to the control ( Figure 7 A), while RNAi of C16A3.6, E02H1.1, B0511.6, and T23D8.3 continuously delayed the decrease in GFP level until the 8th day of adulthood ( Figure 7 B and 7C).

[0222] In addition, for another three genes nst-1, F53F4.11, and lpd-7, RNAi knockdown also led to an extended lifespan, but had no obvious effect on the expression stability of GFP::ELO-6 during aging. Interestingly, all these 8 lifespan regulatory genes are related to nucleolar function. This is consistent with previous research results, that is, in various organisms, long-lived mutants have reduced ribosomal function, and small nucleoli are related to individual longevity. Among these 8 genes, 3 genes have a PQM-1 binding motif and / or PQM-1 enrichment, including T23D8.3. RNAi of T23D8.3 has the most significant lifespan extension phenotype. Previously, T23D8.3 was also identified as a longevity regulator in the prediction of the longevity network.

[0223] Therefore, the expression of ELO-6 during aging and lifespan are regulated by these genes that are highly expressed in short-lived animals.

[0224] Discussion

[0225] The present inventors determined that the expression of elo-6 began to decrease from the 4th day of adulthood based on GFP signal levels, and found that there were expression differences among individual nematodes on the 5th day. The expression differences of ELO-6 among individuals were not caused by genetic heterogeneity. The present inventors speculated that the gene expression changes among individual animals with age were not unique to elo-6, but should be a common feature of dynamically expressed genes. Other genes that showed expression differences between long-lived and short-lived individuals on the 5th day of adulthood and whose expression levels continuously changed during the aging process might also be suitable reporter genes. The reason for the individual differences in elo-6 expression might be that first, elo-6 was highly expressed in young nematodes, and among all the expressed genes in adult nematodes on the 2nd day, the expression level of elo-6 ranked 224th. Second, with the increase in age, the expression level of elo-6 decreased sharply, so the abundance of its expression changes was sufficient to reflect the differences among individuals.

[0226] In the N2 background, the lifespan of animals in the GFPL group was significantly shorter than that of animals in the GFPM group and the GFPH group. elo-6 encodes a fatty acid elongase to synthesize C17iso and is partially functionally redundant with elo-5. Different from elo-5 which is essential for development, the lack of elo-6 does not cause developmental defects. Although the expression of ELO-6 on the 5th day of adulthood was positively correlated with lifespan and healthspan, the present inventors found that reducing the expression of elo-6 by RNAi during adulthood did not affect lifespan. A previous study showed that supplementing C17iso starting from the 1st day of adulthood did not affect lifespan. The present inventors supplemented C17iso starting from the 4th day of adulthood and found that supplementing C17iso could slightly extend the population lifespan, which might reflect the lifespan extension of short-lived animals among them. Therefore, the present inventors supplemented C17iso to the GFPL group starting from the 6th day of adulthood, but could not extend the lifespan of animals in the GFPL group.

[0227] The inventor also found that the expression dynamics of elo-6 is a predictor of population lifespan. In the present invention, by regulating the expression of daf-2 and utx-1, which extend lifespan through the insulin / IGF-1 signaling pathway, the reduction can enhance the stability of ELO-6 expression during aging. Correspondingly, during the aging of the short-lived daf-16(mus86) mutant, the expression level of ELO-6 decreases earlier than in the wild-type N2. Among other lifespan-extending interventions used in the present invention, set-2 RNAi does not change the age-dependent expression stability of ELO-6 after the 6th day of adulthood, nor does it change the expression level of ELO-6 on the 2nd day of adulthood, indicating that neither the active expression of ELO-6 in young animals nor its expression stability during aging is controlled by set-2. The expression stability of ELO-6 during aging is also enhanced in germline-less longevity mutants and metformin treatment. Therefore, under various interventions, the expression dynamics of ELO-6 can predict lifespan, further confirming the accuracy and applicability of ELO-6 as a lifespan predictor.

