TaHA16-5d gene related to wheat ear bud resistance and application thereof
By cloning and utilizing the TaHA16-5D gene for overexpression or gene editing, the problem of wheat spike sprouting was solved, significantly improving the spike sprouting resistance of wheat varieties and providing a safe molecular breeding solution.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ANHUI AGRICULTURAL UNIVERSITY
- Filing Date
- 2024-09-11
- Publication Date
- 2026-04-21
AI Technical Summary
Existing technologies frequently encounter the problem of wheat ear sprouting, leading to a decline in yield and quality. Spraying chemical agents poses environmental and health risks, and there is a lack of effective genetic resources to resist ear sprouting.
By cloning and overexpressing or editing the TaHA16-5D gene, wheat ear sprouting resistance can be increased or decreased, and wheat varieties resistant to ear sprouting can be bred through transgenic means.
Overexpression of the TaHA16-5D gene significantly improves wheat bud break resistance, while gene loss significantly reduces bud break resistance, providing an efficient molecular breeding approach to enhance the bud break resistance of wheat varieties.
Smart Images

Figure CN118995747B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a TaHA16-5D gene related to wheat ear sprouting resistance and its application. Background Technology
[0002] Wheat is my country's second largest staple food crop. However, with global warming and frequent rainy weather during the wheat harvest season, the problem of wheat ears sprouting has become increasingly prominent, resulting in a significant decline in wheat yield, milling and processing quality, and seed viability, which restricts the high-quality development of my country's agriculture.
[0003] Spraying chemical agents can significantly improve the sprouting resistance of wheat varieties, but considering the ecological environment and human health, breeding and planting sprouting-resistant wheat varieties is the safest, most economical, and effective way to solve the sprouting problem. Therefore, the cloning and functional study of wheat sprouting resistance genes is of great significance for improving the sprouting resistance of modern wheat varieties through transgenic means, but currently, only a few wheat sprouting resistance genes have been discovered and cloned. Summary of the Invention
[0004] The purpose of this invention is to provide a TaHA 16-5D gene related to wheat ear sprouting resistance and its application in order to solve the above problems.
[0005] The present invention achieves the above objectives through the following technical solutions:
[0006] A TaHA16-5D gene associated with wheat ear sprouting resistance, the nucleotide sequence of which is shown in SEQ ID NO.1.
[0007] Application of the TaHA16-5D gene, which is associated with wheat ear germination resistance, in regulating seed ear germination resistance in plants.
[0008] As a further optimization of the present invention, overexpression of the TaHA16-5D gene increases wheat ear germination resistance, while loss of gene function of the TaHA16-5D gene decreases wheat ear germination resistance.
[0009] As a further optimization of the present invention, the wheat variety is Zhengmai 7698.
[0010] A method for obtaining a transgenic wheat variety resistant to ear sprouting involves introducing the TaHA16-5D gene as the target gene into the wheat genome for overexpression, thereby cultivating a transgenic wheat variety resistant to ear sprouting.
[0011] The beneficial effects of this invention are as follows:
[0012] This invention utilizes transcriptome sequencing and quantitative real-time PCR (qRT-PCR) to identify a plasma membrane H+-ATPase gene, TraesCS5D02G013100 (named TaHA16-5D), associated with seed bud break resistance. Further overexpression of the TaHA16-5D gene in the wheat variety Zhengmai 7698 revealed that overexpression significantly improved bud break resistance in transgenic lines. Simultaneously, CRISPR-Cas9 gene editing technology was used to induce insertion or deletion mutations in the coding region of the TaHA16-5D gene, resulting in a loss of TaHA16-5D gene function. This loss of function significantly reduced wheat bud break resistance. This demonstrates that the TaHA16-5D gene positively regulates wheat bud break resistance, and its discovery provides a genetic resource for efficiently enhancing bud break resistance in wheat varieties through molecular breeding. Attached Figure Description
[0013] Figure 1 Bioinformatics analysis results of 28 members of the plasma membrane H+-ATPase gene family (TaHA1-TaHA28) identified in the wheat genome using bioinformatics methods;
[0014] Figure 2 The expression analysis of the TaHA16-5D gene in wheat seeds (Jing 411 / J411, susceptible to germination at the ear) and Hongmang Chun 21 / HMC21, resistant to germination at the ear, under different soaking times, and the expression analysis of the TaHA16-5D gene in different tissues of wheat (Chinese spring wheat), **P<0.01 ( Figure 2 A and 2B are graphs based on transcriptome sequencing data analysis. Figure 2 C and D are based on qRT-PCR technology analysis diagrams;
[0015] Figure 3 Diagram of the overexpression vector for the TaHA16-5D gene ( Figure 3 A) and gene editing mutation expression vector diagram ( Figure 3 B);
[0016] Figure 4 Experimental diagram showing the overexpression of the TaHA16-5D gene and its expression through gene editing mutations. Figure 4 A is a statistical chart of seed germination rates for wild-type Zhengmai 7698 / ZM7698, overexpression lines TaHA16-OE-1, TaHA16-OE-3, TaHA16-OE-5, and gene-edited mutant lines taha16-cas-2, taha16-cas-5, and taha16-cas-7. Figure 4B shows the seed germination phenotypes of wild-type Zhengmai 7698 / ZM7698, overexpression lines, and gene-edited mutant lines; Figure 4 C represents the phenotypic diagram of spikelet budding of wild-type Zhengmai 7698 / ZM7698, overexpression lines, and gene-edited mutant lines. Detailed Implementation
[0017] The present application will now be described in further detail with reference to the accompanying drawings. It should be noted that the following specific embodiments are only used to further illustrate the present application and should not be construed as limiting the scope of protection of the present application. Those skilled in the art can make some non-essential improvements and adjustments to the present application based on the above application content.
