A silencing suppressor factor RhHDP2 and its application

Abstract

The present invention discloses a silencing suppressor RhHDP2 and an application thereof. The silencing suppressor RhHDP2 of the present invention, the nucleotide sequence of which is shown in SEQ ID NO.1. The protein encoded by the silencing suppressor RhHDP2 of the present invention, the amino acid sequence of which is shown in SEQ ID NO.2. The present invention improves the stability of rose organ development: by regulating the expression of the silencing suppressor RhHDP2, the present invention can reduce the abnormal development of rose organs, such as stamen petalization, under low temperature conditions, thereby improving the ornamental value and commercial value of rose cut flowers.

Description

Technical Field

[0001] The present invention relates to the field of molecular biotechnology, and in particular to a silencing suppressor factor RhHDP2 and an application thereof. Background Art

[0002] Rose cut flowers are one of the most important commodity cut flowers in the world, accounting for more than 1 / 3 of the world's total cut flower trade. The normal development of flowers is the key to determining their ornamental and economic value. During the annual production of cut roses, they are often damaged by low temperatures in the first and fourth quarters, which affects the development of rose organs, causing serious petalization of rose stamens, deformed petals, and abnormal opening of petals, greatly weakening the commercial value of cut roses and reducing the output value of the fresh cut flower industry.

[0003] To further explore the genetic function of RhHDP2, RhHDP2 was transiently silenced in the rose 'Samantha' and it was found that the petalization of stamens in the silenced plants was significantly more severe than that in the control group, and the number of deformed petals increased; when RhHDP2 was transiently overexpressed, the number of petalized stamens was slightly reduced compared with the control group.

[0004] In the early stage of rose flower bud development, the differentiation of flower organs has not yet been completed. Low temperature treatment of 12℃ will cause the development of rose flowers to be deformed, and the number of petals is significantly more than that of normal flowers (Moe, 1971). Within a certain range, the lower the temperature, the more petals there are and the fewer stamens there are (Zieslin et al., 1992). Wild roses are single-petal varieties, usually with 5 petals, while modern roses are mostly double-petal flowers. This feature is caused by the homologous transformation of rose stamens to petals and is related to changes in the expression region of the C-class gene RhAG in flower development (Dubois et al., 2010). The rose 'Fendla' was treated with low temperature, and paraffin sections were observed to find that low temperature treatment delayed the differentiation time of rose stamen primordium and pistil primordium, thereby prolonging the development time of petals, and the flowers showed "double hearts". The number of transitional forms of stamens to petals increased significantly, resulting in excessive double petals (Fan Tiangang et al., 2014). It also suggests that the excessive double petals of ‘Fendla’ under low temperature are caused by the reduced expression of the C-class gene RhAG under low temperature treatment (Fan Tiangang, 2014; Tian Yaran et al., 2016).

[0005] Epigenetic studies have further proved that the methylation level of CHH sequence in the promoter region of RhAG increased significantly under low temperature, which may be the direct cause of the reduced expression of C-type gene RhAG in rose flower organs under low temperature. The expression defect of C-type gene causes excessive accumulation of A-type gene in the third round of flower organs, which in turn causes the homologous transformation of stamens to petals and produces double petals (Ma et al., 2015).

[0006] In current research, there are few reports on the molecular mechanisms involved in low temperature regulation of floral organ development, and there is a lack of a silencing inhibitory factor RhHDP2 and its application in regulating rose petal development under low temperature. Summary of the invention

[0007] The purpose of the present invention is to provide an application of a silencing suppressor factor RhHDP2 in regulating the development of rose petals under low temperature.

[0008] In order to solve the problems of the prior art, the present invention provides the following technical solutions: In the first aspect, the present application provides a silencing suppressor factor RhHDP2;

[0009] In a second aspect, the present application provides a protein encoded by the silencing suppressor RhHDP2;

[0010] In a third aspect, the present application provides a method for preparing a Rosaceae plant that regulates stamen hyperpetalization at low temperatures;

[0011] In a fourth aspect, the present application provides an application of a silencing suppressor factor RhHDP2 and an encoded protein in regulating petal development of Rosaceae plants under low temperature.

[0012] The present invention provides a silencing suppressor RhHDP2, and the nucleotide sequence of the silencing suppressor RhHDP2 is shown as SEQ ID NO.1.

