Crispr enzymes and systems and applications

Abstract

The present application belongs to the field of nucleic acid editing, in particular, the field of clustered regularly interspaced short palindromic repeats (CRISPR) technology. Specifically, the present application provides a novel CRISPR enzyme (Cas enzyme), which belongs to a novel type of Cas protein and has a wide application prospect.

Description

[0001] This application claims priority to Chinese patent application CN202311097808.1, filed on August 29, 2023. This application incorporates the entire text of the aforementioned Chinese patent application. TECHNICAL FIELD

[0002] The present application relates to the field of gene editing, in particular the field of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) technology. Specifically, the present application screens a new type of Cas enzyme, and develops a corresponding gene editing tool and its application based on the new Cas enzyme. BACKGROUND

[0003] CRISPR / Cas technology is a widely used gene editing technology, which specifically binds to the target sequence on the genome through RNA guidance and cuts the DNA to produce double-strand breaks, and uses biological non-homologous end joining or homologous recombination for site-specific gene editing.

[0004] The CRISPR / Cas9 system is the most commonly used Type II CRISPR system, which recognizes the PAM motif of 3’-NGG and performs blunt-end cleavage on the target sequence. The CRISPR / Cas Type V system is a newly discovered CRISPR system, which has a motif of 5’-TTN and performs sticky-end cleavage on the target sequence, such as Cpf1, C2c1, CasX, and CasY. However, the different CRISPR / Cas systems currently available each have different advantages and disadvantages. For example, Cas9, C2c1, and CasX all require two RNA guide RNAs, while Cpf1 only requires one guide RNA and can be used for multiplex gene editing. CasX has a size of 980 amino acids, while common Cas9, C2c1, CasY, and Cpf1 usually have a size of about 1300 amino acids. In addition, the PAM sequences of Cas9, Cpf1, CasX, and CasY are complex and diverse, while C2c1 recognizes the stringent 5’-TTN, so its target site is easier to predict than other systems, thereby reducing potential off-target effects.

[0005] In summary, given that the currently available CRISPR / Cas systems are limited by some disadvantages, developing a new CRISPR / Cas system that is more robust and has good performance in multiple aspects is of great significance to the development of biotechnology. SUMMARY

[0006] The present inventors, through a large number of experiments and repeated groping, unexpectedly discovered a new type of endonuclease (Cas enzyme). Based on this discovery, the present inventors developed a new CRISPR / Cas system and gene editing methods and nucleic acid detection methods based on the system.

[0007] Cas effector protein

[0008] In one aspect, the present application provides a Cas protein, which is an effector protein in the CRISPR / Cas system, and is referred to as Cas-sf6102, Cas-sf6103, Cas-sf6117, Cas-sf6119, Cas-sf6126, Cas-sf6127, Cas-sf6129 and Cas-sf6132 in the present application, the amino acid sequences of which are shown in SEQ ID Nos. 1-8, respectively.

[0009] In one embodiment, the Cas protein amino acid sequence has at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity compared to any one of SEQ ID Nos. 1-8, and substantially retains the biological function of the sequence from which it is derived. Preferably, the Cas protein is derived from the same species as Cas-sf6102, Cas-sf6103, Cas-sf6117, Cas-sf6119, Cas-sf6126, Cas-sf6127, Cas-sf6129 or Cas-sf6132.

[0010] In one embodiment, the Cas protein amino acid sequence has one or more substitutions, deletions or additions of amino acids compared to any one of SEQ ID Nos. 1-8; and substantially retains the biological function of the sequence from which it is derived; the one or more substitutions, deletions or additions of amino acids include 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 substitutions, deletions or additions of amino acids. Preferably, the Cas protein is derived from the same species as Cas-sf6102, Cas-sf6103, Cas-sf6117, Cas-sf6119, Cas-sf6126, Cas-sf6127, Cas-sf6129 or Cas-sf6132.

[0011] In some embodiments, the Cas protein of the present application is capable of recognizing a protospacer adjacent motif (PAM), and the target nucleic acid comprises or consists of the PAM.

[0012] It is clear to those skilled in the art that the structure of a protein can be changed without adversely affecting its activity and functionality, for example, one or more conservative amino acid substitutions can be introduced into the amino acid sequence of a protein without adversely affecting the activity and / or three-dimensional structure of the protein molecule. Examples of conservative amino acid substitutions and embodiments are clear to those skilled in the art. Specifically, an amino acid residue can be replaced with another amino acid residue belonging to the same group as the site to be replaced, i.e. a non-polar amino acid residue is replaced with another non-polar amino acid residue, a polar uncharged amino acid residue is replaced with another polar uncharged amino acid residue, a basic amino acid residue is replaced with another basic amino acid residue, and an acidic amino acid residue is replaced with another acidic amino acid residue. Such a substituted amino acid residue can or can not be encoded by the genetic code. A conservative substitution in which one amino acid is replaced with another amino acid belonging to the same group is within the scope of the present application, provided that the substitution does not result in the inactivation of the biological activity of the protein. Thus, the proteins of the present application can comprise one or more conservative substitutions in the amino acid sequence, which are preferably replaced to yield according to the following table. In addition, the present application also encompasses proteins which further comprise one or more other non-conservative substitutions, provided that the non-conservative substitution does not significantly affect the desired function and biological activity of the protein of the present application.

[0013] Conservative amino acid substitutions can be made at one or more predicted non-essential amino acid residues. A "non-essential" amino acid residue is an amino acid residue that can be altered (deleted, substituted or replaced) without altering biological activity, while an "essential" amino acid residue is required for biological activity. A "conservative amino acid substitution" is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain. Amino acid substitutions can be made in non-conserved regions of the Cas proteins described above. In general, such substitutions are not made in conserved amino acid residues, or in amino acid residues that are within a conserved motif, where such residues are required for protein activity. However, it will be appreciated by one of skill in the art that functional variants can have fewer conservative or non-conservative alterations in conserved regions.

[0014] initial residue representative substitutions preferred substitutions Ala (A) Val; Leu; lie Val Arg (R) Lys; Gin; Asn Lys Asn (N) Gin; His; Lys; Arg Gin Asp (D) Glu Glu Cys (C) Ser Ser Gin (Q) Asn Asn Glu (E) Asp Asp Gly (G) Pro; Ala Ala His (H) Asn; Gin; Lys; Arg Arg lie (I) Leu; Val; Met; Ala; Phe Leu Leu (L) lie; Val; Met; Ala; Phe lie Lys (K) Arg; Gin; Asn Arg Met (M) Leu; Phe; lie Leu Phe (F) Leu; Val; lie; Ala; Tyr Leu Pro (P) Ala Ala Ser (S) Thr Thr Thr (T) Ser Ser Trp (W) Tyr; Phe Tyr Tyr (Y) Trp; Phe; Thr; Ser Phe Val (V) lie; Leu; Met; Phe; Ala Leu

[0015] It is well known in the art that one or more amino acid residues can be altered (replaced, deleted, truncated or inserted) from the N- and / or C-terminus of a protein while still retaining its functional activity. Thus, proteins having one or more amino acid residues altered from the N- and / or C-terminus of a Cas protein while retaining its desired functional activity are also within the scope of the present application. These alterations can include alterations introduced by modern molecular methods, such as PCR, including PCR amplification of a protein-encoding sequence by means of inclusion of an amino acid-encoding sequence in the oligonucleotides used in the PCR amplification to alter or extend the protein-encoding sequence.

[0016] It is recognized that proteins can be altered in a variety of ways including amino acid substitutions, deletions, truncations, and insertions, methods for which are generally known in the art. For example, amino acid sequence variants of the above-described proteins can be prepared by mutations in the DNA. They can also be prepared by other forms of mutagenesis and / or by directed evolution, for example, using known mutagenesis, recombination and / or shuffling methods, in combination with relevant screening methods, to make single or multiple amino acid substitutions, deletions and / or insertions.

[0017] As will be appreciated by those skilled in the art, these minor amino acid changes in the Cas proteins of the present application can occur (e.g., naturally-occurring mutations) or be created (e.g., using r-DNA technology) without loss of protein function or activity. If the mutations occur in the catalytic domain, active site, or other functional domain of the protein, the properties of the polypeptide can change, but the polypeptide can retain its activity. If the mutations are not near the catalytic domain, active site, or other functional domain, less impact can be expected.

[0018] As will be appreciated by those skilled in the art, essential amino acids of the Cas proteins of the present application can be identified according to methods known in the art, such as by site-directed mutagenesis or by bioinformatic analysis of the protein. The catalytic domain, active site, or other functional domain of the protein can also be determined by physical analysis of the structure, such as by nuclear magnetic resonance, crystallography, electron diffraction, or photoaffinity labeling, in combination with mutagenesis of putative key site amino acids.

[0019] In one embodiment, the Cas protein comprises an amino acid sequence as set forth in any one of SEQ ID Nos. 1-8.

[0020] In one embodiment, the Cas protein is an amino acid sequence as set forth in any one of SEQ ID Nos. 1-8.

[0021] In one embodiment, the Cas protein is a derivatized protein having the same biological function as a protein having a sequence as set forth in any one of SEQ ID Nos. 1-8.

[0022] The biological function includes, but is not limited to, the activity of binding to a guide RNA, endonuclease activity, the activity of binding to a specific site of a target sequence under the guidance of a guide RNA and cleaving, including but not limited to Cis cleavage activity and Trans cleavage activity.

[0023] The present application also provides a fusion protein comprising a Cas protein as described above and another modification moiety.

[0024] In one embodiment, the modification moiety is selected from the group consisting of another protein or polypeptide, a detectable label, or any combination thereof.

[0025] In one embodiment, the modification moiety is selected from the group consisting of an epitope tag, a reporter gene sequence, a nuclear localization signal (NLS) sequence, a targeting moiety, a transcriptional activation domain (e.g., VP64), a transcriptional repression domain (e.g., KRAB domain or SID domain), a nuclease domain (e.g., Fokl), and a domain having an activity selected from the group consisting of a nucleotide deaminase, a methylase activity, a demethylase, a transcriptional activation activity, a transcriptional repression activity, a transcriptional release factor activity, a histone modification activity, a nuclease activity, a single-stranded RNA cleavage activity, a double-stranded RNA cleavage activity, a single-stranded DNA cleavage activity, a double-stranded DNA cleavage activity, and a nucleic acid binding activity; and any combination thereof. The NLS sequence is well known to one of skill in the art, examples of which include but are not limited to the SV40 large T antigen, EGL-13, c-Myc, and TUS proteins.

