Hevea brasiliensis microRNA477 and its application

Abstract

The present invention provides a rubber tree microRNA477 and its application, a microRNA related to latex development, named microRNA477, the nucleotide sequence of which is as shown in SEQ ID NO: 1, and the present invention also provides a precursor gene encoding the microRNA, the nucleic acid sequence of which is as shown in SEQ ID NO: 2. The present invention clones and obtains a precursor gene encoding a rubber tree non-coding RNA from a rubber tree for the first time, and studies show that the microRNA477 encoded by the gene is related to latex development of the rubber tree, and its expression is significantly upregulated by coronatine induction, and the precursor gene can be transformed into dandelion to significantly increase the number of dandelion latex cells, which has important application prospects in the future transgenic improvement of rubber-producing plants rubber trees and dandelions in terms of the number of latex and natural rubber yield.

Description

Technical Field

[0001] The present invention belongs to the technical field of genetic engineering, and specifically relates to a rubber tree microRNA477 and an application thereof. Background Art

[0002] Hevea brasiliensis ( Hevea brasiliensis Rubber tree (Hevea brasiliensis) is a tree of the Euphorbiaceae family, native to the Amazon River Basin in South America, and mainly distributed in tropical regions. More than 98% of the world's natural rubber comes from rubber trees. Latices are the site of natural rubber synthesis and storage. The number of latex tubes in the trunk bark is significantly positively correlated with natural rubber production. Therefore, the regulatory mechanism of latex tube development is a scientific issue that urgently needs to be solved in rubber tree biological breeding.

[0003] Non-coding RNA refers to RNA that does not encode proteins. Recent studies have found that their proportion in the genome increases with the evolutionary level of species. Many non-coding RNAs can interact with proteins, DNA or RNA and participate in a variety of cellular activities. Non-coding RNAs are divided into two categories according to their length: one is long non-coding RNA (lncRNA) with a length of more than 200 nucleotides; the other is small RNA (sRNA), which is generally 20~31 bp in length, including small interfering RNA (siRNA, 19~25 bp), PIWI protein-binding RNA (piRNA, 26~31 bp) and microRNA (miRNA, 20~22 bp). Among them, miRNAs play a very important regulatory role in plant growth and development, cell differentiation and adaptation to adversity. Many studies have found that miRNAs are involved in regulating the development of plant roots, stems, leaves, flowers and other organs. Summary of the invention

[0004] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a rubber tree microRNA477 and an application thereof.

[0005] The first aspect of the present invention is to provide a microRNA related to the development of the milk duct, named as microRNA477 (hereinafter also referred to as "miRNA477" or "miR477"), the nucleotide sequence of which is shown in SEQ ID NO:1.

[0006] The second aspect of the present invention is to provide a precursor gene encoding the microRNA described in the first aspect of the present invention, and its nucleic acid sequence is shown in SEQ ID NO:2.

[0007] The third aspect of the present invention is to provide a recombinant vector containing the precursor gene described in the second aspect of the present invention.

[0008] The original vector of the recombinant vector can be a vector commonly used in the field of gene recombination, such as a virus, a plasmid, etc. The present invention is not limited to this. In a specific embodiment of the present invention, the original vector is a pB7WG2D vector, etc., but it should be understood that the present invention can also use other plasmids, or viruses, etc.

[0009] The fourth aspect of the present invention is to provide a host bacterium or a transgenic cell line or a recombinant bacterium containing the precursor gene of the second aspect of the present invention.

[0010] The fifth aspect of the present invention is to provide the use of the microRNA as described in the first aspect of the present invention, or the precursor gene as described in the second aspect of the present invention, or the recombinant vector as described in the third aspect of the present invention, or the host bacteria or transgenic cell line or recombinant bacteria as described in the fourth aspect of the present invention in increasing the number of plant laticifer cells and / or laticifers.

[0011] Preferably, the plant is dandelion.

[0012] Among them, the microRNA described in the first aspect of the present invention, or the precursor gene described in the second aspect of the present invention, or the recombinant vector described in the third aspect of the present invention, or the host bacteria or transgenic cell line or recombinant bacteria described in the fourth aspect of the present invention increases the number of plant laticifer cells and / or laticifers but does not change the plant phenotype.

[0013] The sixth aspect of the present invention is to provide use of the microRNA as described in the first aspect of the present invention or the precursor gene as described in the second aspect of the present invention in the corresponding coronatine.

[0014] The microRNA described in the first aspect of the present invention or the precursor gene described in the second aspect of the present invention is significantly up-regulated by coronatine.

[0015] The seventh aspect of the present invention is to provide a primer pair, wherein the primer pair is: pB7WG2D-miR477-F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGGGGTTAGTTGCGAGAAGCTCTT-3' and reverse primer pB7WG2D-miR477-R: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCCGGCA CTGCTGGAAGCCCT-3'; or the primer pair is: pre-MIR477-F: 5'- GGGGTTAGTTGCGAGAAGCTCTT -3', pre-MIR477-R: 5'-CCGGCACTGCTGGAAGCCCT -3'.