[0013] The present invention discloses a protein encoded by the silencing suppressor RhHDP2, and the amino acid sequence of the protein encoded by the silencing suppressor RhHDP2 is shown in SEQ ID NO.2.

[0014] The present invention provides a preparation method of a Rosaceae plant for regulating stamen hyperpetalization at low temperature, comprising the following steps:

[0015] (1) Obtaining the nucleotide sequence and amino acid sequence of the silencing suppressor RhHDP2 gene;

[0016] (2) Using RT-PCR to obtain the silencing suppressor factor RhHDP2 fragment;

[0017] (3) The expression profile of the silencing suppressor factor RhHDP2 under adverse stress was analyzed by fluorescence quantitative PCR, and the RhHDP2 gene fragment was constructed into the TRV2 plasmid vector;

[0018] (4) using electroporation to transform the plasmid carrying RhHDP2 obtained in step (3) into Agrobacterium;

[0019] (5) Transforming the target plant with Agrobacterium carrying the transformation plasmid;

[0020] (6) Identification of transgenic positive seedlings of target plants;

[0021] (7) Screening of T2 generation positive homozygous transgenic plants of target plants;

[0022] (8) Analysis of stress resistance of homozygous transgenic plants.

[0023] Furthermore, in step (3), the CDS of RhHDP2 minus the stop codon was constructed between the two restriction sites XbaI and KpnI of the Super1300-GFP / Super1300-FLAG vector to obtain Super:RhHDP2-FLAG and Super:RhHDP2-GFP; the same sequence was constructed at the KpnI restriction site of the ops-TRV2-GFP vector to obtain ops-TRV-RhHDP2.

[0024] Furthermore, in step (5), the target plant is a Chinese rose. As an ornamental crop with extremely high economic value, the ornamental value of Chinese rose is mainly reflected in its flower color, flower shape and fragrance. Studies have reported that low temperature causes severe petalization of stamens in the rose 'Fendella', and the number of deformed petals increases, thereby reducing the quality of the flower shape, greatly reducing its ornamental value and commercial value. However, little is known about the internal mechanism of excessive double petalization of rose flowers caused by low temperature. The inventors found that the expression level of the RhHDP2 gene was significantly reduced under low temperature conditions, and the expression level was higher in various flower organs in the early stage of flower development. In the rose 'Samantha', the number of petalized stamens in the RhHDP2 silenced strain increased significantly, the petals were seriously deformed, and the expression level of the flower development C-type gene RhAG was reduced; the number of petalized stamens in the RhHDP2 transient overexpression strain was slightly reduced. These conclusions prove that under low temperature conditions, RhHDP2 is downregulated in response to low temperature stress, which in turn leads to a decrease in the expression level of RhAG, thereby affecting the development of rose stamens. Therefore, the inventors have discovered new functions and mechanisms of RhHDP2 through research, thereby providing a method for regulating floral organ development by changing the expression of RhHDP2 in plants.

[0025] The invention discloses an application of the silencing suppressor RhHDP2 and the encoded protein in regulating the petal development of Rosaceae plants under low temperature. Overexpression of the RhHDP2 gene or the protein can reduce the stamen petalization caused by low temperature. The deformity rate of rose petals can be reduced by increasing the expression of the gene or the protein in the plant.

[0026] Furthermore, the plant of the Rosaceae family is rose.

[0027] Furthermore, the excessive petalization of rose stamens under low temperature is regulated.

[0028] Beneficial effects: The present invention improves the stability of rose organ development: by regulating the expression of the silencing suppressor factor RhHDP2, the present invention can reduce the abnormal development of rose organs, such as stamen petalization, under low temperature conditions, thereby improving the ornamental value and commercial value of rose cut flowers.

[0029] Compared with the prior art, the present invention has the following advantages:

[0030] (1) A gene related to epigenetics of the present invention, HARBINGER TRANSPOSON-DERIVEDPROTEIN 2 (RhHDP2), was initially verified to have a reduced expression level under low temperature conditions. Enhance the adaptability of roses to low temperature environments: The application of the present invention helps roses maintain normal flower organ development in low temperature seasons and enhances the adaptability of roses to adverse climatic conditions. Improve economic benefits: By improving the quality and yield of rose cut flowers, the present invention helps to improve the economic benefits of growers.

