An Escherichia coli integrated expression system and its application in the high-efficiency expression of enzymes

By integrating the expression box at the slmA site of the E. coli genome and replacing the T7RNA polymerase regulatory original, combining high-strength promoters, an efficient integrated expression system was constructed, solving the genetic stability and antibiotic dependence of the plasmid expression system, and achieving efficient and stable enzyme expression.

CN118995554BActive Publication Date: 2025-07-04JIANGNAN UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411257100.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-09-09
Publication Date
2025-07-04
Estimated Expiration
2044-09-09

AI Technical Summary

Technical Problem

The plasmid expression system has poor genetic stability and antibiotic dependence, which leads to the reduction in yield of recombinant bacteria in the later stage of fermentation and increase cost, while the integration expression volume is insufficient and the experimental process is cumbersome.

Method used

By integrating the target gene expression box at the slmA site of the E. coli host genome, and replacing the regulatory element of the T7 RNA polymerase-encoded gene, a high-intensity tandem promoter such as Plpp-T7 is used to construct a constitutive and efficient integrated expression system, and gene editing is carried out in combination with CRISPR-Cas9 technology.

Benefits of technology

Efficient recombinant expression in the absence of antibiotics and inducers was achieved, genetic stability was significantly improved, enzyme activity and expression amount reached plasmid level, reducing fermentation costs and avoiding antibiotic contamination.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118995554B_ABST
    Figure CN118995554B_ABST
Patent Text Reader

Abstract

The present invention discloses an Escherichia coli integrated expression system and its application in efficient enzyme expression. The present invention systematically optimizes the Escherichia coli integrated expression system from three aspects. First, the integration site slmA with the highest expression activity is screened out from 18 sites in the ORI region of the Escherichia coli genome; second, 16 endogenous promoters in Escherichia coli are identified and combined with the T7 promoter to construct a multi-promoter; subsequently, the expression of T7 RNA polymerase is optimized at the chassis cell level. Compared with the plasmid-based recombinant expression mode, the GFP expression level of the obtained constitutive high-efficiency integrated expression system is increased to about 2 times. Finally, it is applied to the integrated expression of nitrilase and hyaluronidase, realizing stable and efficient enzyme expression, and the enzyme activity is comparable to that of the plasmid level. In summary, the present invention provides a stable and efficient gene expression method, without the need for antibiotics and inducers, making it a powerful tool for synthetic biology, enzyme engineering and related applications.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to an Escherichia coli integration expression system and its application in efficient enzyme expression, belonging to the technical field of synthetic biology. Background Art

[0002] Due to the urgent need for green manufacturing and biological manufacturing, bioengineering has been increasingly widely concerned. Many technologies such as genetic engineering, protein engineering, and synthetic biology have developed vigorously and gradually matured. Microorganisms play an important role as hosts for gene expression and regulation. In these fields, due to the advantages of convenient plasmid experimental operation and high yield, plasmids are usually used as vectors for gene or pathway expression. However, plasmid-based expression systems have two main drawbacks. First, as non-genomic DNA, plasmids usually exhibit poor genetic stability (plasmid loss), resulting in a decrease in the yield of recombinant bacteria in the late fermentation stage or difficulty in improving it. In addition, the maintenance of plasmids in host cells often requires the addition of antibiotics. However, the abuse of antibiotics and their introduction into the environment are likely to lead to the emergence of antibiotic-resistant bacteria and even the evolution of superbugs. This is also considered one of the biggest health problems in the world today. Moreover, on an industrial production scale, the large use of antibiotics will undoubtedly increase more costs.

[0003] Integrating foreign genes into the host chromosome for expression can well avoid several drawbacks of plasmid expression. First of all, the gene inserted into the genome can be continuously and stably expressed without any antibiotic selection. In addition, after the gene is integrated and expressed in the host, there is no need to add substances to maintain the replication of the plasmid in the cell, thus significantly reducing the growth and metabolic pressure of the host cell. Moreover, with the rapid development of gene editing technologies, more and more gene editing technologies have been developed, such as CRISPR-Cas9, CRISPR-Cpf1, and Transposon-Associated CRISPR-Cas System, etc. These provide diversified and convenient technical strategies for integrated expression. Although integrated expression shows various advantages compared with plasmid-free expression, there are still obvious drawbacks such as insufficient expression level. Many scholars have integrated multiple copies of genes into the genome to increase the gene dosage and thus improve the expression level. For example, Zhang et al. integrated two copies of the NAD kinase gene into the genome of Escherichia coli to increase the production of poly-3-hydroxybutyrate (Zhang et al. Biotechnol Lett, 2015). In addition, Watzlawick et al. inserted five copies of the ganA gene expression cassette into the genome of Bacillus subtilis, achieving high-efficiency expression and stable inheritance of β-galactosidase (Watzlawick and Altenbuchner, AMB Express, 2019). However, although integrating multiple copies can significantly improve the expression level of genes at the genomic level, the experimental process is cumbersome, and the multiple-copy gene expression cassettes in the genome will bring a significant growth burden to the host. Summary of the Invention

[0004] To solve the above problems, the present invention provides an Escherichia coli system capable of achieving high-efficiency integrated expression by screening integration sites, optimizing the promoter of the target gene, and modifying the regulatory element of T7 RNA polymerase, and verifies it using target genes encoding different enzymes to determine the feasibility of this system for highly expressing foreign genes.