[0018] 1. Materials
[0019] Unless otherwise specified, the methods used in this embodiment are conventional methods known to those skilled in the art, and the reagents and materials used are commercially available products.
[0020] 2. Method
[0021] 2.1 Identification and analysis of wheat gene TaHA16-5D
[0022] 2.1.1 Bioinformatics Analysis
[0023] Bioinformatics analysis is a method that uses computer science and biological principles to process, analyze, and interpret biological data. This data can include various types such as genome sequences, protein structures, gene expression, and protein-protein interactions. The main purpose of bioinformatics analysis is to extract valuable information about biological questions from this massive amount of data.
[0024] This application obtained protein sequences, coding sequences (CDS), and genomic sequences from the wheat genome database (http: / / plants.ensembl.org / index.html). A BLAST search was performed on the wheat genome database to screen members of the plasma membrane H+-ATPase gene family, with screening criteria of id (%) > 50% and E value < 10⁻¹⁵. After eliminating redundant sequences, candidate proteins were screened using the SMART and Pfam databases to look for conserved ProSite PS00154 and DKTGT[L / I / V / M][T / I] (P domain) domains. Candidate proteins containing both of these conserved domains were defined as plasma membrane H+-ATPase family genes. A total of 28 plasma membrane H+-ATPase genes were identified and named TaHA1-TaHA28 according to their chromosomal distribution (e.g., ...). Figure 1 (As shown).
[0025] 2.1.2. Analysis of the relative expression level of wheat TaHA16-5D gene based on transcriptome data
[0026] Seeds of wheat varieties Jing 411 (J411, susceptible to ear germination) and Hongmangchun 21 (HMC21, resistant to ear germination) were soaked in water, and seed samples were collected at different soaking times (1 h, 6 h, 9 h, 12 h, and 36 h). Transcriptome sequencing (https: / / www.ncbi.nlm.nih.gov / bioproject / PRJNA895954) was used to analyze the transcriptome data of Jing 411 (J411, susceptible to ear germination) and Hongmangchun 21 (HMC21, resistant to ear germination). Combined with the bioinformatics analysis in step 2.1.1 above, a plasma membrane H+-ATPase family gene (Trae) associated with seed ear germination resistance was identified. The sCS5D02G013100 gene was named TaHA16-5D, and its expression pattern at different seed soaking stages in two wheat varieties (Jing 411 and Hongmangchun 21) was investigated. Simultaneously, transcriptome data from the wheat variety Chinese Spring (http: / / 202.194.139.32) were analyzed to study the expression pattern of the TaHA16-5D gene in different tissues (roots, stems, leaves, spikes, and seeds) of Chinese Spring.
[0027] Experimental Results: Transcriptome sequencing data of seeds from the susceptible-to-spillage cultivar Jing 411 (J411) and the resistant-to-spillage cultivar Hongmangchun 21 (HMC21) at different soaking times (1h, 6h, 9h, 12h, 36h) were analyzed. The results showed that the relative expression level of the TaHA16-5D gene in seeds of the resistant-to-spillage cultivar HMC21 was significantly higher than that in the susceptible-to-spillage cultivar J411 (e.g., ). Figure 2 As shown in A). Simultaneously, transcriptome sequencing data of different tissues (roots, stems, leaves, ears, and seeds) of *Wheat* were searched in the wheat public expression database (http: / / 202.194.139.32) (e.g., ...). Figure 2 As shown in B), the relative expression level of the TaHA16-5D gene in the seeds of Chinese spring wheat was found to be significantly higher than that in other tissues (roots, stems, leaves, and ears). This suggests that the TaHA16-5D gene may be related to the ear germination resistance of wheat seeds, and that the TaHA16-5D gene may be a gene that positively regulates the ear germination resistance of wheat.