[0031] (2) Providing molecular biological control means: Through genetic engineering technology, the present invention provides a new molecular biological means for regulating the development process of rose organs. Promoting the development of the fresh cut flower industry: By improving the quality of rose cut flowers, the present invention helps to increase the output value of the fresh cut flower industry and promote the economic development of related industries. Promoting the application of biotechnology: The present invention demonstrates the application potential of biotechnology in the improvement of ornamental plants and promotes the application of biotechnology in the agricultural field.

[0032] (3) Scientific value: The present invention reveals the mechanism of action of the silencing inhibitory factor RhHDP2 in the development of rose organs, providing a new scientific basis for the study of plant developmental biology and molecular biology. Easy operation: Through gene overexpression or gene silencing technology, the present invention provides a relatively simple operation method, so that non-professionals can also regulate the development of rose organs to a certain extent. Environmental friendliness: The application of the present invention reduces the dependence on chemical drugs and is an environmentally friendly regulation method. It has broad application prospects: In addition to roses, the principles and technical means of the present invention may also be applied to the regulation of flower organ development of other ornamental plants, and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0034] Figure 1This is a graph showing that the expression of RhHDP2 of the present invention is downregulated in response to low temperature. Figure 1 A is a differentially expressed gene in the 'Mitaoxueshan' of the present invention that regulates the development of floral organs in response to low temperature and is associated with DNA methylation modification. Figure 1 B is the expression change of RhHDP2 in rose flower buds under low / normal temperature analyzed by qRT-PCR of the present invention. The results were generated by 3 biological replicates, and **** represents a p value less than 0.001. Figure 1 C is the spatial variation of RhHDP2 expression at low / normal temperature during the differentiation period of rose stamen primordium by in situ hybridization analysis of the present invention. Scale bar: 200 μm. Sense probe is used as negative control.

[0035] Figure 2 This is a diagram showing the protein structure and spatiotemporal expression analysis of RhHDP2 of the present invention. Figure 2 A is the protein sequence analysis of the protein domain and DNA-binding domain of RhHDP2 of the present invention. Figure 2 B is the subcellular localization analysis of RhHDP2 in tobacco of the present invention. Figure 2 C is the expression changes of RhHDP2 in different floral organs of rose flowers at developmental stages 0 to 6 analyzed by qRT-PCR of the present invention. The results were generated by 4 biological replicates.

[0036] Figure 3 This is a diagram showing that silencing RhHDP2 of the present invention promotes rose stamen petalization and inhibits RhAG expression. Figure 3 A shows the petal phenotypes of the RhHDP2 silenced plants of the present invention and the control plants. Scale bar, 1 cm. Figure 3 B is the expression level of RhHDP2 gene in silenced plants and control plants analyzed by qRT-PCR of the present invention. Figure 3 C is the statistics of the number of floral organs in the RhHDP2 silencing group and the control group of the present invention. The values ​​represent the mean ± SD. The results were generated by 10 biological replicates. Student's t-test, ****P<0.0001. Figure 3 D is the expression of RhAG in RhHDP2 silenced plants and control plants analyzed by qRT-PCR of the present invention. The values ​​represent mean ± SD. The results were generated by 3 biological replicates, and **** represents a p value less than 0.001.

[0037] Figure 4 This is a diagram showing the inhibition of rose stamen petalization by TRV-mediated transient overexpression of RhHDP2 of the present invention. Figure 4 A shows the petal phenotypes of the RhHDP2 silenced plants of the present invention and the control plants. Scale bar, 1 cm. Figure 4B is the expression level of RhHDP2 gene in overexpression plants and control plants analyzed by qRT-PCR of the present invention, and ** represents p value less than 0.01. Figure 4 C is the statistics of the number of floral organs in the RhHDP2 overexpression group and the control group of the present invention. The values ​​represent the mean ± SD. The results were generated by 12 biological replicates. DETAILED DESCRIPTION

[0038] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0039] In this application, the term "and / or" describes the association relationship of associated objects, indicating that there may be three relationships. For example, A and / or B can mean: A exists alone, A and B exist at the same time, and B exists alone. A and B can be singular or plural. The character " / " generally indicates that the associated objects are in an "or" relationship.