[0005] The first object of the present invention is to provide a recombinant Escherichia coli for highly integrating and expressing a target gene, wherein the recombinant Escherichia coli includes the following modifications: integrating a target gene expression cassette at the slmA site of the Escherichia coli host genome and replacing the regulatory element of the T7 RNA polymerase encoding gene on the genome;

[0006] The target gene expression cassette contains a target gene and a first promoter for initiating the expression of the target gene, and the first promoter is a tandem promoter, which is obtained by tandemly connecting one or more of the Plpp promoter, PgapA promoter, and PssrA promoter with the T7 promoter.

[0007] The regulatory element includes the lactose operon located upstream of the T7 RNA polymerase-encoding gene. The regulatory element is replaced with an element containing a second promoter, and the second promoter is selected from the PalsR promoter or the PasnB promoter.

[0008] Due to the disadvantages of plasmid-mediated microbial fermentation, such as additional growth burden, genetic instability, and antibiotic contamination, it is crucial to enhance the expression of foreign genes at the genomic level. Therefore, the objective of the present invention is to construct a highly efficient integration expression system with a single copy number at the genomic level to achieve highly efficient recombinant expression with genetic stability independent of antibiotics. Escherichia coli has been favored by researchers due to its convenient genetic manipulation and strong expression ability. Therefore, in the present invention, we used Escherichia coli BL21(DE3) as a model strain. To further reduce the cost of recombinant expression, we are committed to constructing a constitutive highly efficient integration expression system to avoid the addition cost of IPTG. Many scholars have demonstrated in previous studies that the expression levels of genes can show significant differences at different positions on the chromosome. Bryant demonstrated in his study that in the same expression cassette, green fluorescent protein could show a 300-fold expression difference on the Escherichia coli genome (Bryant et al. Nucleic Acids Res, 2014). Therefore, in our study, we selected 18 integration sites in the ORI structured macrodomain region of the Escherichia coli chromosome and, through the characterization of the expression intensities of these 18 integration sites, discovered a site with the highest expression activity, slmA. On this basis, to further increase the integration expression level, we designed the promoter element in the expression cassette. We first characterized 16 constitutive promoters of Escherichia coli. Then, we combined these 16 promoters with the T7 promoter to construct 16 dual promoters and 10 triple promoters. A high-intensity promoter, Plpp-T7, was discovered in this series of promoter libraries. In the case of constitutive expression, its expression intensity is 3.3 times that of the T7 promoter. Subsequently, when we combined the high-intensity Plpp-T7 promoter with the high-expression activity site slmA, the integration expression level could reach 74% of the expression level of plasmid pET-3b. To achieve a higher-intensity constitutive integration expression, we further regulated the constitutive expression of T7 RNA polymerase (lactose operon leaky expression) in the genome of Escherichia coli BL21(DE3). The integration expression level of EGFP was successfully increased to 1.98 times that of the plasmid level. Thus, a constitutive highly efficient integration expression system was constructed. Finally, we also used the constructed system to perform integration expression of nitrilase and hyaluronidase. The enzyme activities and expression levels of the obtained integrated strains could reach levels comparable to those of the plasmid.

[0009] Furthermore, among the tandem promoters, the Plpp promoter, the PgapA promoter or the PssrA promoter is located before the T7 promoter.

[0010] Preferably, the tandem promoters include the Plpp promoter, the PgapA promoter, the PssrA promoter, the Plpp-T7 promoter, the PgapA-T7 promoter, the PssrA-T7 promoter, the PgapA-Plpp-T7 promoter, the PgapA-PssrA-T7 promoter, the Plpp-PgapA-T7 promoter, the Plpp-PssrA-T7 promoter, the PssrA-PgapA-T7 promoter or the PssrA-Plpp-T7 promoter. In each of the tandem promoters of the embodiments of the present invention, the promoters are directly connected.

[0011] Furthermore, the target gene expression cassette and / or the element containing the second promoter further contain an RBS; the sequence of the RBS is as shown in SEQ ID NO.12.