[0026] In one embodiment, the NLS sequence is located at, near, or proximal to the terminus (e.g., N-terminus, C-terminus, or both) of the Cas protein of the application.

[0027] The epitope tag is well known to one of skill in the art, including but not limited to His, V5, FLAG, HA, Myc, VSV-G, Trx, and the like, and one of skill in the art can select other suitable epitope tags (e.g., for purification, detection, or tracking).

[0028] The reporter gene sequence is well known to one of skill in the art, examples of which include but are not limited to GST, HRP, CAT, GFP, HcRed, DsRed, CFP, YFP, BFP, and the like.

[0029] In one embodiment, the fusion protein of the application comprises a domain capable of binding to a DNA molecule or an intracellular molecule, such as maltose binding protein (MBP), the DNA binding domain (DBD) of Lex A, the DBD of GAL4, and the like.

[0030] In one embodiment, the fusion protein of the application comprises a detectable label, such as a fluorescent dye, e.g., FITC or DAPI.

[0031] In one embodiment, the Cas protein of the application is optionally coupled, conjugated, or fused to the modification moiety via a linker.

[0032] In one embodiment, the modification moiety is directly linked to the N-terminus or C-terminus of the Cas protein of the application.

[0033] In one embodiment, the modification moiety is linked to the N- or C-terminus of the Cas protein of the present application via a linker. Such linkers are well known in the art, examples of which include, but are not limited to, linkers comprising one or more (e.g., 1, 2, 3, 4, or 5) amino acids (e.g., Glu or Ser) or amino acid derivatives (e.g., Ahx, β-Ala, GABA, or Ava), or PEG, etc.

[0034] The Cas protein, protein derivative, or fusion protein of the present application is not limited by the way it is produced, for example, it can be produced by a genetic engineering method (recombinant technology), or by a chemical synthesis method.

[0035] Nucleic acid of a Cas protein

[0036] In another aspect, the present application provides an isolated polynucleotide comprising:

[0037] (a) a polynucleotide sequence encoding the Cas protein or fusion protein of the present application;

[0038] (b) a sequence having one or more substitutions, deletions, or additions (e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, deletions, or additions) of bases compared to the sequence shown in (a);

[0039] (c) a polynucleotide having a nucleotide sequence with a homology of ≥ 80% (preferably ≥ 90%, more preferably ≥ 95%, most preferably ≥ 98%) to the sequence shown in (a), and encoding the polypeptide shown in any one of SEQ ID Nos. 1-8; or

[0040] (d) a polynucleotide complementary to any one of the polynucleotides described in (a)-(c).

[0041] In one embodiment, the nucleotide sequence described in any one of (a)-(d) is codon-optimized for expression in a prokaryotic cell. In one embodiment, the nucleotide sequence described in any one of (a)-(d) is codon-optimized for expression in a eukaryotic cell.

[0042] In one embodiment, the polynucleotide is preferably single-stranded or double-stranded.

[0043] guide RNA (gRNA)

[0044] In another aspect, the present application provides a gRNA, the gRNA comprising a tracrRNA and a crRNA; the tracrRNA is capable of pairing with the pairing region of the crRNA to form a duplex; the crRNA further comprises a region that hybridizes to a target sequence (i.e., a targeting sequence of a target nucleic acid).

[0045] In one embodiment, the gRNA is a crRNA; the crRNA comprises a pairing region sequence capable of pairing with a tracrRNA, and further comprises a region that hybridizes to a target sequence (i.e., a targeting sequence of a targeting nucleic acid).

[0046] In one embodiment, the pairing region sequence of the crRNA and the tracrRNA is as set forth in any one of SEQ ID Nos. 9-17.

[0047] In one embodiment, the tracrRNA has a sequence as set forth in any one of SEQ ID Nos. 18-31.

[0048] In one embodiment, the gRNA (also referred to as a guide RNA or guide RNA) of the present application is composed of a crRNA and a tracrRNA molecule that form a complex in part. The crRNA comprises a complementary sequence that has sufficient complementarity to a target sequence to hybridize to the target sequence and directs a Cas enzyme to bind to the target sequence in a sequence-specific manner. The gRNA of the present application comprises a tracrRNA and a crRNA, or is composed of only a crRNA.

[0049] The targeting sequence of a targeting nucleic acid or the targeting segment of a targeting nucleic acid of the present application comprises a nucleotide sequence that is complementary to a sequence in a target nucleic acid. In other words, the targeting sequence of a targeting nucleic acid or the targeting segment of a targeting nucleic acid of the present application interacts with a target nucleic acid in a sequence-specific manner via hybridization (i.e., base pairing). Thus, the targeting sequence of a targeting nucleic acid or the targeting segment of a targeting nucleic acid can be altered, or can be modified to hybridize to any desired sequence within a target nucleic acid. The nucleic acid is selected from DNA or RNA.

[0050] The percent complementarity between the targeting sequence of a targeting nucleic acid or the targeting segment of a targeting nucleic acid and the target sequence of a target nucleic acid can be at least 60% (e.g., at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99%, or 100%).

[0051] The gRNA of the present application is capable of forming a complex with the Cas protein.

[0052] The gRNA of the Cas-sf6117 protein, Cas-sf6127 protein of the present application comprises a targeting sequence that hybridizes to a target nucleic acid, wherein the target nucleic acid comprises a sequence located at the 3' end of a protospacer adjacent motif (PAM); the aforementioned PAM sequence is 5'-TTN-3', wherein N = A / T / C / G.

[0053] The gRNA of the Cas-sf6119 protein of the present application comprises a targeting sequence hybridized with a target nucleic acid, wherein the target nucleic acid comprises a sequence located at the 3' end of a protospacer adjacent motif (PAM); the aforementioned PAM sequence is 5'-AAG-3'.

[0054] The gRNA of the Cas-sf6126 protein of the present application comprises a targeting sequence hybridized with a target nucleic acid, wherein the target nucleic acid comprises a sequence located at the 3' end of a protospacer adjacent motif (PAM); the aforementioned PAM sequence is 5'-TTC-3'.

[0055] The gRNA of the Cas-sf6129 protein of the present application comprises a targeting sequence hybridized with a target nucleic acid, wherein the target nucleic acid comprises a sequence located at the 3' end of a protospacer adjacent motif (PAM); the aforementioned PAM sequence is 5'-WWP-3', wherein W=A / T, P=G / A / C.

[0056] The gRNA of the Cas-sf6132 protein of the present application comprises a targeting sequence hybridized with a target nucleic acid, wherein the target nucleic acid comprises a sequence located at the 3' end of a protospacer adjacent motif (PAM); the aforementioned PAM sequence is 5'-WYT-3', wherein Y=C / T, W=A / T.

[0057] vector

[0058] The present application also provides a vector comprising the Cas protein, the isolated nucleic acid molecule or the polynucleotide as described above; preferably, it further comprises a regulatory element operably linked thereto.

[0059] In one embodiment, the regulatory element is selected from one or more of the following group: enhancer, transposon, promoter, terminator, leader sequence, polyadenylation sequence, marker gene.

[0060] In one embodiment, the vector comprises a cloning vector, an expression vector, a shuttle vector, an integration vector.

[0061] In some embodiments, the vector included in the system is a viral vector (such as a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated vector and a herpes simplex vector), and can also be a plasmid, a virus, a cosmid, a bacteriophage, etc., which are well known to those skilled in the art.

[0062] CRISPR system

[0063] The present invention provides an engineered non-naturally occurring vector system, or CRISPR-Cas system, comprising a Cas protein or a nucleic acid sequence encoding the Cas protein and a nucleic acid encoding one or more guide RNAs, the guide RNAs comprising a region that binds to the Cas protein and a targeting sequence that targets a nucleic acid.

[0064] In one embodiment, the nucleic acid sequence encoding the Cas protein and the nucleic acid encoding one or more guide RNAs are artificially synthesized.

[0065] In one embodiment, the nucleic acid sequence encoding the Cas protein and the nucleic acid encoding one or more guide RNAs are not naturally occurring together.

[0066] The one or more guide RNAs target one or more target sequences in a cell. The one or more target sequences hybridize to a genomic locus of a DNA molecule encoding one or more gene products and direct the Cas protein to the genomic locus of the DNA molecule encoding the one or more gene products, where the Cas protein modifies, edits, or cleaves the target sequence, whereby the expression of the one or more gene products is altered or modified.

[0067] The cells of the present invention comprise one or more of an animal, a plant, or a microorganism.

[0068] In some embodiments, the Cas protein is codon-optimized for expression in a cell.

[0069] In some embodiments, the Cas protein directs cleavage of one or two strands at the location of the target sequence.

[0070] The present invention also provides an engineered non-naturally occurring vector system, which can comprise one or more vectors, the one or more vectors comprising:

[0071] a) a first regulatory element operably linked to a gRNA, the gRNA comprising a region that binds to the Cas protein and a targeting sequence that targets a nucleic acid;

[0072] b) a second regulatory element operably linked to the Cas protein;

[0073] wherein components (a) and (b) are located on the same or different vectors of the system.

[0074] The first and second regulatory elements include promoters (e.g., constitutive promoters or inducible promoters), enhancers (e.g., 35S promoter or 35S enhanced promoter), internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences).

[0075] In some embodiments, the vectors in the system are viral vectors (e.g., retroviral vectors, lentiviral vectors, adenoviral vectors, adeno-associated vectors, and herpes simplex vectors), and can also be plasmids, viruses, cosmids, bacteriophages, and the like, which are well known to those skilled in the art.

[0076] In some embodiments, the system provided herein is in a delivery system. In some embodiments, the delivery system is a nanoparticle, a liposome, an exosome, a microvesicle, and a gene gun.

[0077] In one embodiment, the target sequence is a DNA or RNA sequence from a prokaryotic cell or a eukaryotic cell. In one embodiment, the target sequence is a non-naturally occurring DNA or RNA sequence.

[0078] In one embodiment, the target sequence is present within a cell. In one embodiment, the target sequence is present within a nucleus or within a cytoplasm (e.g., organelle). In one embodiment, the cell is a eukaryotic cell. In other embodiments, the cell is a prokaryotic cell.