[0040] In this application, "at least one" means one or more, and "plurality" means two or more. "At least one of the following" or similar expressions refers to any combination of these items, including any combination of single items or plural items. For example, "at least one of a, b, or c", or "at least one of a, b, and c" can all mean: a, b, c, ab (i.e., a and b), ac, bc, or abc, where a, b, c can be single or multiple, respectively.

[0041] It should be understood that in the various embodiments of the present application, the size of the serial numbers of the above-mentioned processes does not mean the order of execution, some or all of the steps can be executed in parallel or sequentially, and the execution order of each process should be determined by its function and internal logic, and should not constitute any limitation on the implementation process of the embodiments of the present application.

[0042] The terms used in the embodiments of the present application are only for the purpose of describing specific embodiments, and are not intended to limit the present application. The singular forms "a", "said" and "the" used in the embodiments of the present application and the appended claims are also intended to include plural forms, unless the context clearly indicates other meanings.

[0043] The weight of the relevant components mentioned in the embodiment description of the present application can not only refer to the specific content of each component, but also represent the proportional relationship between the weights of the components. Therefore, as long as the content of the relevant components is proportionally enlarged or reduced according to the embodiment description of the present application, it is within the scope disclosed in the embodiment description of the present application. Specifically, the mass described in the embodiment description of the present application can be a mass unit known in the chemical industry such as μg, mg, g, kg, etc.

[0044] The terms "first" and "second" are used only for descriptive purposes to distinguish objects such as substances from each other, and should not be understood as indicating or implying relative importance or implicitly indicating the number of indicated technical features. For example, without departing from the scope of the embodiments of the present application, the first XX may also be referred to as the second XX, and similarly, the second XX may also be referred to as the first XX. Thus, features defined as "first" and "second" may explicitly or implicitly include one or more of the features.

[0045] In a first aspect, an embodiment of the present application provides a silencing suppressor factor RhHDP2, and the nucleotide sequence of the silencing suppressor factor RhHDP2 is shown in SEQ ID NO.1.

[0046] A second aspect of an embodiment of the present application provides a protein encoded by the silencing suppressor RhHDP2, and the amino acid sequence of the protein encoded by the silencing suppressor RhHDP2 is shown in SEQ ID NO.2.

[0047] The third aspect of the embodiment of the present application provides a method for preparing a Rosaceae plant for regulating stamen hyperpetalization at low temperature, comprising the following steps:

[0048] (1) Obtaining the nucleotide sequence and amino acid sequence of the silencing suppressor RhHDP2 gene;

[0049] (2) Using RT-PCR to obtain the silencing suppressor factor RhHDP2 fragment;

[0050] (3) The expression profile of the silencing suppressor factor RhHDP2 under adverse stress was analyzed by fluorescence quantitative PCR, and the RhHDP2 gene fragment was constructed into the TRV2 plasmid vector;

[0051] (4) using electroporation to transform the plasmid carrying RhHDP2 obtained in step (3) into Agrobacterium;

[0052] (5) Transforming the target plant with Agrobacterium carrying the transformation plasmid;

[0053] (6) Identification of transgenic positive seedlings of target plants;

[0054] (7) Screening of T2 generation positive homozygous transgenic plants of target plants;

[0055] (8) Analysis of stress resistance of homozygous transgenic plants.

[0056] In some embodiments, in step (3), the CDS of RhHDP2 without the stop codon is constructed between the two restriction sites XbaI and KpnI of the Super1300-GFP / Super1300-FLAG vector to obtain Super:RhHDP2-FLAG and Super:RhHDP2-GFP; the same sequence is constructed at the KpnI restriction site of the ops-TRV2-GFP vector to obtain ops-TRV-RhHDP2.

[0057] In some embodiments, in step (5), the target plant is rose.

[0058] A fourth aspect of the embodiments of the present application provides an application of a silencing suppressor factor RhHDP2 and an encoded protein in regulating the petal development of Rosaceae plants under low temperature.

[0059] In some embodiments, the plant of the Rosaceae family is rose.

[0060] In some embodiments, excessive petalization of rose stamens is regulated under low temperature.

