Mutated sequence of rice osabcg46 gene and method and application thereof in regulating cadmium accumulation in rice

Abstract

The present disclosure relates to a mutant sequence of rice OsABCG46 gene and its method and application in regulating cadmium accumulation in rice. Specifically, it relates to a mutant sequence of rice OsABCG46 gene, a protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in rice plants and its application. The present disclosure reduces the accumulation of cadmium in rice by gene mutation of the nucleotide sequence of rice OsABCG46 gene to lose the function of the gene, thereby reducing the accumulation of cadmium in rice. It provides candidate gene resources and technical support for breeding rice varieties with reduced cadmium absorption content, and provides a new method and idea for breeding low-cadmium varieties and producing safe food. The present disclosure can effectively improve the problem of excessive cadmium content in rice, and has important significance for solving the problem of food safety.

Description

TECHNICAL FIELD

[0001] The present disclosure relates to the technical field of rice genetic engineering, in particular, to a mutant sequence of rice OsABCG46 gene, a protein encoded by the mutant sequence, a vector, a transformant, a method for reducing cadmium accumulation in rice plants and application thereof. BACKGROUND

[0002] ABC transporter (ATP-binding cassette, ABC) family is widely present in organisms, which contains two basic domains, namely highly hydrophobic transmembrane domain and ATP-binding domain, which dimerizes by binding ATP, and dissociates after ATP hydrolysis, and through the change of conformation, the substrate bound thereto is transferred to the other side of the biological membrane, realizing the transport of various substrates.

[0003] There are many members of ABC transporter family in rice, and research has found that ABC transporters are involved in the regulation of cadmium absorption and transport, such as Cd treatment can induce the expression of OsABCG43 in roots, and the heterologous expression of OsABCG43 in yeast can enhance the tolerance of yeast to Cd. OsABCC9 mutant plants are sensitive to Cd, and more Cd in the mutant plants is distributed from the roots to the aboveground parts and seeds. Cd treatment can quickly induce the expression of OsPDR9 in the roots of rice seedlings. However, whether other ABC transporters are also involved in the regulation of Cd tolerance in rice remains to be studied.

[0004] Therefore, finding target genes that can reduce the cadmium content of rice and cultivating low-cadmium accumulation rice are important ways to solve the harm of cadmium to human health, and have important significance for solving the problem of food security. SUMMARY

[0005] In order to solve the problem of excessive cadmium in rice in the prior art, the purpose of the present disclosure is to screen genes and methods that can reduce cadmium in rice, and to cultivate rice varieties with reduced cadmium absorption content.

[0006] In order to achieve the above-mentioned purpose, the first aspect of the present disclosure provides a mutant sequence of rice OsABCG46 gene, wherein the mutant sequence is obtained by mutating the nucleotide sequence of rice OsABCG46 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides on the rice OsABCG46 gene;

[0007] The nucleotide sequence of the rice OsABCG46 gene is shown in SEQ ID NO: 1; and the amino acid sequence of the protein encoded by the rice OsABCG46 gene is shown in SEQ ID NO: 2.

[0008] Optionally, the mutant sequence is selected from at least one of the following sequences:

[0009] (1) a nucleotide sequence as shown in SEQ ID NO: 3 obtained by deleting the 7th to 8th base of the sequence of the target site I of the rice OsABCG46 gene;

[0010] (2) a nucleotide sequence as shown in SEQ ID NO: 4 obtained by inserting a base C between the 6th and 7th base of the sequence of the target site I of the rice OsABCG46 gene;

[0011] wherein the nucleotide sequence of the target site I is as shown in SEQ ID NO: 7.

[0012] The second aspect of the present disclosure provides a protein encoded by the mutant sequence of the first aspect, and the amino acid sequence of the protein is as shown in SEQ ID NO: 5 and / or SEQ ID NO: 6.

[0013] The third aspect of the present disclosure provides a vector, wherein the vector is a CRISPR / Cas9 editing vector, the vector is inserted with the target site I, and the mutant sequence as described in the first aspect is generated;

[0014] wherein the nucleotide sequence of the target site I is as shown in SEQ ID NO: 7.