[0012] Furthermore, the slmA locus is as shown in SEQ ID NO.1.

[0013] Furthermore, integration is performed by the CRISPR-Cas9 technology, and the editing elements required for integration into the slmA locus include sgRNA; the sequence of the sgRNA is as shown in SEQ ID NO.2.

[0014] Furthermore, the sequences of the Plpp promoter, the PgapA promoter and the PssrA promoter are as shown in SEQ ID NOs.3-5 respectively, and the sequence of the T7 promoter is as shown in SEQ ID NO.6.

[0015] Furthermore, the sequence of the regulatory element is as shown in SEQ ID NO.7.

[0016] Furthermore, the sequences of the PalsR promoter and the PasnB promoter are as shown in SEQ ID NOs.8-9 respectively.

[0017] Furthermore, the Escherichia coli host includes Escherichia coli BL21(DE3).

[0018] The second object of the present invention is to provide a constitutive dual promoter with high expression intensity, which is obtained by directly connecting the Plpp promoter before the T7 promoter.

[0019] The third object of the present invention is to provide the application of the above recombinant Escherichia coli or constitutive dual promoter in the integrated expression of a target gene.

[0020] Furthermore, the target gene is a coding gene for an exogenous protein (enzyme), including but not limited to nitrilase, hyaluronidase, etc.

[0021] Furthermore, the sequence of the nitrilase is as shown in SEQ ID NO.10; the sequence of the hyaluronidase is as shown in SEQ ID NO.11.

[0022] The fourth object of the present invention is to provide a method for highly efficient integrated expression of a target gene, including the step of fermenting with the recombinant Escherichia coli.

[0023] Specifically, the present invention provides a highly efficient integrated expression system CEIES_Ecoli of Escherichia coli, which combines the Plpp-T7 promoter, the genomic integration site slmA, and the high-integration expression intensity Escherichia coli chassis cell BslG-alsR to construct an integrated expression system, realizing the highly efficient constitutive integrated expression of Escherichia coli.

[0024] Preferably, the highly efficient integrated expression system CEIES_Ecoli of Escherichia coli is used to achieve the integrated expression of the nitrilase derived from Pseudomonas putida CGMCC3830, and the enzyme activity can reach 22.87 U·mL -1 .

[0025] Preferably, the highly efficient integrated expression system CEIES_Ecoli of Escherichia coli is used to achieve the integrated expression of the hyaluronidase derived from Citrobacter freundii, and the enzyme activity can reach 12195 U·mL -1 .

[0026] The beneficial effects of the present invention:

[0027] (1) In the present invention, Escherichia coli is used as a model strain, and a highly efficient integrated expression system with a single copy number at the genomic level is constructed through the screening and optimization of components, realizing highly efficient recombinant expression with genetic stability independent of antibiotics. Successfully, the integrated expression level of the reporter gene reaches 1.98 times and 2.07 times that of the plasmid level. At the same time, the nitrilase and hyaluronidase are integrally expressed using the constructed system, and the enzyme activity and expression level of the obtained integrated strains can reach the level equivalent to that of the plasmid.

[0028] (2) The highly efficient integrated expression system constructed in the present invention can achieve highly efficient protein recombinant expression without the addition of antibiotics and inducers, and has significantly superior genetic stability. Under the condition of reducing the fermentation cost, it fundamentally avoids the problems of antibiotic residues, antibiotic abuse, and pollution. Description of the Drawings

[0029] Figure 1Screening of high-expression active integration sites in the Escherichia coli genome.

[0030] Figure 2 Characterization and combinatorial construction of constitutive promoters.

[0031] Figure 3 Construction of an Escherichia coli integration expression system.

[0032] Figure 4 Growth enzyme activity curves of recombinant nitrilase and hyaluronidase in Escherichia coli. Specific implementation manners

[0033] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments, so that those skilled in the art can better understand the present invention and be able to implement it, but the exemplified embodiments are not used as a limitation to the present invention.

[0034] The method involved in the present invention is as follows:

[0035] Selection of genomic integration sites

[0036] In the present invention, 18 genomic integration sites for integration expression were selected in the ORI region of the Escherichia coli BL21(DE3) genome. In order not to disrupt the original metabolic pathways and gene expressions of Escherichia coli, these 18 integration sites were selected between the genes in the genome. The integration sites are named after the nearby genes.

[0037] Construction of sgRNA expression plasmid pTargetF

[0038] Plasmid pTargetF was used as a template for inverse PCR. The N20 sequence of sgRNA was introduced into pTargetF through an inverse PCR reaction. The PCR program was set as follows: 95°C for 3 min, 95°C for 30 s, 60°C for 30 s, 72°C for 5 min, 35 cycles, and a final extension time of 10 min. After digesting the PCR product with endonuclease DpnI at 37°C for 2 hours, the mixture was transformed into Escherichia coli JM109, and positive mutants were confirmed by sequencing.

