Application of a rice gene LEFT in improving plant cold tolerance and yield

Abstract

The present invention relates to the field of plant genetic engineering, and in particular to an application of a rice gene LEFT in improving plant cold tolerance and yield. The rice LEFT gene is a rice tillering trait regulatory gene derived from the indica rice variety Xiang Zao Xian 45. LEFT is a gene encoding the following protein (a) or (b). The present invention reveals for the first time that the rice LEFT gene has the function of enhancing plant cold tolerance and yield, and the LEFT gene is of great significance for further analyzing the plant cold tolerance regulatory mechanism and genetic network. Experiments show that under natural low temperature conditions, the average tiller number and yield per plant of the LEFT gene overexpressing transgenic rice strain are significantly higher than those of the wild type, and the LEFT gene can be used for plant genetic improvement to obtain plants with enhanced cold tolerance and yield. The present invention provides a new gene resource for plant cold tolerance breeding, especially rice cold tolerance breeding, and has important application value for cultivating new varieties of cold-resistant crops and ensuring crop production safety.

Description

Technical Field

[0001] The invention belongs to the field of plant genetic engineering, and in particular, relates to the application of rice gene LEFT in improving plant cold tolerance and yield. Background Art

[0002] Rice is one of the most important food crops in the world. About 60% of the world's population relies on rice as their staple food, and rice production is related to world food security. Rice originated in tropical and subtropical regions and is a thermophilic crop, so it is more sensitive to low temperatures than other crops (Ma, Y. et al., Cell, 2015, 160: 1209-1221). Low temperature and cold damage seriously restrict rice production area and high and stable yields. Therefore, cultivating cold-resistant rice varieties is of great significance to ensuring food security and expanding rice planting to high latitudes and high altitudes.

[0003] The cold tolerance of rice is mostly controlled by quantitative trait loci. At present, researchers have located many QTLs related to low temperature using different genetic materials (Liu Citao et al., Heredity, 2018, 40(3):171-185). However, very few cold tolerance QTLs and genes have been cloned, which greatly restricts the analysis of the genetic mechanism of rice cold tolerance and the breeding process. Therefore, it is urgent to explore more new cold tolerance genes in rice, create new cold tolerance rice germplasm, provide theoretical and technical support for the breeding of new cold tolerance rice varieties, and provide new gene resources to reduce the loss of rice yield caused by cold damage and safeguard my country's food security. Summary of the invention

[0004] The purpose of the present invention is to provide application of rice LEFT gene in improving cold tolerance and yield of plants.

[0005] In order to achieve the purpose of the present invention, in the first aspect, the present invention provides the use of the rice LEFT gene in improving plant cold tolerance and yield. Wherein, the rice LEFT gene is a rice tillering trait regulating gene, which is derived from the indica rice variety Xiang Zao Xian 45. LEFT is a gene encoding the following protein (a) or (b):

[0006] (a) a protein consisting of the amino acid sequence shown in SEQ ID NO: 3;

[0007] (b) A protein derived from (a) with equivalent functions, wherein one or more amino acids are substituted, deleted or added to the sequence shown in SEQ ID NO: 3.

[0008] Optionally, the nucleotide sequence of the rice gene LEFT comprises a nucleotide sequence selected from the following group of nucleotide sequences (1)-(7):

[0009] (1) the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2;

[0010] (2) a nucleotide sequence that hybridizes with the nucleotide sequence of (1) under stringent conditions and encodes a plant cold tolerance-related protein;

[0011] (3) a nucleotide sequence that is at least 70%, preferably at least 80%, more preferably at least 90%, and especially at least 95%, 98% or 99% identical to the nucleotide sequence of (1);

[0012] (4) a nucleotide sequence that encodes a protein having the same amino acid sequence as the nucleotide sequence of (1) but differs in sequence due to the degeneracy of the genetic code;

[0013] (5) a nucleotide sequence encoding one of the following amino acid sequences: the amino acid sequence shown in SEQ ID NO: 3, or an amino acid sequence that differs from the amino acid sequence shown in SEQ ID NO: 3 by substitution, deletion and / or insertion of one or more (e.g., 1-25, 1-20, 1-15, 1-10, 1-5, 1-3) amino acid residues, or an amino acid sequence that has at least 70%, preferably at least 80%, more preferably at least 90%, and especially at least 95% or 98% identity with the amino acid sequence shown in SEQ ID NO: 3;

[0014] (6) An active fragment of any nucleotide sequence of (1) to (5); or

[0015] (7) A nucleotide sequence complementary to any one of the nucleotide sequences (1) to (5).

[0016] Among them, the nucleotide sequences defined in (2)-(7) have the function of enhancing the cold tolerance of plants.