[0079] In one embodiment, the Cas protein is linked to one or more NLS sequences. In one embodiment, the fusion protein comprises one or more NLS sequences. In one embodiment, the NLS sequence is linked to the N-terminus or C-terminus of the protein. In one embodiment, the NLS sequence is fused to the N-terminus or C-terminus of the protein.

[0080] In another aspect, the present application relates to an engineered CRISPR system comprising the above-mentioned Cas protein and one or more guide RNAs, wherein the guide RNA comprises a region that binds to the Cas protein and a targeting sequence that targets a nucleic acid, and the Cas protein is capable of binding to the guide RNA and targeting a target nucleic acid sequence complementary to the targeting sequence.

[0081] In one embodiment, the Cas enzyme is Cas-sf6117 or Cas-sf6127, the target nucleic acid is DNA (preferably, double-stranded DNA), the target nucleic acid is located at the 3' end of a protospacer-adjacent motif (PAM), and the PAM is 5'-TTN-3', wherein N = A / T / C / G.

[0082] In one embodiment, the Cas enzyme is Cas-sf6119, the target nucleic acid is DNA (preferably, double-stranded DNA), the target nucleic acid is located at the 3' end of a protospacer-adjacent motif (PAM), and the PAM is 5'-AAG-3'.

[0083] In one embodiment, the Cas enzyme is Cas-sf6126, the target nucleic acid is DNA (preferably, double-stranded DNA), the target nucleic acid is located at the 3' end of a protospacer-adjacent motif (PAM), and the PAM is 5'-TTC-3'.

[0084] In one embodiment, the Cas enzyme is Cas-sf6129, the target nucleic acid is DNA (preferably, double-stranded DNA), the target nucleic acid is located at the 3' end of a protospacer-adjacent motif (PAM), and the PAM is 5'-WWP-3', wherein W = A / T, P = G / A / C.

[0085] In one embodiment, the Cas enzyme is Cas-sf6132, the target nucleic acid is DNA (preferably, double-stranded DNA), the target nucleic acid is located at the 3' end of a protospacer-adjacent motif (PAM), and the PAM is 5'-WYT-3', wherein Y = C / T, W = A / T.

[0086] protein-nucleic acid complex / composition

[0087] In another aspect, the present application provides a complex or composition comprising:

[0088] (i) a protein component selected from the group consisting of: a Cas protein, a derivatized protein or a fusion protein as described above, and any combination thereof; and

[0089] (ii) a nucleic acid component selected from the group consisting of: a gRNA, or a nucleic acid encoding said gRNA, or a precursor RNA of said gRNA, or a precursor RNA nucleic acid encoding said gRNA; said gRNA comprising a region that binds to said Cas protein and a targeting sequence that targets a nucleic acid;

[0090] The protein component and the nucleic acid component are associated with each other to form a complex.

[0091] In one embodiment, the nucleic acid component is a guide RNA in a CRISPR-Cas system.

[0092] In one embodiment, the complex or composition is non-naturally occurring or modified. In one embodiment, at least one component of the complex or composition is non-naturally occurring or modified. In one embodiment, the first component is non-naturally occurring or modified; and / or, the second component is non-naturally occurring or modified.

[0093] activated CRISPR complex

[0094] In another aspect, the present application also provides an activated CRISPR complex, comprising: (1) a protein component selected from the group consisting of: a Cas protein, a derivatized protein or a fusion protein of the present application, and any combination thereof; (2) a nucleic acid component selected from the group consisting of: a gRNA, or a nucleic acid encoding the gRNA, or a precursor RNA of the gRNA, or a precursor RNA nucleic acid encoding the gRNA; the gRNA comprising a region that binds to the Cas protein and a targeting sequence that targets a nucleic acid; and (3) a target sequence that binds to the gRNA. Preferably, the binding is by the targeting sequence of the targeting nucleic acid on the gRNA to the target nucleic acid.

[0095] As used herein, the term "activated CRISPR complex", "activated complex" or "ternary complex" refers to the complex of a Cas protein, a gRNA and a target nucleic acid after binding or modification by the CRISPR system.

[0096] The Cas protein and the gRNA of the present application can form a binary complex that is activated upon binding to a nucleic acid substrate that is complementary to the targeting sequence in the gRNA, forming an activated CRISPR complex. In some embodiments, the targeting sequence of the gRNA is perfectly matched to the target substrate. In other embodiments, the targeting sequence of the gRNA is partially (contiguously or non-contiguously) matched to the target substrate.

[0097] In preferred embodiments, the activated CRISPR complex can exhibit a collateral nuclease cleavage activity, which refers to the non-specific cleavage activity or the random cleavage activity exhibited by the activated CRISPR complex to a single-stranded nucleic acid, also known in the art as trans cleavage activity.

[0098] delivery and delivery composition

[0099] The Cas proteins, gRNAs, fusion proteins, nucleic acid molecules, vectors, systems, complexes and compositions of the application can be delivered by any method known in the art. Such methods include, but are not limited to, electroporation, lipofection, nucleofection, microinjection, sonoporation, biolistics, calcium phosphate-mediated transfection, cationic transfection, liposome transfection, dendrimer transfection, heat shock transfection, nucleofection, magnetofection, lipofection, perforation transfection, optical transfection, reagent-enhanced nucleic acid uptake, and delivery via liposomes, immunoliposomes, viral particles, artificial virions, and the like.

[0100] Thus, in another aspect, the application provides a delivery composition comprising a delivery vehicle, and one or any number of the following selected from the group consisting of: a Cas protein, a fusion protein, a nucleic acid molecule, a vector, a system, a complex and a composition of the application.

[0101] In one embodiment, the delivery vehicle is a particle.

[0102] In one embodiment, the delivery vehicle is selected from the group consisting of a lipid particle, a sugar particle, a metal particle, a protein particle, a liposome, an exosome, a microvesicle, a biolistic particle or a viral vector (e.g. a replication-defective retrovirus, a lentivirus, an adenovirus or an adeno-associated virus).

[0103] host cell

[0104] The application also relates to a cell or cell line or progeny thereof in vitro, ex vivo or in vivo, said cell or cell line or progeny thereof comprising: a Cas protein, a fusion protein, a nucleic acid molecule, a protein-nucleic acid complex, an activated CRISPR complex, a vector, a delivery composition of the application.

[0105] In certain embodiments, the cell is a prokaryotic cell.

[0106] In certain embodiments, the cell is a eukaryotic cell. In certain embodiments, the cell is a mammalian cell. In certain embodiments, the cell is a human cell. In certain embodiments, the cell is a non-human mammalian cell, e.g. a cell of a non-human primate, a bovine, an ovine, a porcine, a canine, a monkey, a rabbit, a rodent (e.g. a rat or a mouse). In certain embodiments, the cell is a non-mammalian eukaryotic cell, e.g. a cell of an avian bird (e.g. a chicken), a fish or a crustacean (e.g. a clam, a shrimp). In certain embodiments, the cell is a plant cell, e.g. a cell of a monocotyledonous or dicotyledonous plant or of a cultivated plant or food crop such as cassava, maize, sorghum, soybean, wheat, oat or rice, e.g. a cell of an alga, a tree or a plant producing a fruit or a vegetable (e.g. a tree such as a citrus tree, a nut tree; a solanaceous plant, cotton, tobacco, tomato, grape, coffee, cacao, etc.).

[0107] In some embodiments, the cell is a stem cell or a stem cell line.

[0108] In some cases, the host cell of the present application comprises a modification of a gene or genome that is not present in its wild type.

[0109] gene editing methods and applications

[0110] The Cas protein, nucleic acid, composition, CIRSPR / Cas system, vector system, delivery composition, or activated CRISPR complex, or host cell of the present application can be used for any one or any number of the following uses: targeting and / or editing a target nucleic acid; cleaving double-stranded DNA, single-stranded DNA, or single-stranded RNA; non-specifically cleaving and / or degrading collateral nucleic acids; non-specifically cleaving single-stranded nucleic acids; nucleic acid detection; detecting nucleic acids in a target sample; specifically editing double-stranded nucleic acids; base editing double-stranded nucleic acids; base editing single-stranded nucleic acids. In other embodiments, it can also be used for preparing a reagent or kit for any one or any number of the above uses.

[0111] The present application also provides the use of the above-mentioned Cas protein, nucleic acid, composition, CIRSPR / Cas system, vector system, delivery composition, or activated CRISPR complex in gene editing, gene targeting, or gene cleavage; or, in the preparation of a reagent or kit for gene editing, gene targeting, or gene cleavage.

[0112] In one embodiment, the gene editing, gene targeting, or gene cleavage is performed in a cell and / or outside of a cell.

[0113] The present application also provides a method of editing, targeting, or cleaving a target nucleic acid, comprising contacting the target nucleic acid with the above-mentioned Cas protein, nucleic acid, composition, CIRSPR / Cas system, vector system, delivery composition, or activated CRISPR complex. In one embodiment, the method is performed in a cell or outside of a cell.

[0114] The gene editing or editing a target nucleic acid includes modifying a gene, knocking out a gene, altering expression of a gene product, repairing a mutation, and / or inserting a polynucleotide, mutating a gene.

[0115] The editing can be performed in a prokaryotic cell and / or a eukaryotic cell.

[0116] In another aspect, the present application also provides use of the above-mentioned Cas protein, nucleic acid, above-mentioned composition, above-mentioned CRISPR / Cas system, above-mentioned vector system, above-mentioned delivery composition, or above-mentioned activated CRISPR complex in nucleic acid detection, or in the preparation of a reagent or kit for nucleic acid detection.

[0117] In another aspect, the present application also provides a method of cleaving a single-stranded nucleic acid, the method comprising contacting a population of nucleic acids with the above-mentioned Cas protein and gRNA, wherein the population of nucleic acids comprises a target nucleic acid and a plurality of non-target single-stranded nucleic acids, the Cas protein cleaving the plurality of non-target single-stranded nucleic acids.

[0118] The gRNA is capable of binding to the Cas protein.

[0119] The gRNA is capable of targeting the target nucleic acid.

[0120] The contacting can be in vitro, ex vivo, or inside a cell in vivo.

[0121] Preferably, the cleaving of the single-stranded nucleic acid is non-specific.

[0122] In another aspect, the present application also provides use of the above-mentioned Cas protein, nucleic acid, above-mentioned composition, above-mentioned CRISPR / Cas system, above-mentioned vector system, above-mentioned delivery composition, or above-mentioned activated CRISPR complex in non-specific cleaving of a single-stranded nucleic acid, or in the preparation of a reagent or kit for non-specific cleaving of a single-stranded nucleic acid.