[0061] Example 1

[0062] Materials and Methods

[0063] Plant material and treatment

[0064] Rose tissue culture seedlings culture. Rose stem segments containing leaf buds were placed vertically into the propagation medium, which contained 4.74g / LMS powder, 1mg / L 6-BA, 1mg / L GA, 0.05mg / LNAA, 30g / L sucrose, 6.8g / L Agar, and pH 5.95. When the plant seedlings grew to about 8cm in height, they were inoculated into the rooting medium containing 2.37g / LMS powder, 0.01mg / L NAA, 30g / L sucrose, 7.5g / LAgar, and pH 5.95, and cultured for about 20 days. The rooted seedlings were taken out and cleaned with water, planted in a culture pot with a ratio of nutrient soil to vermiculite of 2:1, and covered with plastic wrap for about 15 days. After the film was removed, they were cultured normally. The photoperiod of plant culture was 16h / 8h (light / dark), the relative humidity of the air was 40% to 60%, and the temperature was 22±2℃.

[0065] Tobacco cultivation. Evenly spread the tobacco seeds on the surface of moist soil containing nutrient soil and vermiculite in a ratio of 1:1. Transplant the seedlings after one week. When the tobacco grows 4 true leaves, it can be used for injection. The cultivation temperature of tobacco is the same as that of rose.

[0066] Gene cloning

[0067] According to the rose flower bud low temperature transcriptome database, Arabidopsis website (https: / / www.arabidopsis.org / ) and the rose powder database ( https: / / lipm-browsers.toulouse.inra.fr / pub / RchiOBHm-V2 / ), and the full-length sequence of the coding region of the RhHDP2 gene was obtained by homologous cloning. The phylogenetic tree construction and protein sequence alignment of RhHDP2 and other species HDP2 were performed using MEGA7 and Bio-edit, respectively.

[0068] Real-time fluorescence quantitative PCR

[0069] Total RNA was extracted from rose leaves and flower organs using the Adelaide EASYspinPlus polysaccharide polyphenol / complex plant RNA rapid extraction kit. IIQ RT SuperMix for qPCR (+gDNAwiper) reverse transcription kit, catalog number R223-01, was used for reverse transcription. The quantitative reagent used was ChamQ SYBR qPCR Master Mix (HighROX Premixed). The rose RhUBI gene (GenBank accession number JK622648) was used as an internal reference gene.

[0070] Vector construction

[0071] Construction of transient silencing vector: Select the more specific regions of RhHDP2, namely the CDS 3' end and 3' UTR region, with a total fragment length of 302 bp. Add homology arms to both ends of the fragment, insert the fragment into the TRV2 vector through homologous recombination, and fuse to form TRV-RhHDP2.

[0072] Overexpression vector construction: The CDS of RhHDP2 without the stop codon was constructed between the two restriction sites XbaI and KpnI of the Super1300-GFP / Super1300-FLAG vector to obtain Super:RhHDP2-FLAG and Super:RhHDP2-GFP. The same sequence was constructed at the KpnI restriction site of the ops-TRV2-GFP vector to obtain ops-TRV-RhHDP2.

[0073] Virus-induced gene silencing (VIGS)

[0074] To clarify the function of RhHDP2, TRV1, TRV2 and TRV2-RhHDP2 plasmids were transferred into Agrobacterium GV3101, and 5 ml of liquid LB (containing the corresponding kanamycin and rifampicin) was shaken. The next day, 200 ml of liquid LB (containing the corresponding kanamycin, rifampicin and 200 nM acetosyringone) was shaken in a 500 ml conical flask for each of the three bacterial solutions, and the volume ratio of the bacterial solution to the liquid LB medium was 1:100. The culture was shaken at 28°C and 200 rpm for about 12 hours, and centrifuged at 5000 rpm at room temperature for 10 min, and the supernatant was discarded. The TRV1, TRV2 and TRV2-RhHDP2 bacterial cultures were resuspended with infection solution (200 nM acetosyringone, 10 mM magnesium chloride, 10 mM sodium fatty acid methyl ester sulfonate), and the OD600 was adjusted to 1.0. The resuspended bacterial cultures TRV2 and TRV2-RhHDP2 were mixed with equal volumes of TRV1 and left in the dark for 3 to 6 hours.

[0075] Wash and prepare rose tissue culture seedlings in advance, immerse them in the static TRV2 and TRV2-RhHDP2 bacterial solutions, and perform vacuum suction. The first time, pump to 0.8 atmospheres, maintain the pressure for 5 minutes, and slowly release the air for 20 minutes, repeat twice. Gently rinse the tissue culture seedlings with tap water, cover with film to keep them moist, and place them in a low-temperature culture room at 6-8℃. Plant them after three days of acclimatization.