[0039] Escherichia coli gene editing

[0040] The pCas plasmid was transformed into Escherichia coli BL21(DE3) competent cells to obtain BL21(DE3)-pCas. Overlap extension-PCR was used to fuse the homologous arms with the integration fragment to construct the donor DNA. The constructed pTargetF plasmid and the donor DNA were simultaneously transformed into Escherichia coli BL21(DE3)-pCas competent cells. Single colonies were selected for colony PCR and DNA sequencing verification.

[0041] Construction of Recombinant Plasmids of Green Fluorescent Protein, Nitrilase and Hyaluronidase

[0042] In the present invention, pET-3b was used as the expression vector. The green fluorescent protein gene gfp (GenBank: AAB02572.1) was codon-optimized in Escherichia coli. In addition, the genes of nitrilase (derived from Pseudomonas putida CGMCC3830) and hyaluronidase (derived from Citrobacter freundii) were also codon-optimized. Then, the gfp gene was ligated between the NdeI and BamHI of plasmid pET-3b by homologous recombination. The ligation product was transformed into competent Escherichia coli JM109 cells. Finally, the cells were collected by centrifugation and spread on LB agar medium containing ampicillin. After culturing for 12 hours, single colonies were selected for PCR and DNA sequencing. The recombinant plasmids of nitrilase and hyaluronidase were constructed by the same method.

[0043] Construction of Promoter Engineering Plasmids

[0044] The pET3b-GFP plasmid was digested with SalI and XbaI restriction endonucleases, and the endogenous promoter of Escherichia coli was inserted at this position to construct a single promoter plasmid (replacing the T7 promoter). The pET3b-GFP plasmid was digested with SalI and BglII restriction endonucleases, and the endogenous promoter of Escherichia coli was inserted at this position to construct a double promoter plasmid (inserted upstream of the T7 promoter). First, the two endogenous promoters were fused and amplified by extended PCR, and then inserted into the two restriction sites of SalI and BglII of the pET3b-GFP plasmid to construct a triple promoter plasmid.

[0045] Recombinant Expression of Nitrilase and Hyaluronidase in Escherichia coli

[0046] Recombinant Escherichia coli, including integrative and plasmid-type expression strains, was cultured in 10 mL LB at 37 °C and 220 rpm for 10 - 14 h. Then it was transferred to 30 mL LB with an inoculation amount of 1% and cultured for 8 h to express nitrilase and hyaluronidase. After collecting the cells from the fermentation broth, the recombinant Escherichia coli cells were lysed, and the supernatant of the cell lysate was mixed with SDS loading buffer. The sample was boiled for 15 min and then used for SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) analysis.

[0047] Detection Method for Hyaluronidase Activity

[0048] In the present invention, the reaction system consisted of 100 μL reaction buffer, 50 μL of 2 g·L -1It consists of a hyaluronic acid solution and 50 μL of bacterial culture supernatant. After reacting at 37 °C for 1 h, 40 μL of 0.8 M K2B4O7 solution was added, followed by boiling water bath for 3 min and then cooling in an ice bath. Subsequently, 1.2 mL of DMAB solution diluted with glacial acetic acid was added, and incubated at 37 °C for 20 min. The incubated reaction solution was transferred to a 96-well cell culture plate, and the absorbance was measured at 585 nm and substituted into the N-acetylglucosamine standard curve to calculate the enzyme activity. The definition of 1 enzyme activity unit (1 U) is: the amount of enzyme required to catalyze the formation of 1 nmol of N-acetylglucosamine equivalent per minute at 37 °C.

[0049] Method for detecting the activity of nitrilase

[0050] In this study, the biocatalytic reaction in the determination of nitrilase activity adopted the whole-cell catalysis method, using recombinant Escherichia coli cells expressing nitrilase as the biocatalyst, and Escherichia coli BL21(DE3)-pET3b cells as the blank control. The method for determining nitrilase activity was to mix the substrate solution (final concentration of 3-cyanopyridine was 50 mM) and nitrilase in PBS (100 mM, pH 7.2). Take 1 mL of the mixture, pre-incubate it in a thermostatic oscillator for 5 minutes, and then incubate it at 30 °C and 1500 rpm for 10 minutes. The mixture was centrifuged at a speed of 12,000 g for 1 minute to terminate the enzymatic reaction. The enzyme activity was determined by measuring the amount of ammonia produced in the reaction mixture using the phenol-hypochlorite method 30. The above substrate solution, PBS, and phenol-hypochlorite solution were all treated with boiled water to remove ammonia in the water. One unit (1 U) of enzyme activity was defined as the amount of enzyme that produced 1 μmol of ammonia per minute under the above standard conditions.