[0015] The fourth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the transformant is introduced with the target site I, or the transformant is introduced with the vector of the third aspect;

[0016] wherein the nucleotide sequence of the target site I is as shown in SEQ ID NO: 7.

[0017] The fifth aspect of the present disclosure provides a method for reducing the accumulation of cadmium in rice plants, and the method comprises:

[0018] The nucleotide sequence of the rice OsABCG46 gene is mutated by gene editing of the rice OsABCG46 gene, and the protein encoded by the OsABCG46 gene is changed;

[0019] wherein the mutation comprises substitution, deletion and / or addition of one or more nucleotides on the rice OsABCG46 gene.

[0020] Optionally, the method for gene editing comprises:

[0021] S1. designing a CRISPR / Cas9 editing vector according to the target site I of the rice OsABCG46 gene;

[0022] S2, the CRISPR / Cas9 editing vector is infected into the rice plant through agrobacterium infection, mutations are randomly generated in the rice plant body and at the position of the target site I, and then detection is performed according to the designed primer to screen a T0 generation positive plant with a function-deficient mutation;

[0023] S3, the T0 generation positive plant is self-crossed to screen a T1 generation homozygous mutant plant, and a rice plant with reduced cadmium content is obtained.

[0024] The nucleotide sequence of the target site I is shown in SEQ ID NO: 7.

[0025] Optionally, in step S2, the mutation comprises one of the following:

[0026] (a) deleting the bases CT at positions 7-8 of the sequence of the target site I of the rice OsABCG46 gene;

[0027] (b) inserting a base C between the bases at positions 6 and 7 of the sequence of the target site I of the rice OsABCG46 gene.

[0028] The sixth aspect of the present disclosure provides an application of the rice OsABCG46 gene and / or the protein encoded by the rice OsABCG46 gene in regulating cadmium accumulation in rice and / or cultivating a rice variety with reduced cadmium absorption content.

[0029] The seventh aspect of the present disclosure provides an application of the mutant sequence of the rice OsABCG46 gene of the first aspect, the protein of the second aspect, the vector of the third aspect, or the transformant of the fourth aspect in regulating cadmium accumulation in rice and / or cultivating a rice variety with reduced cadmium absorption content.

[0030] Through the above technical solution, the present disclosure makes the function of the gene lost by performing gene mutation on the nucleotide sequence of the rice OsABCG46 gene, and then reduces the accumulation of cadmium in rice. The present disclosure provides candidate gene resources and technical support for cultivating a rice variety with reduced cadmium absorption content, and provides a new method and idea for cultivating a low-cadmium variety and producing safe food. The present disclosure can effectively improve the problem of excessive cadmium content in rice, and has important significance for solving the problem of food safety.

[0031] Other features and advantages of the present disclosure will be described in detail in the following specific embodiments. BRIEF DESCRIPTION OF DRAWINGS

[0032] The accompanying drawings are included to provide a further understanding of the present disclosure and constitute a part of the specification, and are used together with the following specific embodiments to explain the present disclosure, but do not constitute a limitation on the present disclosure. In the drawings:

[0033] Figure 1 is the wild type and OsABCg46 the coding region nucleotide difference comparison of mutant.

[0034] Figure 2 is the gene edited rice OsABCg46-1 and OsABCg46-2 The detection results of cadmium content of mutant and wild type (WT). DETAILED DESCRIPTION

[0035] The detailed description of specific embodiments of the present disclosure is described in detail below in conjunction with the accompanying drawings. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present disclosure, and are not used to limit the present disclosure.

[0036] The first aspect of the present disclosure provides a mutant sequence of rice OsABCG46 gene, wherein the mutant sequence is obtained by mutating the nucleotide sequence of rice OsABCG46 gene; the mutation includes substitution, deletion and / or addition of one or more nucleotides on the rice OsABCG46 gene.