[0123] In another aspect, the present application also provides a kit for gene editing, gene targeting, or gene cleaving, the kit comprising the above-mentioned Cas protein, gRNA, nucleic acid, above-mentioned composition, above-mentioned CRISPR / Cas system, above-mentioned vector system, above-mentioned delivery composition, above-mentioned activated CRISPR complex, or above-mentioned host cell.

[0124] In another aspect, the present application also provides a kit for detecting a target nucleic acid in a sample, the kit comprising: (a) a Cas protein, or a nucleic acid encoding the Cas protein; (b) a guide RNA, or a nucleic acid encoding the guide RNA, or a precursor RNA comprising the guide RNA, or a nucleic acid encoding the precursor RNA; and (c) a single-stranded nucleic acid detector that is single-stranded and does not hybridize to the guide RNA.

[0125] It is known in the art that the precursor RNA can be cleaved or processed into the above-mentioned mature guide RNA.

[0126] In another aspect, the invention provides use of the above-mentioned Cas protein, nucleic acid, above-mentioned composition, above-mentioned CIRSPR / Cas system, above-mentioned vector system, above-mentioned delivery composition, above-mentioned activated CRISPR complex or above-mentioned host cell in the manufacture of a medicament or kit for:

[0127] (i) gene or genome editing;

[0128] (ii) target nucleic acid detection and / or diagnosis;

[0129] (iii) modifying a biological or non-human organism by editing a target sequence in a target locus;

[0130] (iv) treatment of a disease;

[0131] (v) targeting a target gene;

[0132] (vi) cleaving a gene of interest.

[0133] Preferably, the above-mentioned gene or genome editing is performed in or outside a cell.

[0134] Preferably, the above-mentioned target nucleic acid detection and / or diagnosis is performed in vitro.

[0135] Preferably, the above-mentioned treatment of a disease is treatment of a condition caused by a defect in a target sequence in a target locus.

[0136] In another aspect, the invention provides a method of detecting a target nucleic acid in a sample, the method comprising contacting the sample with the above-mentioned Cas protein, gRNA (guide RNA) and single-stranded nucleic acid detector, the gRNA comprising a region that binds to the Cas protein and a guide sequence that hybridizes to the target nucleic acid; detecting a detectable signal produced by cleavage of the single-stranded nucleic acid detector by the Cas protein, thereby detecting the target nucleic acid; the single-stranded nucleic acid detector does not hybridize to the gRNA.

[0137] methods of specifically modifying a target nucleic acid

[0138] In another aspect, the invention also provides a method of specifically modifying a target nucleic acid, the method comprising: contacting the target nucleic acid with the above-mentioned Cas protein, nucleic acid, above-mentioned composition, above-mentioned CIRSPR / Cas system, above-mentioned vector system, above-mentioned delivery composition or above-mentioned activated CRISPR complex.

[0139] The specific modification can occur in vivo or in vitro.

[0140] The specific modification can occur in or outside a cell.

[0141] In some cases, the cell is selected from a prokaryotic cell or a eukaryotic cell, e.g., an animal cell, a plant cell, or a microbial cell.

[0142] In one embodiment, the modification refers to a break of the target sequence, e.g., a single / double strand break of DNA, or a single strand break of RNA.

[0143] In some cases, the method further comprises contacting the target nucleic acid with a donor polynucleotide, wherein the donor polynucleotide, a portion of the donor polynucleotide, a copy of the donor polynucleotide, or a portion of the copy of the donor polynucleotide is integrated into the target nucleic acid.

[0144] In one embodiment, the modification further comprises inserting an editing template (e.g., an exogenous nucleic acid) into the break.

[0145] In one embodiment, the method further comprises contacting an editing template with the target nucleic acid, or delivering into a cell comprising the target nucleic acid. In this embodiment, the method repairs the broken target gene by homologous recombination with an exogenous template polynucleotide; in some embodiments, the repair results in a mutation, including an insertion, a deletion, or a substitution of one or more nucleotides of the target gene, in other embodiments, the mutation results in one or more amino acid changes in a protein expressed from a gene comprising the target sequence.

[0146] detection (non-specific cleavage)

[0147] In another aspect, the present application provides a method of detecting a target nucleic acid in a sample, the method comprising contacting the sample with the above-mentioned Cas protein, nucleic acid, above-mentioned composition, above-mentioned CIRSPR / Cas system, above-mentioned vector system, above-mentioned delivery composition, or above-mentioned activated CRISPR complex and single-stranded nucleic acid detector; detecting a detectable signal generated by the cleavage of the single-stranded nucleic acid detector by the Cas protein, thereby detecting the target nucleic acid.

[0148] In the present application, the target nucleic acid comprises ribonucleotides or deoxyribonucleotides; includes single-stranded nucleic acids, double-stranded nucleic acids, e.g., single-stranded DNA, double-stranded DNA, single-stranded RNA, double-stranded RNA.

[0149] In one embodiment, the target nucleic acid is derived from a sample of virus, bacteria, microorganism, soil, water source, human body, animal, plant, etc. Preferably, the target nucleic acid is a product enriched or amplified by PCR, NASBA, RPA, SDA, LAMP, HAD, NEAR, MDA, RCA, LCR, RAM, etc.

[0150] In one embodiment, the target nucleic acid is a viral nucleic acid, a bacterial nucleic acid, a specific nucleic acid associated with a disease, such as a specific mutation site or SNP site or a nucleic acid that differs from a control; preferably, the virus is a plant virus or an animal virus, for example, a papillomavirus, a hepadnavirus, a herpesvirus, an adenovirus, a poxvirus, a parvovirus, a coronavirus; preferably, the virus is a coronavirus, preferably, SARS, SARS-CoV2 (COVID-19), HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, Mers-Cov.

[0151] In the present application, the gRNA has at least 50% match with the target sequence on the target nucleic acid, preferably at least 60%, preferably at least 70%, preferably at least 80%, preferably at least 90%.

[0152] In one embodiment, when the target sequence contains one or more characteristic sites (such as specific mutation sites or SNPs), the characteristic sites are completely matched with the gRNA.

[0153] In one embodiment, the detection method can comprise one or more gRNAs with different guide sequences targeting different target sequences.

[0154] In the present application, the single-stranded nucleic acid detector includes but is not limited to single-stranded DNA, single-stranded RNA, DNA-RNA hybrid, nucleic acid analog, base modifier, and single-stranded nucleic acid detector containing abasic spacer, etc.; "nucleic acid analog" includes but is not limited to: locked nucleic acid, bridged nucleic acid, morpholino nucleic acid, glycol nucleic acid, hexitol nucleic acid, threose nucleic acid, arabino nucleic acid, 2'oxymethyl RNA, 2'methoxyacetyl RNA, 2'fluoro RNA, 2'amino RNA, 4'thio RNA and combinations thereof, including optional ribonucleotide or deoxyribonucleotide residues.

[0155] In the present application, the detectable signal is achieved by the following ways: visual detection, sensor-based detection, color detection, fluorescence signal-based detection, gold nanoparticle-based detection, fluorescence polarization, colloidal phase change / dispersion, electrochemical detection and semiconductor-based detection.

[0156] In the present application, preferably, the single-stranded nucleic acid detector is provided with a fluorescent group and a quencher group at its two ends, respectively, and can exhibit a detectable fluorescent signal after the single-stranded nucleic acid detector is cleaved. The fluorescent group is selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red, or LC RED460; and the quencher group is selected from one or any of BHQ1, BHQ2, BHQ3, Dabcy1, or Tamra.

[0157] In other embodiments, the 5' end and the 3' end of the single-stranded nucleic acid detector are respectively provided with different labeling molecules, and the colloidal gold detection method is used to detect the colloidal gold test results of the single-stranded nucleic acid detector before and after being cleaved by the Cas protein; the single-stranded nucleic acid detector before and after being cleaved by the Cas protein will exhibit different color development results on the colloidal gold detection line and the quality control line.

[0158] In some embodiments, the method of detecting a target nucleic acid can further include comparing the level of the detectable signal to a reference signal level, and determining the amount of the target nucleic acid in the sample based on the level of the detectable signal.

[0159] In some embodiments, the method of detecting a target nucleic acid can further include using RNA reporter nucleic acids and DNA reporter nucleic acids (e.g., fluorescent colors) on different channels, and determining the level of the detectable signal by measuring the signal level of the RNA and DNA reporter molecules, and by measuring the amount of the target nucleic acid in the RNA and DNA reporter molecules, based on the combination (e.g., using the minimum or product) of the level of the detectable signal to sample.

[0160] In one embodiment, the target gene is present in a cell.

[0161] In one embodiment, the cell is a prokaryotic cell.

[0162] In one embodiment, the cell is a eukaryotic cell.

[0163] In one embodiment, the cell is an animal cell.

[0164] In one embodiment, the cell is a human cell.

[0165] In one embodiment, the cell is a plant cell, such as a cell of a cultivated plant (e.g., cassava, corn, sorghum, wheat, or rice), an alga, a tree, or a vegetable.

[0166] In one embodiment, the target gene is present in a nucleic acid molecule (e.g., a plasmid) outside the cell.

[0167] In one embodiment, the target gene is present in a plasmid.

[0168] term definitions

[0169] In the present application, the scientific and technical terms used herein have the meanings commonly understood by a person skilled in the art, unless otherwise specified. Also, the molecular genetic, nucleic acid chemical, chemical, molecular biological, biochemical, cell culture, microbiological, cell biological, genomic, and recombinant DNA procedures used herein are conventional procedures widely used in the corresponding fields. At the same time, in order to better understand the present application, the definitions and explanations of related terms are provided below.

[0170] In the present application, the amino acid residues can be represented by single letters or by three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamine (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine (Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), arginine (Arg, R).

[0171] Cas protein

[0172] In the present application, Cas protein, Cas enzyme, Cas effector protein can be used interchangeably; the present inventors first discovered and identified a Cas effector protein having an amino acid sequence selected from the following:

[0173] (i) any one of SEQ ID No. 1-8;

[0174] (ii) a sequence having one or more substitutions, deletions or additions of amino acids (for example 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 substitutions, deletions or additions of amino acids) compared to any one of SEQ ID No. 1-8; or

[0175] (iii) a sequence having at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to the sequence set forth in any one of SEQ ID Nos. 1-8.