[0076] In situ hybridization

[0077] The non-conservative fragment of the ORF region of the RhHDP2 sequence was selected for cloning and in vitro transcription was performed using the Roche DIG DNA Labeling and Detection Kit. DNase I was added for purification, anhydrous ethanol precipitation, carbonate solution hydrolysis, and finally glacial acetic acid, ethanol, formamide, etc. were added for neutralization.

[0078] Take samples from the 1st to 4th stage of early development of rose buds, fix them with 3.7% FAA, dehydrate them with alcohol gradient, make them transparent with xylene, embed them with paraffin and slice them longitudinally. Spread the slices in a 37℃ water bath, pick up the slices and put them on slides, and bake them at 42℃ overnight. On the second day, hybridization treatment is carried out, and the slides are placed on the staining rack, and the staining rack is placed in a glass hybridization tank containing the solution. After dewaxing and rehydration, protease treatment and refixation, acetic anhydride treatment, washing and dehydration, hybridization overnight. On the third day, after washing at 55℃, antibody incubation, washing, and finally color development for 1 to 7 days, it can be observed under an optical microscope.

[0079] Results and Analysis

[0080] RhHDP2 responds to low temperature stress

[0081] The inventors used the low-temperature-sensitive cut rose 'Mi Tao Xue Shan' as the experimental material and performed whole transcriptome sequencing on the primary flower buds (stamen primordium development stage) after low-temperature treatment. From this, a differentially expressed gene with a gene number of MSTRG.23375 was identified, which was annotated as an anti-silencing factor that inhibits DNA hypermethylation ( Figure 1 A), Phylogenetic analysis identified MSTRG.23375 as a homologous gene of Arabidopsis AtHDP2, and thus named RhHDP2.

[0082] The rose plants of 'Samantha' were treated with low temperature at 4℃. Real-time fluorescence quantitative PCR detection showed that the expression level of RhHDP2 was significantly reduced in the rose buds treated with low temperature for 12h and 16h ( Figure 1 B). To further explore the spatiotemporal expression characteristics of RhHDP2 under low temperature, in situ hybridization was used to detect the expression of rose flower buds during the stamen primordium development period.

[0083] The results showed that at room temperature, the strongest signal and highest expression of RhHDP2 were found in the stamens and petal primordia of flower buds. After low temperature treatment at 4℃, the expression of RhHDP2 was significantly reduced ( Figure 1 C). The above results showed that RhHDP2 responded to low temperature stress and its expression level was downregulated under low temperature.

[0084] Analysis of protein structure and gene expression characteristics of RhHDP2

[0085] The amino acid sequence of RhHDP2 was compared with that of HDP2 in 6 other species. It was found that there is a highly conserved MYB-DNA-Binding domain in the N-terminal 31aa-106aa region of RhHDP2, in which three tryptophan residues are crucial for the MYB-DNA-Binding domain ( Figure 2 A). Subcellular localization detection in tobacco revealed that RhHDP2 was localized in the nucleus ( Figure 2 B).

[0086] We selected floral organ tissue samples from the 0-6 developmental stages of 'Samantha' flowers and detected the spatiotemporal expression of RhHDP2 by real-time fluorescence quantitative analysis. We found that RhHDP2 was expressed in all stages of floral development and in all parts of floral organs. The expression of RhHDP2 in the receptacle increased with the increase in flowering stages, while the expression in petals and stamens decreased significantly after the second flowering stage. The expression pattern of RhHDP2 is similar to that of floral organ development genes, and both are concentrated in some floral organs at specific stages ( Figure 2 C).

[0087] Silencing RhHDP2 significantly increased the number of petalized stamens

[0088] After silencing RhHDP2 in rose 'Samantha' using VIGS technology, real-time fluorescence quantitative PCR detected that the expression of RhHDP2 in the silencing group was significantly reduced. Observing the phenotype of floral organ development at room temperature, it was found that the number of petalized stamens and total stamens in the silencing group was significantly increased compared with the control group, the number of normal stamens was slightly reduced compared with the control group, and there was no significant difference in the number of normal petals, suggesting that petalized stamens may be transformed from reduced normal stamens ( Figure 3 At the same time, the detection of flower development C-type gene RhAG found that the expression of RhAG was significantly downregulated in the RhHDP2 silencing group ( Figure 3 D). The above results indicate that RhHDP2 may regulate the development of rose floral organs by regulating the expression of floral development genes, and the number of petalized stamens increases after silencing.