[0028] 2.1.3. Verification of the expression trend of wheat TaHA16-5D gene using qRT-PCR technology.
[0029] Quantitative Real-time PCR (qRT-PCR) is a method that uses fluorescent chemicals to measure the total amount of product after each polymerase chain reaction (PCR) cycle in a DNA amplification reaction. The basic principle is to add a fluorescent group to the PCR reaction system, using the accumulation of fluorescence signals to monitor the entire PCR process in real time, and finally quantitatively analyze unknown templates using a standard curve. The fluorescent substances used in qRT-PCR include fluorescent probes and fluorescent dyes. This experiment uses SYBR fluorescent dye. The principle is that by adding an excess of SYBR fluorescent dye to the PCR reaction system, SYBR fluorescent dye non-specifically incorporates into the DNA double strand and emits a fluorescent signal, while SYBR dye molecules not incorporated into the strand do not emit any fluorescent signal, thus ensuring that the increase in fluorescence signal is completely synchronized with the increase in PCR product. SYBR only binds to double-stranded DNA, therefore, the specificity of the PCR reaction can be determined by using a melting curve.
[0030] Wheat seeds and different tissues of Chinese spring wheat at different infiltration stages (1h, 6h, 9h, 12h, 36h) from step 2.1.2 above were collected. RNA was extracted from wheat seeds and reverse transcribed into cDNA. Reverse transcription was performed using the PrimeScript RT-Reagent Kit (Takara Biotechnology, Dalian, China). Quantitative real-time PCR was performed according to the instructions of the SYBR Premix Ex Taq GC kit (Takara Biotechnology, Dalian, China). The primer sequences, PCR reaction system, and PCR reaction procedure are as follows:
[0031] The PCR amplification primer sequences are shown below:
[0032] SEQ ID NO.2: TaHA16-5D-qRT-PCR-F: 5'AGATTCTTCACCTCGCTCACAACAC 3';
[0033] SEQ ID NO.3: TaHA16-5D-qRT-PCR-R: 5'CTTTTCTTTCCTCCCATCTGGTACTTC C 3';
[0034] PCR reaction system: The total qPCR reaction system is 25 μL, including 12.5 μL of SYBR Advantage Premix (2×), 2.0 μL of reverse transcribed cDNA and 9 μL of ddH2O, and 0.75 μL each of 10 μM upstream and downstream primers for mRNA quantification.
[0035] PCR reaction procedure: One cycle of 95℃ for 30s (pre-denaturation); 39 cycles of 95℃ for 5s (denaturation) and 60℃ for 30s (melting), with fluorescence signal readings performed in each cycle; finally, 95℃ for 10s for melting curve analysis; each fluorescence data should be analyzed in triplicate (biological and technical replicates); after qRT-PCR amplification, use 2- △△CT The data was analyzed, and finally, graphs were drawn using GraphPad Prism 5.0.
[0036] Experimental conclusion: Quantitative real-time PCR (qRT-PCR) analysis showed that the relative expression level of the TaHA16-5D gene in seeds of the resistant budding variety HMC21 at different soaking times (1h, 6h, 9h, 12h, 36h) was significantly higher than that in the susceptible budding variety J411. Figure 2 C); The relative expression level of the TaHA16-5D gene in Chinese spring wheat seeds was significantly higher than that in other tissues (roots, stems, leaves, and ears). Figure 2 D) The results of qRT-PCR analysis were consistent with the results of the transcriptome sequencing analysis above, indicating that the TaHA16-5D gene is related to the germination resistance of wheat seeds and that the TaHA16-5D gene positively regulates the germination resistance of wheat seeds.
[0037] 2.2 Obtaining the full-length CDS sequence of the TaHA16-5D gene
[0038] Using cDNA from the resistant budding variety HMC21 as a template, specific primers were designed using Primer Premier 5.0 software to amplify the fragment, and gene cloning was performed in Jing 411 and HMC21 according to the following procedures.