[0051] The sequences involved in the present invention are as follows:

[0052] Integration site slmA, the underlined part was replaced during the gene editing process of integrating the target fragment into the genome (SEQ ID NO.1)

[0053] tgaaggtatgctgtcacgttttgtccgcagcgaatttaaataccgcccgacggatgattttgacgcccgctggccgctaattgccgcgcagttgcagtaa tatgacgccggatgacttttcatccggcgagtttct The sgRNA gene sequence of slmA (SEQ ID NO.2)

[0054] acgccggatgacttttcatcgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaa aagtggcaccgagtcggtgc

[0055] Plpp(SEQ ID NO.3)

[0056] tttgtatatcgaagcgccctgatgggcgctttttttatttaatcgataaccagaagcaataaaaaatcaaatcggatttcactatataatctcactttatctaagatgaatccgatggaagcatcctgttttctctcaatttttttatctaaaacccagcgttcgatgcttctttgagcgaacgatcaaaaataagtgccttcccatcaaaaaaatattctcaacataaaaaactttgtgtaatacttgtaacgctacatggagattaactcaatctagagggtattaata

[0057] PgapA(SEQ ID NO.4)

[0058] ttgctcacatctcactttaatcgtgctcacattacgtgactgattctaacaaaacattaacaccaactggcaaaattttgtcctaaacttgatctcgacgaaatggctgcacctaaatcgtgatgaaaatcacatttttatcgtaattgccctttaaaattcggggcgccgaccccatgtggtctcaagcccaaaggaagagtgaggcgagtcagtcgcgtaatgcttaggcacaggattgatttgtcgcaatgattgacacgattccgcttgacgctgcgtaaggtttttgtaattttacaggcaaccttttattcactaacaaatagctggtggaatat

[0059] PssrA(SEQ ID NO.5)

[0060] ccagttcctcaccgcgcctccctctccggcggcgcgaatgaacatcttattggctatcacatccgacacaaatgttgccatcccattgcttaatcgaataaaaatcaggctacatgggtgctaaatctttaacgataacgccattgaggctggtcatggcgctcataaatctggtatacttacctttacacatt

[0061] T7 (SEQ ID NO.6)

[0062] TAATACGACTCACTATAGG

[0063] The part replaced before T7 RNA polymerase (SEQ ID NO.7)

[0064] tcgtataatgtgtggaattgtgagcggataacaatttcacacaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtgcgatcttcctgaggccgatactgtcgtcgtcccctcaaactggcagatgcacggttacgatgcgcccatctacaccaacgtgacctatcccattacggtcaatccgccgtttgttcccacggagaatccgacgggttgttactcgctcacatttaatgttgatgaaagctggctacaggaaggccagacgcgaattatttttgatggcgtcgggatctgatccggatttactaactggaagaggcactaa

[0065] alsR (SEQ ID NO.8)

[0066] TCATCTTCCCCGTCCGTGCAAAACTTCACAATCAAAAAACATTTGTGATGTTAATGAATTAAAAACACCCAAAATCGATGAATTACGCCTTCCTGATCTGTTTTACAGAGTTACATCTGACAGCGCAATAGCGTTAAAGACACTCACCATCCAGCAACATCTATCATCTAAAAAACCAGAAAAACAAATAACATCATGTTTTTAAACTAATTAAATGAAATAAAATTTTAAGCCACTCGCCATTGTTCACAATAAAATAAACTTTATAAATTTTATTTTTTTGTGAAGTCGCCAGCATCTTTTCTGTTCTTGCTGTGGTGATATAGTGGCGTCTTCAATTCAAGGACAAGAGAACGTG

[0067] asnB (SEQ ID NO.9)

[0068] ATAGCAACCACGTCTGCGGACGTGGTTGGCTCTGATGACAAACGCCAAACTGCCTGATGCGCTACGCTTATCAGGCCTACGCAGCTCCTGCAATATATTGAATTTTCATGCTTTTGTAGGCCGGATAAGGCGTTCACGCCGCATCCGGCATGAACAAATTGCACTTTGTCAGCAATTTGGCCCCCGTAAAATATAACCATTCAATAAAACCCGCTAAAAATTATCGATTCATCAATAAATACATCCTTACACCAGACCTTTTTTCACCAATCGACAATCACCATTACGTTTTTTATTTTTTCACCGCCAAATCGCTTGCGCACAGTGCTGCTTTGCGGCATTTTTTTAAACAAGCAAACACAACAAGCAACAAATACCAGGTTAACGGAGAAGGTT nitrilase (SEQ ID NO.10)