[0037] The nucleotide sequence of the rice OsABCG46 gene is shown in SEQ ID NO: 1; the amino acid sequence of the protein encoded by the rice OsABCG46 gene is shown in SEQ ID NO: 2.

[0038] In the present disclosure, the inventors of the present disclosure surprisingly found that the OsABCG46 gene (accession number LOC_Os09g16290) can regulate the accumulation of cadmium in rice, and the present disclosure reduces the accumulation of cadmium in rice by mutating the nucleotide sequence of the rice OsABCG46 gene to lose the function of the gene.

[0039] In one specific embodiment of the present disclosure, the mutant sequence is selected from at least one of the following sequences:

[0040] (1) the nucleotide sequence shown in SEQ ID NO: 3 obtained by deleting the 7th to 8th base of the sequence of the target site I of the rice OsABCG46 gene;

[0041] (2) the nucleotide sequence shown in SEQ ID NO: 4 obtained by inserting base C between the 6th and 7th bases of the sequence of the target site I of the rice OsABCG46 gene;

[0042] The nucleotide sequence of the target site I is shown in SEQ ID NO: 7.

[0043] In the above embodiment, the inventors of the present disclosure designed an editing vector according to the target site I, infected the vector into the rice plant through Agrobacterium, randomly mutated at the target site in the rice plant body, then detected the mutant sequence according to the designed primer, and selected the mutant strain with deletion of fragment CT and insertion of C base in the nucleotide sequence of the rice OsABCG46 gene. Deletion of fragment CT or insertion of C base in the nucleotide sequence of the rice OsABCG46 gene causes corresponding changes in the order and composition of codons after the insertion of the base, the appearance of the stop codon in advance, the premature termination of the encoded protein, and the change in the structure and function of the protein encoded by the mutant sequence. In addition, the inventors of the present disclosure also found that the cadmium content in the rice grain of the homozygous mutant plant of the OsABCG46 gene function-deficient mutant obtained by transgenic is significantly lower than that of the wild type, which can be used to analyze the biological function of the OsABCG46 gene in rice and has potential application value in agricultural development.

[0044] The second aspect of the present disclosure provides a protein encoded by the mutant sequence of the first aspect, and the amino acid sequence of the protein is shown in SEQ ID NO: 5 and / or SEQ ID NO: 6.

[0045] According to the present disclosure, the nucleotide sequence shown in SEQ ID NO: 3 encodes the protein shown in SEQ ID NO: 5; and the nucleotide sequence shown in SEQ ID NO: 4 encodes the protein shown in SEQ ID NO: 6.

[0046] The third aspect of the present disclosure provides a vector, wherein the vector is a CRISPR / Cas9 editing vector, the vector is inserted with a target site I, and the mutant sequence as described in the first aspect is generated.

[0047] The nucleotide sequence of the target site I is shown in SEQ ID NO: 7.

[0048] The fourth aspect of the present disclosure provides a transformant, wherein the host of the transformant is a genetically engineered bacterium; the transformant is introduced with a target site I, or the transformant is introduced with the vector of the third aspect.

[0049] The nucleotide sequence of the target site I is shown in SEQ ID NO: 7.

[0050] In the present disclosure, the genetically engineered bacterium can be Agrobacterium EHA105.

[0051] The fifth aspect of the present disclosure provides a method for reducing the accumulation of cadmium in rice plants, and the method comprises:

[0052] The nucleotide sequence of the rice OsABCG46 gene is mutated by gene editing of the rice OsABCG46 gene, and the protein encoded by the OsABCG46 gene is changed;

[0053] The mutation includes substitution, deletion and / or addition of one or more nucleotides on the rice OsABCG46 gene.

[0054] In the present disclosure, the protein encoded by the OsABCG46 gene is changed by gene editing of the rice OsABCG46 gene, thereby reducing or losing the expression of the OsABCG46 gene, reducing the activity of the protein encoded by the rice OsABCG46 gene, and being conducive to cultivating rice varieties with reduced cadmium absorption content, and effectively solving the problem of excessive cadmium content in rice.