[0039] The specific primer sequences are shown below:
[0040] SEQ ID NO.4: TaHA16-5D-F: 5'ATGGCCGAGAAGGAGGCCG 3';
[0041] SEQ ID NO. 5: TaHA16-5D-R: 5'TCAGACCGTGTAGGATTGCTGGA 3'.
[0042] PCR amplification was performed using the high-fidelity enzyme Fastpfu, which has high amplification efficiency and speed, according to the following reaction system: 10 μL 5×PCR Buffer (15 mM MgCl2), 5 μL dNTPmix (2.5 mM), 2 μL upstream primer (10 μM), 2 μL downstream primer (10 μM), 4 μL template DNA (50-100 ng / μL), 1 μL Fast pfu (2.5 U / μL), and distilled water to a final volume of 50 μL.
[0043] Reaction procedure: 95℃ pre-denaturation for 2 min, 95℃ denaturation for 20 s, annealing at the required annealing temperature for each primer pair for 20 s, extension at 72℃ (extension time can be calculated based on fragment length and Fastpfu amplification efficiency of 2-4 kb / min), repeat the denaturation-annealing-extension three-step cycle 35 times, supplementary extension at 72℃ for 5 min, and store the product at 4℃.
[0044] Add 2 μL of 6×DNA loading buffer to the PCR product and perform electrophoresis on a 1.5% agarose gel. After electrophoresis, cut off the gel block containing the target fragment and use the agarose gel DNA recovery kit purchased from Kangwei Century Biotechnology Co., Ltd. to recover and purify the target fragment according to the instructions (https: / / www.cwbiotech.com / uploads / websitepdf / 216c4037-3eae-4ac2-b86a-762277a7adc1.pdf).
[0045] Add 1 μL of plasmid (Blunt-zero, purchased from TransGen Biotech, http: / / www.transgen.com.cn / ) and 4 μL of PCR purification product to a sample tube, ligate at 25°C for 20 min, and cool at 12°C. Remove the ligated sample and add 50 μL of competent cells (Trans-T, stored at -80°C before use) to a UV-sterilized workbench. Mix gently and incubate on ice for 20 min. After completion, transfer the sample to a water bath and heat shock at 42°C for 45 s, then immediately place it on ice for 2 min. On a sterile workbench, add 950 μL of SOC medium (formula per 100 mL: 2 g tryptone, 0.5 g yeast extract, 0.06 g NaCl, 0.02 g KCl, 0.2033 g MgCl2·6H2O, 0.2465 g MgSO4·7H2O, 0.36 g glucose, 100 mL ultrapure water) to the sample and incubate at 37°C for 1-1.5 h. Next, in a sterile workbench, spread 100-200 μL of the bacterial culture evenly onto LB solid medium supplemented with kanamycin (formula per 100 mL: 1 g tryptone, 0.5 g yeast extract, 0.5 g NaCl, 1.5 g agar powder, 100 μL kanamycin solution, 100 mL ultrapure water) and incubate at 37°C for 15-16 h. Once the bacterial colonies have grown to a suitable size, add 6 μL of sterile water to each PCR sample well. Use a pipette with a maximum volume of 10 μL to transfer the bacteria into the well. Gently mix by aspiration, then transfer 4 μL to a centrifuge tube containing 1000 μL of LB liquid medium (per 100 mL: 1 g tryptone, 0.5 g yeast extract, 0.5 g NaCl, 100 μL kanamycin solution, 100 mL ultrapure water). Incubate the centrifuge tube at 37°C for 4-6 hours. Simultaneously, perform PCR detection using M13 as a primer and the remaining 2 μL of bacterial culture in the sample well as a template. A positive PCR result indicates the presence of the target fragment, and the sample should be sent for sequencing.
[0046] The M13 primer sequence is:
[0047] SEQ ID NO.6: M13-F:5'CAGGAAACAGCTATGACCATGAT 3';
[0048] SEQ ID NO.7: M13-R:5'GTAAAACGACGGCCAGTGC 3'.
[0049] 2.3 TaHA16-5D gene overexpression and gene editing mutation assay
[0050] 2.3.1 Overexpression assay of TaHA16-5D gene
[0051] The full-length CDS sequence of the correctly sequenced TaHA16-5D gene from step 2.2 above (sequence shown in SEQ ID NO.1) was constructed into a vector driven by the maize Ubiquitin promoter. The overexpression vector of the TaHA16-5D gene is shown below. Figure 3 As shown in Figure A.