[0228] After predicting the lifespan of C. elegans based on the ELO-6 expression level, individuals with different lifespan lengths can be used to study the mechanisms regulating individual lifespan. The inventor found that there are genes with significant differences in expression between long-lived and short-lived animals. Genes related to xenobiotic metabolism processes and cuticle structure composition are enriched among the downregulated genes in short-lived C. elegans, while genes related to ribosome biogenesis and CUB domain are enriched among the upregulated genes. In addition, the inventor found that PQM-1 binding sites are enriched in both downregulated and upregulated genes. After pqm-1 RNAi treatment, the transcriptome of the animals shifts to a relatively young state and the healthspan is improved. This is consistent with the existing finding that overexpression of PQM-1 shortens the lifespan of wild-type Caenorhabditis elegans. Due to the trade-off between survival under stress conditions and lifespan mediated by PQM-1, the inventor speculated that short-lived individuals may have experienced certain stress conditions, which may be related to enhanced xenobiotic metabolism processes, cuticle properties, or ribosome synthesis gene expression. In the present invention, the inventor found that ribosomal genes are enriched among the highly expressed genes in short-lived animals, and RNAi of some of these genes extended lifespan. This is consistent with previous research results that small nucleoli on the first day of adulthood predict longer individual lifespan. Under dietary restriction conditions, C17iso mediates the coordination between growth and amino acid supplementation. The enhanced expression of ribosome synthesis genes in short-lived animals may reflect enhanced ribosome function, leading to amino acid supplementation stress and resulting in downregulation of ELO-6 to reduce the synthesis of C17iso.

[0229] The research of the present invention found that the elo-6 gene is a single-gene reporter for predicting individual and population lifespan. Studying the mechanism by which PQM-1 regulates differentially expressed genes between short-lived and long-lived animals will help to understand the lifespan differences between individuals.

[0230] All documents mentioned in this invention are cited herein by reference as if each individual document was cited by reference. In addition, it should be understood that after reading the above teachings of this invention, those skilled in the art can make various changes or modifications to this invention, and these equivalent forms also fall within the scope defined by the appended claims of this application.

Claims

1. Use of a fatty acid elongase ELO-6 detection reagent in preparing a kit for evaluating animal lifespan, characterized in that: The animal is Caenorhabditis elegans; the detection reagent is selected from the following group: elo-6 a reagent for detecting the mRNA level of ELO-6, a reagent for detecting the protein level of ELO-6, or a combination thereof.

2. Use of a fatty acid elongase ELO-6 detection reagent in preparing a kit for evaluating the healthy life span of an animal, characterized in that: The animal is Caenorhabditis elegans, and the healthy life span refers to the health status of Caenorhabditis elegans in mid-to-late adulthood.

3. The use according to claim 2, characterized in that The healthspan is measured by the frequency of pharyngeal pumping movements and / or the frequency of body bending movements in liquid in mid-to-late adult nematodes.

4. The use according to claim 1, characterized in that The method for detecting the protein level of ELO-6 comprises: co-expressing a marker gene with ELO-6, and using the expression intensity of the marker gene to indicate the protein level of ELO-6.

5. The use according to claim 1, characterized in that The kit further comprises one or more auxiliary detection reagents, which are used to detect the expression level of a gene selected from the following group: (Z1) pqm-1 ； (Z2) smf-2 ； (Z3) B0238.13 ； (Z4) tag-151 ； (Z5) E02H1.1 ； (Z6) C16A3.6 ； (Z7) B0511.6 ； (Z8) T23D8.3 。 6. A method for preparing an animal model that can be used to assess lifespan, characterized in that: The method comprises the steps of: Through gene editing, exogenous marker genes are introduced to make the endogenous elo-6 Genes are co-expressed with the exogenous marker gene, or used by transgenic methods elo-6 The promoter of the gene expresses the marker gene, thereby obtaining the animal model, Among them, in the animal, the expression level of the marker gene reflects the elo-6 Gene expression levels or elo-6 The expression activity of the promoter; And the animal is Caenorhabditis elegans.

7. The method according to claim 6, characterized in that The marker gene is the green fluorescent protein GFP gene.

8. A method for screening compounds, characterized in that: Includes steps: (a) providing an animal model prepared by the method of claim 6; (b) in the test group, culturing the animal model in the presence of the candidate compound, and detecting the expression level of the marker gene of the animal model, which is recorded as E1; In the blank control group, in the absence of the candidate compound and under the same other conditions, the animal model is cultured, and the expression level of the marker gene in the animal model in the blank control group is detected, which is recorded as E0; wherein the marker gene is a fluorescent gene, and the fluorescent gene is co-expressed with ELO-6; or the marker gene encodes a fusion protein, and the fusion protein is a fusion protein formed by the fusion of fluorescent protein and ELO-6; or the marker gene is elo- 6 promoter expression; (c) comparing E1 and E0 to determine whether the candidate compound is a potential compound that affects animal lifespan; Among them, when E1 increases significantly, it indicates that the candidate compound is a potential compound for prolonging lifespan; when E1 decreases significantly, it indicates that the candidate compound is a potential compound for shortening lifespan.

Images