[0055] In one specific embodiment of the present disclosure, the method of gene editing comprises:

[0056] S1, designing a CRISPR / Cas9 editing vector according to the target site I of the rice OsABCG46 gene;

[0057] S2, introducing the CRISPR / Cas9 editing vector into the rice plant by Agrobacterium infection, mutating randomly at the target site I in the rice plant, and then detecting and screening the T0 generation positive plants with functional defective mutations according to the designed primers;

[0058] S3, selfing the T0 generation positive plants to screen T1 generation homozygous mutant plants, and obtaining rice plants with reduced cadmium content;

[0059] The nucleotide sequence of the target site I is shown in SEQ ID NO: 7.

[0060] In a preferred embodiment of the present disclosure, in step S2, the mutation includes one of the following:

[0061] (a) deleting the bases CT at positions 7-8 of the sequence of the target site I of the rice OsABCG46 gene;

[0062] (b) inserting a base C between the bases at positions 6 and 7 of the sequence of the target site I of the rice OsABCG46 gene.

[0063] The sixth aspect of the present disclosure provides the application of the rice OsABCG46 gene and / or the protein encoded by the rice OsABCG46 gene in regulating cadmium accumulation in rice and / or cultivating rice varieties with reduced cadmium absorption content.

[0064] The seventh aspect of the present disclosure provides the use of the mutant sequence of the rice OsABCG46 gene of the first aspect, the protein of the second aspect, the vector of the third aspect, or the transformant of the fourth aspect in regulating cadmium accumulation in rice and / or cultivating a rice variety with reduced cadmium absorption content.

[0065] In the present disclosure, by mutating the rice OsABCG46 gene, the change of the exon nucleotide leads to the premature termination of the translated protein, resulting in a non-functional OsABCG46 protein. The cadmium content in the rice grains of the mutant plant obtained is significantly reduced compared with that of wild type Nipponbare, indicating that the mutation of the rice OsABCG46 gene in the present disclosure can effectively reduce the cadmium content in the rice grains. Cultivating a rice variety with reduced cadmium absorption content using the mutant of the rice OsABCG46 gene has potential application value in agricultural applications.

[0066] The present disclosure is further illustrated in detail by the following examples.

[0067] The raw materials used in the examples can be obtained through commercial channels. The specific experimental conditions not specified in the examples are in accordance with the conventional conditions well known to those skilled in the art.

[0068] Example 1

[0069] This example is used to illustrate the preparation of the rice ABC transporter gene OsABCG46 knockout mutant, and the detailed implementation steps are as follows:

[0070] (1) Construct the OsABCG46 knockout mutant plant using the CRISPR-Cas9 gene knockout system. First, select the coding sequence (CDS) region target site I: CCTTGGCTGGAACACTCCCATC (SEQ ID NO: 7) shown in SEQ ID NO: 2 as a specific target site, construct a knockout vector with OsABCG46 specific target site, and then use rice variety Nipponbare seeds as the transformation material, use Agrobacterium infection transformation method to obtain T0 generation transgenic plants.

[0071] (2) Hydroponically identify T0 generation plants. Design sequencing primers:

[0072] Forward primer mG46F: 5'-TGGCCAACTCCTTGACACTT-3' (SEQ ID NO: 8); reverse primer mG46R: 5'-GTGGGATCATCAAGCCTCACA-3' (SEQ ID NO: 9), identify whether the OsABCG46 gene is mutated and the mutation type, then select homozygous mutants, and harvest T1 generation seeds.

[0073] Two types of OsABCG46 gene mutations were identified in this embodiment: OsABCg46-1 and OsABCg46-2 As shown in Figure 1 , wherein the black solid line mark represents the target sequence, and the red solid line PAM represents the adjacent motif of the candidate recognition site, OsABCg46-1 is a fragment CT (i.e. the 287-288th base of the coding region or the 7th to 8th of the sequence of target site I) deleting the 3rd exon, OsABCg46-2 is an insertion of base C (i.e. between the 6th and 7th of the sequence of target site I after the 286th base of the coding region) Figure 1 ). OsABCg46-1 and OsABCg46-2 Both mutation types are frame shift mutations, resulting in premature termination of the OsABCG46 encoded protein and producing non-functional protein.