[0052] 2.3.2 Gene Editing Mutation Experiment of TaHA16-5D Gene
[0053] Using TaU3 as the promoter of sgRNA, two tandem sgRNA sequences (sgTaHA16-1 and sgTaHA16-2) targeting the TaHA16-5D gene were designed based on the correct full-length CDS sequence of the TaHA16-5D gene (as shown in SEQ ID NO.1) sequenced in step 2.2 above. The gene editing vector TaHA16-cas9 was constructed, and the gene mutation expression vector for the TaHA16-5D gene is shown below. Figure 3 As shown in B.
[0054] The sequence designed to target the TaHA16-5D gene is shown below:
[0055] SEQ ID NO.8: sgTaHA16-1: 5'-CCTCAAGGAGGTCGTCGACCTGG-3';
[0056] SEQ ID NO. 9: sgTaHA16-2: 5'-CCTGGTGGCCCATGGCATTTTGC-3'.
[0057] The overexpression vectors obtained in step 2.3.1 and the gene mutation expression vectors obtained in step 2.3.2 were sequenced. The correctly sequenced vector plasmids (overexpression vector and gene mutation expression vector) were transformed into Agrobacterium EHA105 competent cells using Agrobacterium-mediated transformation. Then, they were transformed into the immature embryos of wheat Zhengmai 7698 using Agrobacterium-mediated transformation. T0 generation wheat seedlings were transplanted into a flower substrate and incubated in a high-humidity incubator for two weeks to allow them to recover. Leaves were collected, and genomic DNA was extracted using the CTAB method. Positive plants were detected. Figure 4 As shown in A (overexpression lines: TaHA16-OE-1, TaHA16-OE-3, TaHA16-OE-5; gene-edited mutant lines: taha16-cas-2, with a 1bp base insertion in the coding region; taha16-cas-5, with a 4bp base deletion in the coding region; taha16-cas-7, with a 5bp base deletion in the coding region).
[0058] 2.3.3 Determination of spikelet germination phenotype
[0059] The seed germination index (GI) and spike germination rate (SGR) were used to evaluate the spike germination resistance of wheat varieties.
[0060] Seed germination test: Healthy and intact wheat seeds (3 replicates) were placed in a 90 mm diameter petri dish, 9 mL of sterile water was added, and the seeds were cultured at 20 °C under a photoperiod of 14 h daytime and 10 h nighttime. Germination was determined by the rupture of the seed embryo. During the seed germination test, the phenotype was observed and the number of germinated seeds was recorded regularly every day. The germination rate was calculated as the number of germinated seeds divided by the total number of seeds.
[0061] Whole ear germination test: Soak 3-5 freshly harvested whole ears in deionized water for 6 hours, then place them vertically in a constant temperature incubator at 25℃. On the 7th day, take pictures of the whole wheat ears and observe the phenotype.
[0062] Experimental results, such as Figure 4 As shown, the seed germination rate and whole-ear germination of the TaHA16-5D gene overexpressing lines TaHA16-OE-1, TaHA16-OE-3, and TaHA16-OE-5 were significantly lower than those of wild-type Zhengmai 7698. The seed germination rate and whole-ear germination of the TaHA16-5D gene-edited lines taha16-cas-2, taha16-cas-5, and taha16-cas-7 were significantly higher than those of wild-type Zhengmai 7698. This indicates that TaHA16-5D gene overexpression can significantly improve wheat ear germination resistance, while TaHA16-5D gene loss can significantly reduce wheat ear germination resistance. The TaHA16-5D gene positively regulates wheat ear germination resistance.
[0063] The embodiments described above are merely examples of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention.
Claims
1. Application of TaHA16-5D gene associated with resistance to wheat ear bud sprouting in regulating the resistance of plant seed ear bud sprouting, characterized in that, The nucleotide sequence of the gene TaHA16-5D is shown as SEQ ID NO. 1, and the TaHA16-5D gene positively regulates the wheat ear sprouting resistance.
2. Use according to claim 1, characterized in that, The overexpression of the TaHA16-5D gene increases the wheat ear sprouting resistance, and the gene function loss of the TaHA16-5D gene reduces the wheat ear sprouting resistance.
3. Use according to claim 2, characterized in that, The wheat variety is Zhengmai 7698.
4. A method for obtaining a transgenic wheat variety resistant to pre-harvest sprouting, characterized in that, The TaHA16-5D gene related to the wheat ear sprouting resistance is introduced into the wheat genome as a target gene for overexpression, and a transgenic wheat variety with ear sprouting resistance is obtained; the nucleotide sequence of the gene TaHA16-5D is shown as SEQ ID NO. 1.