[0069]

[0070] Hyaluronidase (SEQ ID NO.11)

[0071]

[0072] RBS (SEQ ID NO.12)

[0073] TTTGTTTAACTTTAAGAAGGAGA

[0074] Example 1: Exploration of High-Expression Activity Integration Sites in the Escherichia coli Genome

[0075] The "position effect" phenomenon has a significant impact on chromosomes in the cell system, that is, the expression intensity of genes in the genome is regulated according to the specific positions of these genes on the chromosome. The Escherichia coli chromosome is divided into 4 structured macrodomains (Ori, Right, Ter, and Left) and two unstructured macrodomains (NSL and NSR) ( Figure 1 .A). We focused on the vicinity of the Ori macrostructural region. According to the investigation, we selected 18 integration sites on the genome of Escherichia coli BL21(DE3). In addition, most of the selected integration sites are located between genes, aiming to retain the original gene expression and metabolic pathways of the strain without causing damage. The green fluorescent protein gene (gfp) was expressed in the form of a constitutive T7 expression cassette, and the expression cassette was inserted into the selected 18 sites using the CRISPR-Cas9 genome editing technology ( Figure 1 .A). After constructing 18 Escherichia coli strains integrated with green fluorescent protein (GFP), their growth conditions were detected, and the results showed that the genomic insertion of the reporter gene expression cassette had no obvious effect on cell growth ( Figure 1 .B). Subsequently, these integrated strains were cultured to express GFP, and the expression levels of Escherichia coli integrated and expressed at different sites were characterized by detecting the fluorescence intensity of GFP. The results showed that there were significant differences in the expression levels of Escherichia coli with the gfp gene integrated at 18 different integration sites ( Figure 1 .C), and the expression levels of the strains with the reporter gene integrated at the 4 sites (glmS, xylA, aslA, and slmA) closest to OriC were relatively high. Among them, the difference in the expression level between the strain with the highest expression level (B-slmA) and the strain with the lowest expression level (B-melB) was 2.13-fold ( Figure 1 .C). In addition, among the remaining 17 integration sites, the relative mRNA transcription level of slmA was the highest, which was 1.85 times that of the site melB with the lowest relative mRNA level ( Figure 1 .D). Therefore, the present invention selects slmA as the high-expression activity site for subsequent integration and expression. Although the integration and expression intensity of B-slmA shows obvious advantages among the 18 strains, the expression level of the plasmid-type strain is about 1.75 times that of B-slmA, and further research is still needed to obtain an efficient integration and expression system.

[0076] Example 2: Characterization of Escherichia coli endogenous constitutive promoters

[0077] A promoter is a DNA sequence located upstream of the 5' end of a structural gene and plays a crucial role in the specific recognition and binding of RNA polymerase. At the transcriptional level, the promoter determines the starting time and intensity of the expression of the structural gene. In this invention, 16 promoters were selected from relevant key pathways such as the tricarboxylic acid cycle, glycolysis, RNA transcription, and molecular chaperones, and the constitutive expression intensities of these 16 promoters were characterized. We replaced the T7 promoter of pET-3b with these 16 promoters and inserted the gfp gene into the expression cassette. On this basis, 16 recombinant plasmid strains of Escherichia coli were constructed. The fluorescence intensity results showed that there were significant differences in the expression levels of these 16 promoters ( Figure 2 .A). Generally speaking, this group of promoters can be roughly divided into 4 categories according to the expression intensity, namely weak (PsucA, PaceE, and PmglB), low level (Pmdh, Ppgi, PldhA, and PasnB), medium level (PalsR, Picd, PrpoH, Pfnr, PgrpE, and PdnaKJ), and high level (Plpp, PgapA, and PssrA). In the case of constitutive expression, the intensities of the high-level promoters were significantly higher than that of the T7 promoter, which were 1.74, 1.75, and 2.57 times that of the T7 promoter respectively. It can be observed that multiple potential promoter expression elements can be obtained through the screening of endogenous promoters. Among them, the range from the promoter with the lowest expression level (PsucA) to the promoter with the highest expression level (PssrA) spanned 178 times.