[0074] Example 2

[0075] This embodiment is used to carry out field planting test of cadmium pollution on the rice ABC transporter gene OsABCG46 knockout mutants prepared in Example 1 OsABCg46-1 and OsABCg46-2 The specific implementation steps are as follows:

[0076] (1) After the T1 generation homozygous seeds of Nipponbare and mutants OsABCg46-1 and OsABCg46-2 are germinated in darkness at 37℃ for 3 days, they are sowed in the rice seedling area, and after 20 days, the seedlings with consistent growth are selected and planted in the cadmium contaminated rice field, with eight plants per row, a row spacing of 15 cm, and a plant spacing of 15 cm. The water, fertilizer and pest management during the whole growth period are consistent with those in the general field.

[0077] (2) At the mature stage of rice, the seeds of the main panicle of Nipponbare and mutants OsABCg46-1 and OsABCg46-2 are harvested respectively. The harvested homozygous T1 generation mutant family and wild type Nipponbare mature seeds are first dried at 37℃, then shelled and weighed. The rice seeds are obtained by nitric acid digestion method to obtain ion constant solution, and the cadmium content of the rice seeds is determined by ICP-OES.

[0078] The results are shown in Figure 2 , wherein "*" represents a significant decrease compared with the wild type, p P <0.05. The results of this embodiment show that the cadmium content of the seeds of rice OsABCG46 mutants OsABCg46-1 and OsABCg46-2 is significantly reduced compared with Nipponbare, indicating that the OsABCG46 gene has an important function in regulating the accumulation of cadmium in rice seeds.

[0079] The above results show that mutating the OsABCG46 gene of rice by gene editing method can reduce the cadmium content in the rice grains. This provides a way for cultivating low cadmium accumulation varieties of rice.

[0080] The preferred embodiments of the present disclosure are described in detail above with reference to the drawings, but the present disclosure is not limited to the specific details in the above-described embodiments. Within the technical concept of the present disclosure, various simple modifications can be made to the technical solutions of the present disclosure, and these simple modifications all belong to the protection scope of the present disclosure.

[0081] In addition, it should be noted that each specific technical feature described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, various possible combinations are not described again in the present disclosure.

[0082] In addition, various different embodiments of the present disclosure can also be combined in any manner, as long as they do not deviate from the idea of the present disclosure, and they should also be considered as disclosed by the present disclosure.

Claims

1. A method of reducing cadmium accumulation in rice grains, characterized by, The method comprises: The method comprises: The method comprises: The method comprises: S1, designing a CRISPR / Cas9 editing vector according to a target site I of the rice OsABCG46 gene; S2, infecting the CRISPR / Cas9 editing vector into the rice plant through agrobacterium, mutating randomly at the target site I in the rice plant body, and then detecting according to the designed primer to screen a T0 generation positive plant with a functional defect mutation; S3, selfing the T0 generation positive plant, screening a T1 generation homozygous mutant plant, and obtaining a rice plant with reduced cadmium content; The nucleotide sequence of the target site I is shown in SEQ ID NO: 7; The sequence of the primer is shown in SEQ ID NO: 8 and SEQ ID NO: 9; The nucleotide sequence of the rice OsABCG46 gene is shown in SEQ ID NO: 1; and the amino acid sequence of the protein encoded by the rice OsABCG46 gene is shown in SEQ ID NO:

2.

2. The method of claim 1, wherein, In step S2, the mutation comprises one of the following: (a) deleting the bases CT at positions 7-8 of the sequence of the target site I of the rice OsABCG46 gene; (b) inserting a base C between the bases at positions 6 and 7 of the sequence of the target site I of the rice OsABCG46 gene.

Images