[0017] In the present invention, the plants include but are not limited to rice, corn, sorghum, wheat and barley.

[0018] In a second aspect, the present invention provides a method for improving cold tolerance of plants, the method comprising:

[0019] 1) Producing a plant comprising the rice LEFT gene; or

[0020] 2) Overexpression of the rice LEFT gene in plants.

[0021] The aforementioned method includes but is not limited to transgenic, hybridization, backcrossing, selfing or asexual reproduction.

[0022] Furthermore, the method includes introducing a recombinant expression vector containing the rice LEFT gene into plant cells using conventional biological methods such as Ti plasmid, plant virus vector, direct DNA transformation, microinjection, gene gun, electroporation, Agrobacterium-mediated, etc. to obtain transgenic plants; or, hybridizing a plant containing the rice LEFT gene with another plant to obtain hybrid offspring. The obtained offspring plants have improved cold tolerance.

[0023] In a third aspect, the present invention provides a promoter of a rice LEFT gene, wherein the promoter is:

[0024] i) the nucleotide sequence shown in SEQ ID NO:4;

[0025] ii) a nucleotide sequence having promoter activity in which one or more nucleotides are substituted, deleted and / or added to the nucleotide sequence shown in SEQ ID NO: 4;

[0026] iii) a nucleotide sequence that hybridizes with the sequence shown in SEQ ID NO: 4 under stringent conditions and has promoter activity;

[0027] iv) a nucleotide sequence that is at least 70%, preferably at least 80%, more preferably at least 90%, in particular at least 95% or 98% or 99% identical to a nucleotide sequence of i), ii) or iii);

[0028] v) an active fragment of any nucleotide sequence i) to iv); or

[0029] vi) a nucleotide sequence complementary to any one of the nucleotide sequences i) to iv).

[0030] The present invention also provides biological materials comprising the rice gene LEFT promoter.

[0031] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0032] (I) This invention reveals for the first time that the rice LEFT gene has the function of enhancing plant cold tolerance and yield. The LEFT gene is of great significance for further analyzing the plant cold tolerance regulation mechanism and genetic network.

[0033] (ii) The experiment showed that under natural low temperature conditions, the average tiller number and yield per plant of the LEFT gene overexpressing transgenic rice lines were significantly higher than those of the wild type. The LEFT gene can be used in plant genetic improvement to obtain plants with increased cold tolerance and yield.

[0034] (III) The present invention provides a new gene resource for plant cold-tolerant breeding, especially rice cold-tolerant breeding, and has important application value for cultivating new varieties of cold-tolerant crops and ensuring the safety of crop production. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 The LEFT gene fine positioning map and cold stress phenotype: A: LEFT gene fine positioning and left mutation site; B: cold treatment phenotype of wild type WT and mutant left plants at the seedling stage; C: comparison of survival rate of wild type WT and mutant left plants after cold treatment; C: cold treatment phenotype of wild type WT and mutant left plants at the booting stage; D: comparison of fruit setting rate of wild type WT and mutant left plants before and after cold treatment, (scale is 10 cm, * indicates p<0.05, ** indicates p<0.01, *** indicates p<0.001, ns indicates no significant difference, the same below).

[0036] Figure 2 Comparison of photosynthesis intensity, sucrose content and yield data between WT and left plants. AC: Comparison of chlorophyll a, chlorophyll b and sucrose content in leaves between WT and left plants; DI: Comparison of plant height, effective panicle number, spikelet number per panicle, fruit setting rate, 1000-grain weight and yield per plant between WT and left lines.

[0037] Figure 3 WT, left and LEFT knockout mutants (LEFT KO ) Phenotypes of cold treatment at seedling stage: A: Under normal temperature, WT, left and LEFT KO Seedling phenotype; B: LEFT gene knockout target site; C: WT, left and LEFT before and after low temperature treatment KO Seedling phenotype; D: WT, left and LEFT after low temperature treatment KO Survival rate of seedlings.

[0038] Figure 4 This is the plasmid map of the overexpression vector pHF611.

[0039] Figure 5 Figure 2 shows the seedling phenotypes of WT, left and LEFT overexpressing materials (LEFT-OE): A: Seedling phenotypes of WT, left and LEFT-OE lines before and after low temperature treatment; Figure B: Survival rate of WT, left and LEFT-OE seedlings after cold treatment.