[0016] The present invention cloned a precursor gene encoding a non-coding RNA of a rubber tree from a rubber tree for the first time. Studies have shown that the microRNA 477 encoded by the gene is related to the latex development of the rubber tree, and its expression is significantly upregulated by coronatine induction. Transforming the precursor gene into dandelion can significantly increase the latex cells of the dandelion, and has important application prospects in the future in the genetically modified improvement of the latex number and natural rubber yield of rubber trees and dandelions producing rubber. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is the expression pattern of miR477 in the bark of rubber tree treated with coronatine (COR) in Example 2. The expression of miR477 is upregulated by COR.

[0018] Figure 2 PCR detection of the resistance gene Bar and miR477 precursor in transgenic dandelion plants of rubber tree miR477 precursor.

[0019] Figure 3 The results of fluorescence quantitative expression of miR477 in wild-type dandelion (WT) and dandelion overexpressing miR477 precursor (miR477-OE).

[0020] Figure 4 The microscopic structure of the root of wild-type dandelion (WT) and dandelion overexpressing miR477 precursor (miR477-OE). The red arrows indicate the laticifer cells.

[0021] Figure 5 Statistics of root laticifer cell index of wild-type dandelion (WT) and dandelion overexpressing miR477 precursor (miR477-OE).

[0022] Figure 6Wild-type dandelion (WT) and dandelion plants overexpressing miR477 precursor (miR477-OE). DETAILED DESCRIPTION

[0023] The present invention will be further described below with reference to the accompanying drawings in conjunction with specific embodiments to better understand the present invention. Where specific techniques or conditions are not indicated in the embodiments, the techniques or conditions described in the literature in this area or the product specifications are used. Where the manufacturer of the reagents or instruments used is not indicated, they are all conventional products that can be obtained commercially.

[0024] Example 1: miR477 precursor gene pre-MIR477 Clone

[0025] The inner bark of rubber tree Reyan 7-33-97 was used as the material, and the genomic DNA was extracted using the TIANGEN DNAsecure new plant genomic DNA extraction kit (DP320). TaKaRa PrimeSTAR® MaxDNA Polymerase Ver.2 was used, and DNA was used as the template. PCR amplification was performed using the forward primer pB7WG2D-miR477-F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGGGGTTAGTTG CGAGAAGCTCTT-3' and the reverse primer pB7WG2D-miR477-R: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCCGGCACTGCTGGAAGCCCT-3'. The PCR amplification system was 50ul: PrimeSTAR Max Ver.2 Premix (2X) 25 μL, forward and reverse primers (10 μM) 2.5 μL each, DNA template 2 μL, ddH2O 18 μL. The PCR amplification program was: 95 °C pre-denaturation for 2 min; 98 °C denaturation for 10 s, 60 °C annealing for 15 s, 68 °C extension for 10 s, a total of 30 cycles; 72 °C extension for 10 min. The PCR amplification product was separated by 0.8% agarose gel electrophoresis and the target band was recovered. The target band was connected to the plant overexpression vector pB7WG2D by the Gateway method, transformed into Escherichia coli, and the positive clone was selected for sequencing (Shanghai Bioengineering Co., Ltd.) to obtain the precursor gene. pre- MIR477 The sequence is shown as SEQ ID No:2, and the miR477 sequence encoded by it is shown as SEQ ID No:1.

[0026] Example 2: Expression analysis of miR477 in the bark of rubber tree treated with coronatine (COR)

[0027] The second elongation unit of the rubber tree Reyan 7-33-97 was treated with 20 μM COR. The inner bark was collected after 1 h, 2 h, 8 h, and 24 h of treatment. The small RNA was extracted using the miRcute miRNA extraction and separation kit (DP501) of TIANGEN, and the small RNA was reverse transcribed using the miRcute enhanced miRNA cDNA first-strand synthesis kit (KR211). The miRcute enhanced miRNA fluorescence quantitative detection kit (SYBRGreen) (FP411) was used to quantitatively analyze the expression of miR477 using the cDNA reverse transcribed from the small RNA as a template. The reaction system: 2×miRcute Plus miRNA PreMix (SYBR&ROX) 10μl, miR477-qF (10 μM) 0.4μl, Reverse Primer (10μM) 0.4μl, miRNA first-strand cDNA 2μl, supplemented to 20μl with ddH2O. Reaction procedure: 95℃ 15min; 94℃ 20s, 60℃ 34s, 45 cycles; melting curve analysis. Primer sequences are U6-qF: 5'- ACAGAGAAGATTAGCATGGCCC -3', U6-qR: 5'-TCGATTTGTGCGTGTCATCC -3'; miR477-qF: 5'-ACTCTCCCTCAAGGGCTTCCA -3', and the downstream primer is the universal primer of the kit. -ΔΔCt The expression level of miR477 was calculated, and the expression levels of COR-treated materials and controls were compared and analyzed. The results showed that the expression of miR477 in the inner bark of rubber tree sprouts was significantly upregulated after 1 h, 2 h, and 8 h of COR treatment (Figure 1).