[0078] Example 3: Characterization of the combined strength of endogenous-T7 promoters

[0079] Through the identification of endogenous promoters, 16 Escherichia coli endogenous constitutive promoters were obtained. In the case of constitutive expression, the expression intensities of 4 promoters had exceeded that of the T7 promoter. In order to obtain stronger promoters, we adopted the strategy of combining endogenous-T7 promoters and inserted these 16 endogenous promoters upstream of the T7 promoter of plasmid pET3b-GFP ( Figure 2.B), on this basis, 16 GFP-expressing strains with dual promoters were constructed. Fluorescence detection results showed that, except for PssrA-T7, the expression levels of the combined dual promoters were significantly higher than those of the endogenous promoters. Further analysis found that when the dual promoters combined with high-level promoters (Plpp, PgapA, and PssrA) were combined with the T7 promoter, they did not show the significant enhancement shown by the other 13 promoters. Nevertheless, the three dual promoters, Plpp-T7, PgapA-T7, and PssrA-T7, exerted the inherent expression advantages of themselves as single promoters, and their expression levels were still significantly better than those of the other 13 dual promoters ( Figure 1 .A, B). It is worth noting that the expression level of Plpp-T7 was 1.89 times that of Plpp and 3.30 times that of the T7 promoter ( Figure 2 .B).

[0080] After obtaining the dual promoters with high expression intensity, we constructed 10 triple promoters of endogenous-endogenous-T7 combinations to obtain combined promoters with higher expression intensity, but these results showed that the expression levels of the 10 triple promoters were all lower than that of the Plpp-T7 dual promoter ( Figure 3 .C). It can be seen that the expression of Plpp-T7 showed obvious advantages among single, dual, and triple promoters. Therefore, the present invention selects the Plpp-T7 promoter as the final promoter in the integrated expression cassette.

[0081] Example 4: Enhancement of integrated expression intensity by the Plpp-T7 promoter

[0082] In the above study, we obtained a high-expression integration site slmA and a high-expression dual promoter Plpp-T7. We speculated that combining these two aspects might further enhance the integrated expression. Therefore, we inserted the gfp expression cassette of the Plpp-T7 promoter into the slmA site of the Escherichia coli BL21(DE3) genome ( Figure 1 .A) to construct the strain B-slmA-PlppT7-GFP (BslG). The results showed that, compared with the strain with the T7 expression cassette inserted (B-slmA), the expression level of GFP in BslG was increased to 1.30 times ( Figure 3 .A, B). In addition, the expression level of the gfp gene also showed a significant increase at the transcriptional level ( Figure 3 .C). This indicates that the dual promoter Plpp-T7 constructed by combining the promoter strategy in the above study can still show an enhanced effect at the genomic level. However, despite using the high-intensity combined promoter Plpp-T7 and the high-expression activity integration site slmA, the expression level of the plasmid-expressing strain Escherichia coli BL21(DE3)-pET3b-GFP was still 1.35 times higher than that of BslG.Figure 3 . B, C), so the next step of the research will be to further enhance the expression level of BslG by modifying the chassis cells.

[0083] Example 5: Modifying Chassis Cells to Enhance the Integrative Expression Ability of Escherichia coli

[0084] In the above research, the integrative expression cassette we constructed contains the T7 promoter, which can be specifically recognized and transcribed by T7 RNA polymerase. The original T7 RNAp expression system in Escherichia coli BL21(DE3) is leaky under the control of the lactose operon by the PlacUV5 promoter ( Figure 3 . D). In the case of constitutive expression, due to the lack of induction by lactose analogs, only a small amount of T7 RNAp participates in the transcription process of the T7 promoter. Therefore, we speculate that the expression efficiency of the T7 promoter can be improved by increasing the expression of T7 RNAp in Escherichia coli cells.

[0085] The present invention aims to develop an efficient and induction-free integrative expression system to avoid the cost of adding IPTG and enable the constitutive expression of T7 RNAp. Therefore, we selected 6 promoters with different strengths ( Figure 2 . A), namely low level (Ppgi and PasnB), medium level (PalsR and PrpoH), and high level (PgapA and PssrA). At the genomic level of BslG, a series of expression elements upstream of the T7 RNAp gene were edited and replaced with these 6 promoters ( Figure 3 . D, where the replaced sequence is shown in SEQ ID NO.7, and the elements used for replacement include the promoter and RBS element), and 6 T7 RNAp expression regulation strains were constructed. Then, the GFP expression in these 6 strains was measured. The above results showed that the expression levels of BslG-alsR and BslG-asnB were 2.72 times and 2.83 times that of BslG, respectively ( Figure 3 E). More importantly, the expression levels of BslG-alsR and BslG-asnB were 1.98 times and 2.07 times that of the plasmid expression strain E. coli BL21(DE3)-pET3b-GFP, respectively. In the above research, efficient integrative expression strains BslG-alsR and BslG-asnB were obtained. Although the expression level of BslG-asnB was slightly higher than that of BslG-alsR ( Figure 3 E), considering the significant growth advantage of BslG-alsR cells ( Figure 3 F), BslG-alsR was considered more suitable as the chassis cell for integrative expression. Then, through the analysis of the transcriptional level of the gfp gene, it was found that the relative mRNA level of BslG-alsR was increased to 1.75 times that of BslG ( Figure 3.C). This indicates that by regulating the expression of T7RNAp, the mRNA content of the target gene is increased at the transcriptional level, thereby enhancing the expression level. In summary, BslG-alsR was finally selected as the strain for constructing the constitutive high-efficiency integrated expression system (CEIES_Ecoli).