[0040] Figure 6Comparison of the average yield per plant data of WT and LEFT-OE strains under natural low temperature conditions: A: Temperature map of Sanya, Hainan from December 2023 to March 2024; B: Plant maturity phenotypes of WT and LEFT-OE strains; C: Pie chart of single plant yield of WT and LEFT-OE strains; D: Comparison of the average tiller number per plant of WT and LEFT-OE strains; Figure E: Comparison of the average yield per plant of WT and LEFT-OE strains. DETAILED DESCRIPTION

[0041] Example 1 Discovery of the rice gene LEFT's function of enhancing plant cold tolerance and increasing yield

[0042] The inventors first cloned the rice gene LEFT, https: / / www.ricedata.cn / gene / , database number: LOC_03g18200. The inventors previously used the early rice variety Xiangzaoxian 45 (WT) to create a mutant library, from which they screened a low-temperature oligotillering mutant left. The F2 genetic population was constructed using left and Zhonghua 11, and the left mutant gene was precisely located in a 56kb interval on chromosome 3 by map-based cloning. This interval has a total of 8 expression frames. By sequence alignment, it was found that the 777th base G deletion in the 5th expression frame (ORF5) of left caused a frameshift mutation ( Figure 1 A). Through genetic complementation, ORF5 was verified as the functional gene of LEFT. This gene is currently unannotated and is a new gene. The cold tolerance of WT and left was compared and analyzed by cold stress at the seedling stage and booting stage. The results showed that the survival rate of WT plants after cold treatment at the seedling stage was significantly higher than that of left ( Figure 1 BC); however, after cold treatment at the booting stage, the fruit setting rate of WT plants was significantly higher than that of left ( Figure 1 CD).

[0043] Under normal temperature conditions, the photosynthesis intensity and sucrose content of the leaves of WT and left plants were tested. The results showed that the chlorophyll a, chlorophyll b and sucrose content of WT plants were significantly higher than those of left. Under normal temperature conditions, the yield traits of WT and left plants were investigated and it was found that the plant height, number of effective ears per plant, number of spikelets per ear and yield per plant of WT plants were significantly higher than those of left plants, while there were no significant differences in fruit set rate and thousand-grain weight ( Figure 2). It can be seen that the plants containing the gene LEFT clearly show cold tolerance and high yield traits. The above-mentioned cold treatment method at the seedling stage is: the seedlings are hydroponically cultured with Yoshida nutrient solution in an artificial climate box (28℃day / 25℃night, 14 / 10h, humidity 70-80%) to the two-leaf and one-heart stage, transferred to 15℃ cold tolerance acclimatization for 2 days, and then treated at 4℃ for 2 days. After treatment, the materials are transferred to normal conditions to resume growth, and finally their survival rate is investigated. Three replicates are set for each of the above materials. The cold treatment method at the booting stage is: the seedlings are grown in the experimental field to the booting stage, and then the neat and consistent individual plants are selected and transferred to an artificial climate box (28℃day / 25℃night, 14 / 10h, humidity 70-80%) for treatment for 5 days. After treatment, the materials are transferred to normal conditions to resume growth, and finally their fruit setting rate is investigated. Three replicates are set for each of the above materials.

[0044] Example 2 Construction of LEFT gene knockout vector and genetic transformation of rice

[0045] Design and synthesis of sgRNA: Design the adapter primers required to knock out the target gene LEFT, select NGG for PAM sequence, Μ6 for snoRNA promoter, 20bp for Gμide Seqμence Length, and Oryzasative (MSΜ) for Target Genome. Select knockout primers with GC content of 45%-70%, off-target estimate equal to or greater than 0.7 (or 0.6), Offtarget < 100, TSL of 2 or 3; GSL <= 6; CBP <= 7; TBP <= 12; IBP <= 6, and the leading F is GCCG + target sequence ( Figure 2B), the rear primer R is the reverse complementary sequence of the AAAC+ target sequence, and the primer sequences are as follows: front primer CRF-1: cagtggtctcatgcaagtagtaaccttggagggag; rear primer CRR-1: cagtggtctcaaaacttcggagacgagccccccgg. The Μ-F / gR-R primer sequences are for constructing Crispr-Ca9 universal primers: Μ-F: TCGAGAACGGTCGTAAGAGGA; gR-R: TGTAACGCTTCCTGTCGATGGT; and then the primers were synthesized at Changsha Qingke Biological Company. Construction of CRISPR knockout vector: The vector used in this experiment is the pYLCRISPR / Cas9 binary vector system, and the sgRNA intermediate vector pYLgRNA-OsΜ6a. The sgRNA expression cassette was constructed by target linker ligation amplification method to obtain the sgRNA expression cassette, and the purified PCR product sgRNA expression cassette was cloned into the pYLCRISPR / Cas9 vector: This step used the "Golden Gate" cloning method based on BsaⅠ (No. Thermo; LOT: 00882417) digestion and ligation (Gibson et al. developed an "isothermal in vitro recombination reaction", also known as "Gibson Assembly", which can connect multiple PCR fragments (Gibson, et al., 2009; Gibson, et al., 2010; Gibson, 2011), and the sgRNA expression cassette was connected to the binary vector pYL CRISPR / Cas9 by the "cut and ligation" method. The recombinant expression vector was transferred into Escherichia coli for amplification, and the extracted vector plasmid was verified to be correct by sequencing (Changsha Qingke Biological Company), and the above plasmid was saved.