[0176] Nucleic acid cleavage or cleaving a nucleic acid herein includes: a DNA or RNA break in a target nucleic acid produced by a Cas enzyme described herein (Cis cleavage), a DNA or RNA break in a side branch nucleic acid substrate (single stranded nucleic acid substrate) (i.e., non-specific or non-targeted, Trans cleavage). In some embodiments, the cleavage is a double stranded DNA break. In some embodiments, the cleavage is a single stranded DNA break or a single stranded RNA break.

[0177] CRISPR system

[0178] As used herein, the term "Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)-CRISPR-associated (Cas) (CRISPR-Cas) system" or "CRISPR system" are used interchangeably and have the meaning generally understood by those skilled in the art, which generally includes a transcription product or other element related to the expression of a CRISPR-associated ("Cas") gene, or a transcription product or other element capable of directing the activity of the Cas gene.

[0179] CRISPR / Cas complex

[0180] As used herein, the term "CRISPR / Cas complex" refers to a complex formed by the binding of a guide RNA or mature crRNA to a Cas protein, which complex is capable of recognizing and cleaving a polynucleotide to which the guide RNA hybridizes.

[0181] guide RNA (guide RNA, gRNA)

[0182] As used herein, the terms "guide RNA" (gRNA), "mature crRNA," and "guide sequence" are used interchangeably and have the meaning generally understood by one of skill in the art. Generally, a guide RNA comprises a tracrRNA as well as a crRNA; the tracrRNA is capable of pairing to the pairing region of the crRNA to form a duplex; the crRNA further comprises a region that hybridizes to a target sequence (i.e., a targeting sequence of a target nucleic acid). Alternatively, a guide RNA is a crRNA; the crRNA comprises a pairing region sequence that is capable of pairing to a tracrRNA, and further comprises a region that hybridizes to a target sequence (i.e., a targeting sequence of a target nucleic acid).

[0183] In certain instances, a targeting sequence is any polynucleotide sequence that has sufficient complementarity to a target sequence such that it hybridizes to the target sequence and directs specific binding of a CRISPR / Cas complex to the target sequence. In one embodiment, the degree of complementarity between a targeting sequence and its corresponding target sequence, when optimally aligned, is at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or at least 99%. Determining optimal alignment is within the capabilities of one of skill in the art. For example, there are published and commercially available alignment algorithms and programs such as, but not limited to, ClustalW, Smith-Waterman in matlab, Bowtie, Geneious, Biopython, and SeqMan.

[0184] target sequence

[0185] A "target sequence" refers to a polynucleotide targeted by a targeting sequence in a gRNA, e.g., a sequence that has complementarity to the targeting sequence, wherein hybridization between the target sequence and the targeting sequence will facilitate formation of a CRISPR / Cas complex (comprising a Cas protein and a gRNA). Perfect complementarity is not required, so long as there is sufficient complementarity to cause hybridization and facilitate formation of a CRISPR / Cas complex.

[0186] A target sequence can comprise any polynucleotide, such as DNA or RNA. In certain instances, the target sequence is located within a cell or outside of a cell. In certain instances, the target sequence is located in the nucleus or cytoplasm of a cell. In certain instances, the target sequence can be located within an organelle of a eukaryotic cell, such as a mitochondrion or a chloroplast. A sequence or template that can be used for recombination into a target locus comprising the target sequence is referred to as an "editing template" or "editing polynucleotide" or "editing sequence." In one embodiment, the editing template is an exogenous nucleic acid. In one embodiment, the recombination is homologous recombination.

[0187] In the present application, "target sequence" or "target polynucleotide" or "target nucleic acid" can be any endogenous or exogenous polynucleotide to a cell (e.g., a eukaryotic cell). For example, the target polynucleotide can be a polynucleotide present in the nucleus of a eukaryotic cell. The target polynucleotide can be a sequence encoding a gene product (e.g., a protein) or a non-coding sequence (e.g., a regulatory polynucleotide or junk DNA). In some cases, the target sequence should be associated with a protospacer adjacent motif (PAM).

[0188] single-stranded nucleic acid detector

[0189] The single stranded nucleic acid detector of the present application refers to a sequence containing 2-200 nucleotides, preferably, 2-150 nucleotides, preferably, 3-100 nucleotides, preferably, 3-30 nucleotides, preferably, 4-20 nucleotides, more preferably, 5-15 nucleotides. Preferably, it is a single stranded DNA molecule, a single stranded RNA molecule or a single stranded DNA-RNA hybrid.

[0190] The single stranded nucleic acid detector comprises different reporter groups or labeling molecules at both ends, which do not present a reporter signal when it is in the initial state (i.e., uncut state), and presents a detectable signal after it is cut, i.e., presents a detectable difference before and after cutting.

[0191] In one embodiment, the reporter groups or labeling molecules comprise a fluorescent group selected from one or any of FAM, FITC, VIC, JOE, TET, CY3, CY5, ROX, Texas Red or LC RED460; and a quenching group selected from one or any of BHQ1, BHQ2, BHQ3, Dabcy1 or Tamra.

[0192] In one embodiment, the single stranded nucleic acid detector has a first molecule (such as FAM or FITC) attached to the 5' end and a second molecule (such as biotin) attached to the 3' end. The reaction system containing the single stranded nucleic acid detector is used in conjunction with a flow strip to detect the target nucleic acid (preferably, a colloidal gold detection method). The flow strip is designed to have two capture lines, with an antibody to the first molecule (i.e., first molecule antibody) at the sample contact end (colloidal gold), an antibody to the first molecule antibody at the first line (control line), and an antibody to the second molecule (i.e., second molecule antibody, such as avidin) at the second line (test line). As the reaction flows along the strip, the first molecule antibody binds to the first molecule carrying the cleaved or uncleaved oligonucleotide to the capture lines, the cleaved reporter will bind to the antibody to the first molecule antibody at the first capture line, and the uncleaved reporter will bind to the second molecule antibody at the second capture line. The binding of the reporter group at each line will result in a strong readout / signal (e.g., color). As more reporter is cleaved, more signal will accumulate at the first capture line, and less signal will appear at the second line. In certain aspects, the present application relates to the use of a flow strip as described herein for detecting a nucleic acid. In certain aspects, the present application relates to a method of detecting a nucleic acid using a flow strip as defined herein, such as a (lateral) flow test or a (lateral) flow immuno-chromatographic assay. In certain aspects, the molecules in the single stranded nucleic acid detector can be replaced by each other, or the position of the molecules can be changed, as long as the reporting principle is the same or similar to the present application, and the improved ways are also included in the present application.

[0193] The detection method described in the present application can be used for quantitative detection of the target nucleic acid to be detected. The quantitative detection index can be quantified according to the signal strength of the reporter group, such as the luminescence intensity of the fluorescent group, or the width of the color developing strip, etc.

[0194] wild type

[0195] As used herein, the term "wild type" has the meaning generally understood by those skilled in the art, which means the typical form of an organism, strain, gene, or characteristic that distinguishes it from a mutant or variant form when it occurs in nature, which can be isolated from a source in nature and has not been intentionally modified by man.

[0196] derivatization

[0197] As used herein, the term "derivatized" refers to a chemical modification of an amino acid, polypeptide, or protein, in which one or more substituents have been covalently attached to the amino acid, polypeptide, or protein. The substituents can also be referred to as side chains.

[0198] A derivatized protein is a derivative of the protein, typically, derivatization of the protein does not adversely affect the desired activity of the protein (e.g., activity of binding to a guide RNA, endonuclease activity, activity of binding to and cleaving a target sequence at a specific site under the guidance of a guide RNA), that is, the derivative of the protein has the same activity as the protein.

[0199] derivatized protein

[0200] Also referred to as a "protein derivative," refers to a modified form of a protein, e.g., in which one or more amino acids of the protein can be deleted, inserted, modified and / or substituted.

[0201] non-naturally occurring

[0202] As used herein, the terms "non-naturally occurring" or "engineered" are used interchangeably and indicate artificial involvement. When these terms are used to describe a nucleic acid molecule or polypeptide, it indicates that the nucleic acid molecule or polypeptide is at least substantially isolated from at least another component with which it is associated in nature or as found in nature.

[0203] orthologue

[0204] As used herein, the term "orthologue" has the meaning generally understood by those skilled in the art. As a further guide, an "orthologue" of a protein as described herein refers to a protein belonging to a different species which performs the same or a similar function as the protein of which it is an orthologue.

[0205] identity

[0206] As used herein, the term "identity" is used in reference to the matching of sequences between two polypeptides or between two nucleic acids. When a position in each of two sequences being compared is occupied by the same base or amino acid monomer subunit (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine), then the molecules are identical at that position. The "percentage of identity" between two sequences is a function of the number of matching positions shared by the sequences divided by the number of positions compared x 100. For example, if 6 of 10 positions in two sequences are matched then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (3 of 6 positions are matched). Typically, the comparison is made over the length of the sequences being compared, after aligning the two sequences to produce maximum identity. Such alignment can be achieved by methods such as that of Needleman et al. (1970) J. Mol. Biol. 48:443-453, which can be conveniently performed by computer program such as the Align program (DNAstar, Inc.). Percentage identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl. Biosci., 4: 11-17 (1988)) as integrated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. In addition, percentage identity between two amino acid sequences can be determined using the algorithm of Needleman and Wunsch (J MoI Biol. 48:444-453 (1970)) as implemented in the GAP program in the GCG software package (available at www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a gap length weight of 1, 2, 3, 4, 5, or 6.

[0207] vector

[0208] The term "vector" refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors include, but are not limited to, nucleic acid molecules that are single-stranded, double-stranded, or partially double-stranded; nucleic acid molecules that comprise one or more free ends, no free ends (e.g., circular), nucleic acid molecules that comprise DNA, RNA, or both; and other varieties of nucleic acids known in the art. A vector can be introduced into a host cell by transformation, transduction, or transfection, and the resulting genetically modified host cell can express the genetic material elements carried by the vector. A vector can be introduced into a host cell to thereby produce a transcript, protein, or peptide, including a protein, fusion protein, isolated nucleic acid molecule, etc. (e.g., a CRISPR transcript, such as a nucleic acid transcript, protein, or enzyme) as described herein. A vector can contain a variety of control elements, including but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, a vector can contain a replication origin.

[0209] One type of vector is a "plasmid," which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted, such as by standard molecular cloning techniques.