[0028] Example 3: Precursor gene pre-MIR477 Transforming Dandelions

[0029] 1. Acquisition and identification of transgenic dandelions

[0030] The strain with correct sequencing obtained in Example 1 was expanded and cultured, and plasmids were extracted according to the instructions of the plasmid DNA small-scale purification kit (Bao Ri Yi Biotechnology (Beijing) Co., Ltd.). pre- MIR477 The pB7WG2D plasmid was transformed into the Agrobacterium AGL1 strain to obtain Agrobacterium tumefaciens AGL1 containing pB7WG2D-35S::pre-MIR477.

[0031] The root segments of dandelions were infected with Agrobacterium tumefaciens AGL1 containing pB7WG2D-35S:: pre-MIR477 for genetic transformation, and resistant seedlings were obtained by resistance screening using Basta. The Basta resistance gene BAR and the precursor gene pre-MIR477 were identified by PCR to screen transgenic positive plants from the resistant seedlings. Specific method: The genomic DNA of dandelion leaves was extracted, and the primers of BAR and the precursor gene pre-MIR477 were used for PCR amplification, and then 1% agarose gel electrophoresis was performed. The lengths of the PCR products of the BAR gene and the precursor gene pre-MIR477 were 509 bp and 140 bp, respectively; if the PCR products of the BAR gene and the precursor gene pre-MIR477 both had specific bands, the plant was a transgenic plant (also called an overexpression plant). The recombinant plasmid pB7WG2D-35S:: pre-MIR477 was used as a positive control, and water and wild-type dandelion genomic DNA were used as negative controls. The electrophoresis images of some plants are shown in Figure 2 The primer sequences were BAR-F: 5′-GAAGTCCAGCTGCCAGAAAC -3′, BAR-R: 5′-CTACCATGAGCCCAGAACGA -3′; pre-MIR477-F: 5′-GGGGTTAGTTGCGAGAAGCTCTT-3′, pre-MIR477-R: 5′-CCGGCACTGCTGGAAGCCCT -3′.

[0032] 2. Expression detection and phenotypic analysis of pB7WG2D-35S:: pre-MIR477 positive plants

[0033] The root segments of wild-type and transgenic positive plants were taken, and small RNA was extracted according to the instructions of miRcute miRNA extraction and separation kit (DP501) of TIANGEN Company. The fluorescence quantitative expression analysis of miR477 was carried out with reference to Example 2. The fluorescence quantitative analysis showed that the expression levels of miR477 overexpression lines miR477-OE2, miR477-OE3, miR477-OE5, and miR477-OE6 were significantly upregulated compared with wild-type plants (Figure 3). The roots of these four transgenic lines and wild type (WT) were paraffin sectioned for root microstructure analysis. The specific method is: the cut root material was fixed in 80% ethanol for 24 hours, and the display method of rubber tree latex tube (Tian Weimin, Shi Minjing, Tan Haiyan, Wu Jilin, Hao Bingzhong, "Rubber Tree Bark Structure and Development", Beijing: Science Press) was referred to, and the sections were sliced ​​by gradient dehydration, iodine bromide staining, paraffin embedding, and then placed under an optical microscope for observation. The slices were sliced ​​and the area of ​​the laticifer cells and the root area were counted using ImageJ software, and the laticifer cell index was calculated: Laticifer cell index = laticifer cell area / root area. The results showed that the number of laticifer cells in the transgenic plants increased significantly ( Figure 4 ), the statistical results showed that the average laticifer index of the wild type WT was 0.316, while the average laticifer index of the four transgenic lines miR477-OE2, miR477-OE3, miR477-OE5, and miR477-OE6 were 0.967, 0.805, 0.739, and 0.746, respectively, which were significantly different from the control (p<0.05) ( Figure 5 There was no significant difference in phenotype between the transgenic plants and the wild-type plants ( Figure 6 ).

[0034] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modification and substitution of the practical is also within the scope of the present invention. Therefore, the equalization transformation and modification made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. A precursor gene encoding a microRNA associated with the development of dandelion laticifers, the nucleic acid sequence of which is shown in SEQ ID NO:

2.

2. A recombinant vector containing the precursor gene according to claim 1.

3. A host bacteria or transgenic cell line or recombinant bacteria containing the precursor gene according to claim 1.

4. Use of the precursor gene according to claim 1, or the recombinant vector according to claim 2, or the host bacteria or transgenic cell line or recombinant bacteria according to claim 3 in increasing the number of dandelion laticifer cells and / or laticifers, characterized in that: The number of dandelion laticifer cells and / or laticifers is increased by overexpressing the precursor gene according to claim 1.

5. The use according to claim 4, characterized in that Overexpression of the precursor gene of claim 1 increases the number of dandelion laticifer cells and / or laticifers but does not change the dandelion phenotype.

6. A primer pair, characterized in that: The primer pair is: pB7WG2D-miR477-F: 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTTAGGGGTTAGTTGCGAGAAGCTCTT-3' and reverse primer pB7WG2D-miR477-R: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTCCGGCA CTGCTGGAAGCCCT-3'; or The primer pair is: pre-MIR477-F: 5'-GGGGTTAGTTGCGAGAAGCTCTT -3', pre-MIR477-R: 5'-CCGGCACTGCTGGAAGCCCT -3'.

Images