[0089] Overexpression of RhHDP2 slightly reduced the number of petalized stamens

[0090] After TRV-mediated transient overexpression of RhHDP2, real-time fluorescence quantitative PCR detected a slight increase in the expression of RhHDP2 in the overexpression group. Observation of the floral organ phenotype revealed that the number of petalized stamens slightly decreased after overexpression of RhHDP2, but there was no significant difference in the total number of petals and stamens, indicating that overexpression of RhHDP2 can reduce the transformation of stamens into petals, reduce the rate of petal deformities, and ensure the normal development of floral organs ( Figure 4 ). The primers used in the present invention are shown in Table 1:

[0091] Table 1

[0092]

[0093] qRT-RhUBI2-RCCTGCGTGTCTGTCCGCATTG

[0094] qRT-OE-RhHDP2-F GTCCAAGAGGAGAAGGCGAC

[0095] qRT-OE-RhHDP2-R CGCCACATGGGTTTGAACTG

[0096] qRT-RhHDP2-F CTCTCGAAATCGGAGCACCA

[0097] qRT-RhHDP2-RGTCCGGTGCTACCTGAGAAC

[0098] qRT-RhAG-F GGGCATGGAAGCTACGAGA

[0099] qRT-RhAG-RAAATCTGGTCATGGCGCGAG

[0100] In situ hybridization probe primers

[0101] ISH-RhHDP2-1F TAATACGACTCACTATAGGGCCGAGAATGCAGACCATGAG

[0102] ISH-RhHDP2-1R AGTCACACTCACACCACAAAGC

[0103] ISH-RhHDP2-2F CCGAGAATGCAGACCATGAG

[0104] ISH-RhHDP2-2RTAATACGACTCACTATAGGGAGTCACACTCACACCACAAAGC

[0105] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments, and the above embodiments and descriptions are only for explaining the principles of the present invention. Without departing from the spirit and scope of the present invention, the present invention may have various changes and improvements, and the scope of protection of the present invention is defined by the attached claims, description and their equivalents.

Claims

1. A method for preparing a Rosaceae plant for regulating stamen hyperpetalization at low temperature, characterized in that The steps include: (1) Obtaining silencing suppressor factors RhHDP2 The nucleotide sequence and amino acid sequence of the gene; the silencing suppressor factor RhHDP2 The nucleotide sequence is shown in SEQ ID NO.1; the silencing suppressor factor RhHDP2 The amino acid sequence of the encoded protein is shown in SEQ ID NO.2; (2) Obtaining silencing suppressor factors using RT-PCR RhHDP2 Fragment; (3) Analysis of silencing suppressor factors using fluorescent quantitative PCR RhHDP2 The expression profile under adverse stress RhHDP2 The gene fragment was constructed into the TRV2 plasmid vector; (4) The electroporation method was used to RhHDP2 Transform Agrobacterium with plasmids; (5) Transforming a target plant with the Agrobacterium carrying the transformation plasmid; the target plant is a rose; (6) Identification of transgenic positive seedlings of target plants; (7) Screening of T2 generation homozygous positive transgenic plants of target plants; (8) Analysis of stress resistance of homozygous transgenic plants.

2. The method for preparing a Rosaceae plant for regulating stamen hyperpetalization at low temperature according to claim 1, characterized in that: In step (3), RhHDP2 The CDS without the stop codon was constructed between the XbaI and KpnI restriction sites of the Super1300-GFP / Super1300-FLAG vector to obtain Super:RhHDP2-FLAG and Super:RhHDP2-GFP; the same sequence was constructed at the KpnI restriction site of the ops-TRV2-GFP vector to obtain ops-TRV-RhHDP2.

3. The silencing suppressor according to claim 1 RhHDP2 And the use of its encoded protein in regulating the petal development of Rosaceae plants under low temperature, wherein the Rosaceae plants are roses; regulating the excessive petalization of rose stamens under low temperature.

Images