[0086] Example 6: Case study on the integrated expression of nitrilase and hyaluronidase using CEIES_coli

[0087] Nitrilase can catalyze the hydrolysis of nitrile compounds into carboxylic acids and is widely used in many fields such as food, medicine, and chemical industry. To explore the application potential of the CEIES_Ecoli developed in this study, the gfp gene in the genome of Escherichia coli BslG-alsR was replaced with the nitrilase gene from Pseudomonas putida CGMCC3830 (this strain is recorded in Patent CN201110116234.9), and the integrated expression strain BslG-alsR-Nit was constructed. For comparison, we also constructed the plasmid expression strain BL21(DE3)-pET3b-Nit. The SDS-PAGE results showed that the expression level of the integrated expression strain BslG-alsR-Nit could reach a level comparable to that of the plasmid expression strain BL21(DE3)-pET3b-Nit, and the enzyme activity of BslG-alsR-Nit (22.87 U·mL -1 ) could reach 1.1 times that of BL21(DE3)-pET3b-Nit (20.81 U·mL -1 ) ( Figure 4 A, B), and the protein expression level and enzyme activity of the CEIES_Ecoli system could reach a level comparable to that of the recombinant expression Escherichia coli nitrilase reported in the literature.

[0088] Hyaluronidase is a glycosaminoglycan degrading enzyme that can specifically degrade hyaluronic acid and has high application value in the fields of medicine and medical beauty. Similarly, we used the developed CEIES_Ecoli to integrate and express the hyaluronidase from Citrobacter freundii in Escherichia coli. The results showed that the enzyme activity of the hyaluronidase integrated expression strain BslG-alsR-HylC was increased by 1.16 times compared with the plasmid-based expression strain BL21(DE3)-pET3b-HylC, reaching 12195 U·mL -1( Figure 4 .C, D).

[0089] Therefore, the above case studies on the integrated expression of nitrilase and hyaluronidase show that the recombinant strains constructed using CEIES_Ecoli can achieve stable and efficient expression without adding any antibiotics and inducers.

[0090] Obviously, the above embodiments are merely examples given for clear illustration and are not limitations on the implementation manners. For those of ordinary skill in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all implementation manners here. And the obvious changes or modifications derived therefrom still fall within the protection scope of the present invention.

Claims

1. A recombinant Escherichia coli integrating and expressing a target gene, characterized in that, The recombinant Escherichia coli includes the following modifications: integrating the target gene expression cassette at the slmA site of the Escherichia coli host genome, and replacing the regulatory element of the T7 RNA polymerase coding gene on the genome; The target gene expression cassette contains a target gene and a first promoter for initiating the expression of the target gene. The first promoter is a tandem promoter, and the tandem promoter is selected from the Plpp-T7 promoter, PgapA-T7 promoter, PssrA-T7 promoter, PgapA-Plpp-T7 promoter, PgapA-PssrA-T7 promoter, Plpp-PgapA-T7 promoter, Plpp-PssrA-T7 promoter, PssrA-PgapA-T7 promoter or PssrA-Plpp-T7 promoter; The regulatory element includes a lactose operon located upstream of the T7 RNA polymerase coding gene. The regulatory element is replaced with an element containing a second promoter, and the second promoter is selected from the PalsR promoter or PasnB promoter.

2. The recombinant Escherichia coli according to claim 1, characterized in that, The target gene expression cassette and / or the element containing the second promoter further contains an RBS; the sequence of the RBS is as shown in SEQ ID NO.

12.

3. The recombinant Escherichia coli according to claim 1, characterized in that, Integration by CRISPR; Editing elements required for integration into slmA the slmA site include sgRNA; The sequence of the sgRNA is shown in SEQ ID NO.

2.

4. The recombinant Escherichia coli according to claim 1, characterized in that, The Escherichia coli host is Escherichia coli BL21 (DE3).

5. Use of the recombinant Escherichia coli according to any one of claims 1-4 in the integrated expression of a target gene.

6. The application according to claim 5, wherein The target gene is a coding gene of an enzyme.

7. The application according to claim 6, characterized in that, The enzyme is nitrilase or hyaluronidase.

Citation Information

Patent Citations

  • Pseudomonas putida and method for producing nicotinic acid or isonicotinic acid through converting Pseudomonas putida

    CN102337233A

  • Dual cistronic bacterial expression system

    CN106661588A