[0210] Another type of vector is a viral vector, wherein virally-derived DNA or RNA sequences are present in the vector for packaging into a virus (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno-associated viruses). Viral vectors also include polynucleotides carried by a virus for transfection into a host cell. Certain vectors (e.g., bacterial vectors with a bacterial origin of replication and episomal mammalian vectors) are capable of autonomous replication in a host cell into which they are introduced.

[0211] Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell and thereby are replicated along with the host genome. Moreover, certain vectors are capable of directing expression of genes to which they are operatively linked. Such vectors are referred to herein as "expression vectors."

[0212] host cell

[0213] As used herein, the term "host cell" refers to a cell that can be used to introduce a vector, including but not limited to, prokaryotic cells such as E. coli or Bacillus subtilis, and eukaryotic cells such as microbial cells, fungal cells, animal cells, and plant cells.

[0214] Those of skill in the art will appreciate that the design of the expression vector can depend on such factors as the choice of the host cell to be transformed, the level of expression of the desired gene, etc.

[0215] regulatory element

[0216] As used herein, the term "regulatory element" is intended to include promoters, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals, such as polyadenylation signals and poly-U sequences), which are described in detail in Goeddel, GENE EXPRESSION TECHNOLOGY: METHODS IN ENZYMOLOGY 185, Academic Press, San Diego, CA (1990). In certain instances, regulatory elements include those that direct constitutive expression of a nucleotide sequence in many types of host cells as well as those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can direct expression primarily in a desired tissue of interest, such as muscle, neuronal, bone, skin, blood, a particular organ (e.g., liver, pancreas), or a particular cell type (e.g., lymphocytes). In certain instances, regulatory elements can also direct expression in a temporal-dependent manner, such as in a cell cycle-dependent or developmental stage-dependent manner, which can or can not be tissue- or cell type-specific. In certain instances, the term "regulatory element" encompasses enhancer elements, such as the WPRE; the CMV enhancer; the R-U5' segment in the LTR of HTLV-I ((Mol. Cell. Biol., vol. 8(1), pp. 466-472, 1988); the SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit beta-globin (Proc. Natl. Acad. Sci. USA., vol. 78(3), pp. 1527-31, 1981).

[0217] promoter

[0218] As used herein, the term "promoter" has its art-understood meaning and refers to a non-coding nucleotide sequence located upstream of a gene that initiates expression of the downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked with a polynucleotide encoding or specifying a gene product, results in production of the gene product in a cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked with a polynucleotide encoding or specifying a gene product, results in production of the gene product in a cell essentially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked with a polynucleotide encoding or specifying a gene product, results in production of the gene product in a cell essentially only when the cell is of the tissue type to which the promoter corresponds.

[0219] NLS

[0220] A "nuclear localization signal" or "nuclear localization sequence" (NLS) is an amino acid sequence that "tags" a protein for import into the nucleus by nuclear transport, i.e., a protein with an NLS is transported to the nucleus. Typically, an NLS comprises positively charged Lys or Arg residues that are exposed on the surface of the protein. Exemplary nuclear localization sequences include, but are not limited to, NLS from SV40 large T antigen, EGL-13, c-Myc, and TUS protein. In some embodiments, the NLS comprises a PKKKRKV sequence. In some embodiments, the NLS comprises an AVKRPAATKKAGQAKKKKLD sequence. In some embodiments, the NLS comprises a PAAKRVKLD sequence. In some embodiments, the NLS comprises a MSRRRKANPTKLSENAKKLAKEVEN sequence. In some embodiments, the NLS comprises a KLKIKRPVK sequence. Other nuclear localization sequences include, but are not limited to, the acidic M9 domain of hnRNP Al, the sequence KIPIK in the yeast transcriptional repressor Matα2, and PY-NLS.

[0221] operably linked

[0222] As used herein, the term "operably linked" is intended to mean that a nucleotide sequence of interest is linked to the one or more regulatory elements in a manner that allows expression of the nucleotide sequence (e.g., in an in vitro transcription / translation system or, when the vector is introduced into a host cell, in the host cell).

[0223] complementarity

[0224] As used herein, the term "complementarity" refers to the ability of a nucleic acid to form one or more hydrogen bonds with another nucleic acid sequence by virtue of traditional Watson-Crick or other non-traditional types of bonding. Percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g., Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 is 50%, 60%, 70%, 80%, 90%, and 100% complementary). "Perfect complementarity" indicates that all consecutive residues of a nucleic acid sequence form hydrogen bonds with the same number of consecutive residues in a second nucleic acid sequence. "Substantially complementary" as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to hybridization under stringent conditions of two nucleic acids.

[0225] stringent conditions

[0226] As used herein, "stringent conditions" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence will hybridize primarily to that target sequence and not to non-target sequences. Stringent conditions are often sequence dependent, and are varied depending on many factors. In general, the longer the sequence, the higher the temperature at which the sequence will specifically hybridize to its target sequence.

[0227] hybridization

[0228] The terms "hybridize" or "complementary" or "substantially complementary" refer to the non-covalent binding of nucleotides of a nucleic acid (e.g., RNA, DNA) to another nucleic acid by means of complementary base pairing and / or G / U base pairing, "annealing" or "hybridizing" in a sequence-specific, anti-parallel fashion (i.e., nucleic acid specifically binds to complementary nucleic acid).

[0229] Hybridization requires that the two nucleic acids contain complementary sequences, although mismatches between bases can occur. Suitable conditions for hybridization between two nucleic acids depend on the length and complementarity of the nucleic acids, which are variables known in the art. Typically, the length of the hybridizable nucleic acid is 8 nucleotides or more (e.g., 10 nucleotides or more, 12 nucleotides or more, 15 nucleotides or more, 20 nucleotides or more, 22 nucleotides or more, 25 nucleotides or more, or 30 nucleotides or more).

[0230] It is understood that the sequence of a polynucleotide need not be 100% complementary to the sequence of its target nucleic acid to hybridize specifically thereto. A polynucleotide can comprise 60% or more, 65% or more, 70% or more, 75% or more, 80% or more, 85% or more, 90% or more, 95% or more, 98% or more, 99% or more, 99.5% or more, or 100% complementarity to the sequence of the target region in the sequence of the target nucleic acid to which it hybridizes.

[0231] Hybridization of a target sequence to a gRNA means that at least 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleic acid sequences of the target sequence and the gRNA can hybridize, forming a complex; or that at least 12, 15, 16, 17, 18, 19, 20, 21, 22, or more bases of the nucleic acid sequences of the target sequence and the gRNA can base pair, hybridizing to form a complex.

[0232] expression

[0233] As used herein, the term "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (e.g., transcribed into mRNA or other RNA transcript) and / or the process by which a transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. Transcripts and encoded polypeptides can be collectively referred to as "gene product." If the polynucleotide is derived from genomic DNA, expression can include splicing of the mRNA in a eukaryotic cell.

[0234] linker

[0235] As used herein, the term "linker" refers to a linear polypeptide formed by the linkage of a plurality of amino acid residues via peptide bonds. The linkers of the present application can be artificial synthetic amino acid sequences, or naturally occurring polypeptide sequences, such as polypeptides having a hinge region function. Such linker polypeptides are well known in the art (see, e.g., Holliger, P. et al. (1993) Proc. Natl. Acad. Sci. USA 90:6444-6448; Poljak, R.J. et al. (1994) Structure 2:1121-1123).

[0236] treatment

[0237] As used herein, the term "treatment" refers to the treatment or cure of a disorder, the delay of onset of symptoms of a disorder, and / or the delay of progression of a disorder.

[0238] subject

[0239] As used herein, the term "subject" includes, but is not limited to, various animals, plants, and microorganisms.

[0240] animal

[0241] For example, a mammal, for example, a bovine, equine, ovine, porcine, canine, feline, leporid, rodent (e.g., a mouse or rat), non-human primate (e.g., a macaque or cynomolgus monkey), or a human. In certain embodiments, the subject (e.g., a human) has a disorder (e.g., a disorder resulting from a disease-associated gene defect).

[0242] plant

[0243] The term "plant" is to be understood as any differentiated multicellular organism capable of photosynthesis, including crop plants at any stage of maturation or development, in particular monocotyledonous or dicotyledonous plants, vegetable crops, including artichokes, Brussels sprouts, cress, leeks, asparagus, lettuce (e.g. head lettuce, leaf lettuce, long-leaf lettuce), bok choy, yellow fleshed yam, melons (e.g. muskmelons, watermelons, crenshaw melons, cantaloupes, Roman melons), oilseed crops (e.g. curd-forming brassicas, cabbages, cauliflowers, broccoli, kale, collards, Chinese cabbage, bok choy), artichokes, radishes, napa, okra, onions, celery, parsley, chickpeas, parsnips, chicory, peppers, potatoes, gourds (e.g. zucchini, cucumbers, small zucchini, squashes, pumpkins), radishes, dry bulb onions, turnip rape, eggplants (also known as aubergines), burdock, endive, green onions, scorzonera, garlic, spinach, green onions, squashes, greens, sugar beets and fodder beets, sweet potatoes, Swiss chard, wasabi, tomatoes, turnips, and spices; fruits and / or vine crops, such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, aronia, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus, blueberries, boysenberries, cranberries, currants, goji berries, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pomes, melons, mangoes, papayas, and lychees; field crops, such as clover, alfalfa, meadow grass, meadow grass, corn / maize (fodder corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain crops (barley, oats, rye, wheat, etc.), sorghum, tobacco, cotton, legumes (beans, lentils, peas, soybeans), oil plants (rape, mustard, olives, sunflowers, coconuts, castor oil plants, cocoa beans, groundnuts), Arabidopsis, fiber plants (cotton, flax, jute), lauraceae (cinnamon, camphor), or a plant such as coffee, sugar cane, tea, and natural rubber plants; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants, and trees such as forests (broad-leaved trees and evergreens, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, and shrubs and other young plants.

[0244] beneficial effects of the invention

[0245] The present application discovers a new type of Cas enzyme, Blast results show that the Cas enzyme of the present application has low consistency with the Cas enzyme reported, belongs to a new type of Cas protein, and has wide application prospect.

[0246] Embodiments of the present application will be described in detail below with reference to the attached drawings and examples, but those skilled in the art will understand that the following drawings and examples are only for the purpose of illustrating the present application, and are not a limitation on the scope of the present application. Various objects and advantageous aspects of the present application will become apparent to those skilled in the art from the following detailed description of the preferred embodiments in conjunction with the accompanying drawings. BRIEF DESCRIPTION OF DRAWINGS

[0247] Figure 1 Fluorescence result map of Cas-sf6102 for nucleic acid detection.

[0248] Figure 2 Fluorescence result map of Cas-sf6103 for nucleic acid detection.

[0249] Figure 3 PAM structure of Cas-sf6117.

[0250] Figure 4 PAM structure of Cas-sf6119.

[0251] Figure 5 PAM structure of Cas-sf6126.

[0252] Figure 6 PAM structure of Cas-sf6127.

[0253] Figure 7 PAM structure of Cas-sf6129.

[0254] Figure 8 PAM structure of Cas-sf6132.

[0255] SEQUENCE INFORMATION

[0256]

[0257] DETAILED DESCRIPTION

[0258] The following examples merely illustrate the application and are not intended to limit the application in any way. The experiments and methods described in the examples were performed essentially as described in the art and as described in various references unless otherwise indicated. For example, the general techniques of immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, among others, used in the present application can be found in Sambrook, Fritsch, and Maniatis, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd ed. (1989); CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (F. M. Ausubel et al. eds., (1987)); the series METHODS IN ENZYMOLOGY (Academic Press, Inc.): PCR 2: A PRACTICAL APPROACH (M. J. MacPherson, B. D. Hames, and G. R. Taylor eds. (1995), Harlow and Lane, ANTIBODIES, A LABORATORY MANUAL, eds. (1988); and ANIMAL CELL CULTURE (R. I. Freshney, ed. (1987)).

[0259] In addition, where particular conditions are not specified in the examples, those conditions were performed under routine conditions or as suggested by the manufacturer. Where the manufacturer of reagents or instruments is not indicated, it is intended that the reagents or instruments used were of a routine variety available from a commercial vendor. Those skilled in the art will recognize that the examples describe the present application in terms of preferred embodiments and are not intended to limit the scope of the application as claimed. All publications and other references mentioned herein are incorporated by reference in their entirety.

[0260] Example 1. Obtaining of Cas proteins

[0261] The inventors analyzed the metagenome of the uncultured material, and identified 8 new CRISPR-Cas enzymes through de-redundancy and protein clustering analysis. Blast results showed that the Cas proteins had low sequence identity with the reported Cas proteins, which were named Cas-sf6102, Cas-sf6103, Cas-sf6117, Cas-sf6119, Cas-sf6126, Cas-sf6127, Cas-sf6129 and Cas-sf6132 in the present application; the amino acid sequences of the above proteins are shown in Table 1, the sequence of the pairing region of the crRNA and the tracrRNA corresponding to the Cas protein is shown in Table 2, and the predicted tracrRNA sequence according to different proteins is shown in Table 3.

[0262] Table 1. Amino acid sequences of Cas proteins

[0263]

[0264]

[0265] Table 2. Sequence of the pairing region of the crRNA and the tracrRNA corresponding to the Cas protein

[0266] SEQ ID No. Cas protein crRNA pairing region sequence 9 Cas-sf6102 guggcaaucgggucgaacgcucggucagacugcaac 10 Cas-sf6103 gucgcaauggucgcgaaguccugcugggauugcgag 11 Cas-sf6103 gucgcaauggucgcgaaguccagaugggauugcgag 12 Cas-sf6117 auuguuaacgacccuuuuuugcgguguaguucgagg 13 Cas-sf6119 guccgccccacgggcgcggggaacggucg 14 Cas-sf6126 cuugcaacucauguaugaguauaaaaugcgag 15 Cas-sf6127 guuucugaggaaacuaugugugaugugaag 16 Cas-sf6129 ggaugcuucuuguacgcauuugcgaguugaagg 17 Cas-sf6132 guugcacccuucacgggugcguggauugaaac

[0267] Table 3. tracrRNA sequence corresponding to the Cas protein

[0268]

[0269]

[0270]

[0271] Example 2. Application of Cas-sf6102 and Cas-sf6103 proteins in nucleic acid detection

[0272] This embodiment verifies the trans cleavage activity of Cas-sf6102 and Cas-sf6103 respectively through in vitro detection. In this embodiment, gRNA that can pair with the target nucleic acid is used to guide Cas-sf6102 and Cas-sf6103 protein to recognize and bind to the target nucleic acid; then, Cas-sf6102 and Cas-sf6103 protein triggers the trans cleavage activity to any single-stranded nucleic acid, thereby cutting the single-stranded nucleic acid detector in the system; the two ends of the single-stranded nucleic acid detector are respectively provided with a fluorescent group and a quenching group, if the single-stranded nucleic acid detector is cut, fluorescence will be excited; in other embodiments, the two ends of the single-stranded nucleic acid detector can also be provided with markers that can be detected by colloidal gold.

[0273] The target nucleic acid in this embodiment is single-stranded DNA, N-B-i3g1-ssDNA, and its sequence is: CGACATTCCGAAGAACGCTGAAGCGCTGGGGGCAAATTGTGCAATTTGCGGC;

[0274] The crRNA sequence of the Cas-sf6102 protein is:

[0275] GUGGCAAUCGGGUCGAACGCUCGGUCAGACUGCAAC CCCCCAGCGCUUCAGCGU UC (The underlined region is the region targeting the target nucleic acid);

[0276] The crRNA sequence of the Cas-sf6103 protein is:

[0277] GUCGCAAUGGUCGCGAAGUCCUGCUGGGAUUGCGAG CCCCCAGCGCUUCAGCGU UC (The underlined region is the region targeting the target nucleic acid);

[0278] The sequence of the single-stranded nucleic acid reporter molecule is FAM-TTATT-BHQ1.

[0279] The following reaction system is used: the final concentration of Cas-sf6102 and Cas-sf6103 is 100 nM, the final concentration of crRNA is 200 nM, the final concentration of the target nucleic acid is 200 nM, and the final concentration of the single-stranded nucleic acid reporter molecule is 500 nM. Incubate at 37°C, and read the FAM fluorescence / 20 s. The control group does not add the target nucleic acid.

[0280] As shown in Figure 1 compared with the control without adding the target nucleic acid, Cas-sf6102 can cut the single-stranded nucleic acid reporter molecule for detection in the system in the presence of the target nucleic acid, quickly reporting fluorescence; in the absence of the target nucleic acid, the fluorescence signal does not change. The above experiments reflect that Cas-sf6102 can be used for the detection of target nucleic acid in combination with a single-stranded nucleic acid reporter molecule. Figure 1 In the above table, 1 is the control group without adding the target nucleic acid, and 2 is the experimental group with adding the target nucleic acid.

[0281] As shown in Figure 2 compared with the control without adding the target nucleic acid, Cas-sf6103 can cut the single-stranded nucleic acid reporter molecule for detection in the system in the presence of the target nucleic acid, quickly reporting fluorescence; in the absence of the target nucleic acid, the fluorescence signal does not change. The above experiments reflect that Cas-sf6103 can be used for the detection of target nucleic acid in combination with a single-stranded nucleic acid reporter molecule. Figure 2 In the above table, 1 is the control group without adding the target nucleic acid, and 2 is the experimental group with adding the target nucleic acid.

[0282] Example 3. PAM identification of Cas-sf6117 and Cas-sf6119 proteins

[0283] Construct PAM library, synthetic sequence:

[0284] CGTGTTTCGTAAAGTCTGGAAACGCGGAAGCCCCCAGCGCTTCAGCGTTCNNNNNNTCCCCTACGTGCTGCTGAAGTTGCCCGCAA, N is random deoxynucleotide, underlined is target sequence. After Klenow enzyme filling, connect into pacyc184 vector. After transforming E. coli, extract plasmid to form PAM library. The sequence of gRNA Cas-sf6117-tracr is:

[0285] auagcccaagggcaauugcguaugcgucagucguaggccgacucgaacggccugaacgaugagucaaagucacauauaagu ggaaaaacuauguuucccauuguguucgcucaccaauacacgcaaauuuuuucagguagaauucguuuaacgaauu, Cas-sf6117-cr-5'spacer1 sequence is:

[0286] auuguuaacgacccuuuuuugcgguguaguucgagg uccccuacgugcugcugaag (underlined area is targeting area);

[0287] Primer sequence: TK-117: CGGCATTCCTGCTGAACCGCTCTTCCGATCT;

[0288] TK-111: GATCGGAAGAGCGGTTCAGCAGGAATGCCG;

[0289] PAM-after-F: ACTCAGGGGTCTTCGGTTTCCGTGTT;

[0290] S6-PAM-after: ACTCAGCTGAACCGCTCTTCCG;

[0291] Preparation of Cas-sf6117 protein PAM library: 50 nM Cas-sf6117 protein, 50 nM gRNA (tracr+cr) were incubated in buffer Tris-HAC 40 mM, Mg(AC)2 30 mM, BSA 120 μg / ml, DTT 12 mM, pH 7.0 at 25 °C for 10 min. PAM library plasmid (10 ng / μL) was added and incubated at 37 °C for 1 h; incubated at 85 °C for 20 min. 2.5 U DreamTaq DNA Polymerase (5 U / μL) (Thermo Fisher Scientific) and 4 μL 2.5 mM dNTP Mix (all kinds of gold) were added and incubated at 72 °C for 30 min to fill in the cut end and add A at the 3' end. The above product was purified by kit (Omega Gel Extraction Kit D2500). The primers TK-117 and TK-111 were annealed and ligated with the above product by T4 ligase. The ligated product was subjected to PCR reaction by primers PAM-after-F and S6-PAM-after to obtain Cas-sf6117 protein PAM library. The PCR product was subjected to second-generation sequencing, and the PAM sequence was obtained by analysis. The results are shown in Table 1, and the main PAM sequence recognized by Cas-sf6117 is 5'-TTN-3', wherein N=A / T / C / G. Figure 3

[0292] The above method was used to identify Cas-sf6119 protein PAM. The sequence of gRNA Cas-sf6119-tracr was: acacgtcgcctgcgacgcgcgggagacggaaaacgcccgtggagctcctgtaagacctgctgcccctcggggccgcagctcttcaggggcagtgaagcgggaagacaccgggcctccgggtctggtgccaccccagcggagtgatccgctggcgttccccagcccagcccatgagc, and the sequence of Cas-sf6119-cr-5'spacer1 was: guccgccccacgggcgcggggaacggucg uccccuacgugcugcugaag (underlined region is the targeting region);

[0293] Primer sequence: TK-117: CGGCATTCCTGCTGAACCGCTCTTCCGATCT;

[0294] TK-111: GATCGGAAGAGCGGTTCAGCAGGAATGCCG; ​

[0295] PAM-after-F: ACTCAGGGGTCTTCGGTTTCCGTGTT;

[0296] S6-PAM-after: ACTCAGCTGAACCGCTCTTCCG;

[0297] PAM sequences were obtained by analysis, and the results were plotted using Weblogo, as shown below. Figure 4 The PAM sequence recognized by Cas-sf6119 was 5'-AAG-3'.

[0298] Example 4. PAM identification of Cas-sf6126, Cas-sf6127, Cas-sf6129 and Cas-sf6132 proteins

[0299] Construction of Cas-sf6126 protein expression plasmid: After human codon optimization of nucleic acid sequence, gene synthesis was performed, and it was connected into E. coli expression vector PeT28(a)+ vector. JM23119 promoter was added in the vector PeT28(a)+-Cas-sf6126 to start Cas-sf6126 gRNA transcription. The formed vector was: PeT28(a)+-Cas-sf6126-JM23119-gRNA, and the gRNA sequence was:

[0300] gugcgaaauauaaguaaacauuugggguggcucgacacccugaaaccgagaaguagcauaaauccacaauugaugugguugauuaacacucgguaagguaagacgguucgcaccgucugaaauuucaggcauaaaagaccgccugaacauuaaauaauuauacaugaauugcaauuaaaauaacucgcacuuuauauguauauaagcauugaaaugccgaaacuugcaacucauguaugaguauaaaaugcgag uccccuacgugcugcugaaguugc The underlined sequence is the target sequence; the PAM library was constructed: the sequence CGTGTTTCGTAAAGTCTGGAAACGCGGAAGCCCCCAGCGCTTCAGCGTTCNNNNNN TCCCCTACGTGCTGCTGAAGTTGC CCGCAA, N is a random deoxynucleotide, and the underlined sequence is the target sequence. After Klenow enzyme filling, it was connected into pacyc184 vector. After transformation of E. coli, plasmid was extracted to form a PAM library.

[0301] PAM library subtraction experiment: preparation of competent cells: BL21 (DE3)- PeT28 (a) +-Cas-sf6126-JM23119-gRNA. PAM library plasmid transformation of competent cells: BL21 (DE3)-PeT28 (a) +-Cas-sf6126-JM23119-gRNA, coated on LB plates containing kanamycin, chloramphenicol, and after overnight culture at 37°C, the bacterial cells were collected, the bacterial liquid concentration was adjusted to OD600 0.6-0.8, 0.2 mM IPTG was added, and 37°C induction was performed for 4 h. FastPure EndoFree Plasmid Maxi Kit (vazyme) was used for plasmid extraction to obtain the PAM library after subtraction. Primer: PAM-F: GGTCTTCGGTTTCCGTGTT; PAM-R: TGGCGTTGACTCTCAGTCAT. 30 ng / μL plasmid (PAM library) as template primer for PCR reaction to obtain control group samples, and 30 ng / μL plasmid (PAM library after subtraction) as template for PCR reaction to obtain experimental group samples. The control group samples and experimental group samples were sent for second-generation sequencing for data analysis.

[0302] The main PAM structure of Cas-sf6126 is 5'-TTC-3', as shown in Figure 5 .

[0303] The above method was used to identify the PAM of Cas-sf6127 protein. The vector was formed: PeT28 (a) +-Cas-sf6127-JM23119-gRNA, and the gRNA sequence was:

[0304] gcucuggggcgauucagcguccuuaagucgagaagugccguguacagcgucuuggucuagcgguaacacucgauaagguaguccugucuaacaggcugaaacccuagccacaaaauccggcuaggcaucauacauagaaagucgucgaucuacaaucguggaaaguuucugaggaaacuaugugugaugugaag uccccuacgugcugcugaaguugc The underlined part is the target sequence. The main PAM structure of Cas-sf6127 is 5'-TTN-3', wherein N=A / T / C / G, as shown in Figure 6 .

[0305] The above method was used to identify the PAM of Cas-sf6129 protein. The vector was formed: PeT28 (a) +-Cas-sf6129-JM23119-gRNA, and the gRNA sequence was:

[0306] GAAAGCAAAAAAGAAGUGCGAACCUCAAGCGAACGGCUGACUGCCGGAGG GUCGCAUCGCAUUAUGGGGCGACUUCUCGUCGCAAUCGAGAAAGUGGC GGUACUUUGUAUUUUACAGUUCGCAAUACACUCGAAAAGGUU AAGGUG CAAAAAUAAUCCGUGCACGACCGCAAUAAUGUGUGACAUUUCGGA AAGGAUGCUUCUUGUACGCAUUUGCGAGUUGAAGG uccccuacgugcugcugaaguugc The underlined sequence is the target sequence. The PAM structure obtained for Cas-sf6129 is 5'-WWP-3', wherein W=A / T, P=G / A / C, as shown in Figure 7 .

[0307] The above method was used to identify the PAM of Cas-sf6132 protein. The vector was formed: PeT28(a)+-Cas-sf6132-JM23119-gRNA, and the gRNA sequence was:

[0308] AAAGAGCAUCGCAGCCUCAAGCAAUUAACA AUUAGGGUGGU GGGCACCCUUA AAGUGAGAAAGUGGCUAAGUUCGG

[0309] UUGAGACAACGUUGGCAUACGCUCACUA AUCCUCUGACGAAAGAGGAACCCUGACGAA AUGUCAUCAAUCCAUAGGUAAA

[0310] A AUACGGUUCGCGGAAAAGCUUGAGAAAGUUGCACCCUUCACGGGUGC GUGGAUUGAAAC uccccuac gugcugcugaaguugc The underlined sequence is the target sequence. The PAM structure obtained for Cas-sf6132 is 5'-WYT-3', wherein Y=C / T, W=A / T, as shown in Figure 8 .

[0311] Example 5. Editing efficiency of Cas-sf6126, Cas-sf6127, Cas-sf6129 and Cas-sf6132 proteins in animal cells ​

[0312] The Cas-sf6126 gene editing activity was verified in animal cells. The vector pcDNA3.3 was modified to carry an ECFP fluorescent protein gene. The SV40 NLS-Cas-sf6126-NLS fusion protein was inserted through the enzyme cutting site BsmB1; the U6 promoter and gRNA sequence were inserted through the enzyme cutting site Mfe1. The CMV promoter initiated the expression of the fusion protein SV40 NLS-Cas-sf6126-NLS-ECFP. The protein Cas-sf6126-NLS was connected to the protein ECFP using the connecting peptide T2A. The pUC19 vector was modified, and the EF-1a promoter initiated the expression of the tdTomato-T2A-GF(5spacer1 24bp)FP gene. After the Cas-sf6126 protein recognized the target 5spacer1 24bp and edited it, the proportion of GFP positive cells in CFP and tdTomato double positive cells was analyzed to determine the editing efficiency of the Cas-sf6126 protein.

[0313] Plating: 293T cells were plated at a confluence of 70-80%, and the number of cells seeded in a 12-well plate was 1.5*10^5 cells / well.

[0314] Transfection: Transfection was performed 12-24h after plating. 2ul Hieff Trans TM Liposome nucleic acid transfection reagent, mix well, room temperature for 5 minutes; 100ul opti-MEM added 1ug plasmid (pcDNA3.3:pUC19=1:1), mix well. Diluted Hieff Trans TM Liposome nucleic acid transfection reagent was mixed with diluted plasmid, incubated at room temperature for 20min. The mixed solution was added to the culture medium with cells for transfection, and the transfection was replaced with normal culture medium 24h later and continued to culture for 24h. Flow cytometry was used for analysis.

[0315] The analysis results showed that the editing efficiency of Cas-sf6126 was 3.44%.

[0316] The same method as described above was used to verify the editing efficiency of Cas-sf6127, Cas-sf6129 and Cas-sf6132, and the results showed that the editing efficiency of Cas-sf6127 was 0.16%; the editing efficiency of Cas-sf6129 was 10.41%; and the editing efficiency of Cas-sf6132 was 4.21%.

[0317] While the specific embodiments of the application have been described in detail, those skilled in the art will appreciate that various modifications and alterations to the details can be made within the scope of the application as disclosed in the teachings of the present application. The entire disclosure of the application is set out in the accompanying claims and any equivalents thereof.

Claims

1. A Cas protein, characterized in that, The amino acid sequence of the Cas protein is shown in SEQ ID No.

7.

2. A fusion protein comprising the Cas protein of claim 1 and other modified portions.

3. An isolated polynucleotide, characterized in that, The polynucleotide is a polynucleotide sequence encoding the Cas protein of claim 1, or a polynucleotide sequence encoding the fusion protein of claim 2.

4. A carrier, characterized in that, The vector comprises the polynucleotide of claim 3 and a regulatory element operatively linked thereto.

5. A CRISPR-Cas system, characterized in that, The system includes the Cas protein of claim 1 and at least one gRNA capable of binding to the Cas protein, the gRNA including a region for binding to the Cas protein and a targeting sequence for the target nucleic acid.

6. A composition, characterized in that, The composition comprises: (i) A protein component selected from: the Cas protein of claim 1 or the fusion protein of claim 2; (ii) A nucleic acid component selected from: gRNA, or nucleic acid encoding said gRNA, or precursor RNA of said gRNA, or precursor RNA nucleic acid encoding said gRNA, said gRNA including a region that binds to the Cas protein of claim 1 and a targeting sequence of the targeting nucleic acid; The protein components and nucleic acid components combine to form a complex.

7. An engineered host cell, said cell being a non-animal / plant cell, characterized in that, The host cell comprises the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6.

8. The application of the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6, or the host cell of claim 7 in gene editing, wherein the application is for purposes other than disease diagnosis and treatment; Alternatively, in the preparation of a formulation or kit for use in gene editing.

9. A method for editing a target nucleic acid, the method being a method for non-disease diagnosis and treatment purposes, the method comprising contacting the target nucleic acid with the Cas protein of claim 1, or the fusion protein of claim 2, or the polynucleotide of claim 3, or the vector of claim 4, or the CRISPR-Cas system of claim 5, or the composition of claim 6, or the host cell of claim 7.

Images