[0046] Rice genetic transformation and phenotypic identification: Using WT as the genetic receptor material, the constructed knockout vector was sent to Wuhan Boyuan Biological Company for genetic transformation. After identification, transgenic positive plants were obtained and the LEFT gene base insertion and deletion mutation type was obtained ( Figure 3 B). Then the homozygous mutant (LEFT KO ) Plants were planted in the base, and soil and fertilizer were managed normally. After the transgenic rice seedlings matured, sufficient homozygous strain seeds were harvested. KO Normal culture was performed and LEFT was found KO The seedling phenotype is consistent with left ( Figure 3 A) For WT, left and LEFT KO The seedlings were treated with low temperature and the results showed that left and LEFT KOThe survival rate of seedlings of these strains was significantly lower than that of WT ( Figure 3 CD), which once again proves that the plants containing the LEFT gene clearly show cold tolerance. The above cold treatment method refers to Example 1.

[0047] Example 3 Construction of LEFT gene overexpression vector and genetic transformation of rice

[0048] Design and synthesis of overexpression primers: Design primers with recombination adapters. First, select 18-24bp before and after the CDS sequence as gene CDS sequence amplification primers, then select two restriction sites (Sam1 and BamHI) in the MCN (multiple cloning site region) of the overexpression vector pHF611, select 12-15bp before the restriction site Sam1 as the front primer (F) recombination adapter, and select 12-15bp reverse complementary after the restriction site BamHI as the rear primer (R) recombination adapter. At this time, the overexpression primer sequence is obtained, F: recombination adapter sequence + restriction site sequence (restriction site: Sma1) + CDS sequence amplification primer F; R: recombination adapter sequence reverse complementary sequence + restriction site sequence (restriction site: BamHI) + CDS sequence amplification primer R. The designed primer sequence is synthesized at Qingke Biotechnology Co., Ltd.

[0049] LEFT overexpression vector construction: The vector used in this experiment is pHF611 overexpression vector (PEXP1002 Ruibo Biotechnology), the vector map is as follows Figure 4As shown, the homologous recombination method was used to construct the target gene fusion vector. Using the leaf tissue cDNA of WT as a template, the high-fidelity enzyme KOD (NO.TOYOBO; REF: KFX-101) was used, and the seamless cloning primers OE-F: CTCTCTCTCAAGCTTGGATCCATGGCCTCACGA AGTCTATC; OE-R: TTATCGATACCGTCACTAGTGAACTCGTTGAAGTGAATGG were used for sequence amplification to amplify the target gene. The amplified product was identified by agarose electrophoresis, and the gel was cut and recovered after the size met the target. Linearization of overexpression vector pHF611: The overexpression vector pHF611 was double-digested with restriction endonucleases BamHI and HindIII (NO.NEB; REF: R0141L, R0136L). The digestion reaction system included 1 μl of restriction endonuclease BamHI, 1 μl of HindIII, 39 μl of ddH2O, 4 μl of Phf611 plasmid vector, 5 μl of 10× buffer (supplied with the enzyme), the digestion temperature was 37°C, and the digestion time was 2 h 40 min. Purification of linearized vector product and amplified fragment PCR product: The amplified LEFT CDS sequence and the original solution of the linearized vector fragment after enzyme digestion were subjected to 1% agarose gel electrophoresis (NO. Qingke Bio; REF. TSJ001), and then the position of the target band was observed on a gel imager (Monad Gel Imaging System QuickGel 6100); the gel blocks where the target positions were located were cut off, and the gel recovery kit was used for recovery to obtain the purified pHF611 linearized vector and the purified target gene fragment (with a recombination linker). (The gel recovery step is the same as the knockout vector construction). Product connection and transformation: The purified target gene fragment of the band size recovered in the previous step was connected with the purified linearized vector fragment at a concentration ratio of 1:3, and the connection reaction system was 20μl.

[0050] The above reaction solutions were mixed and connected at a temperature of 50°C for 1 hour. After the product connection was completed, the competent E. coli was transformed, the plate was streaked, and the culture was inverted at 37°C in an incubator overnight (the vector transformation steps were the same as the knockout vector transformation). Bacteria selection: Some colonies were picked to LB liquid culture medium containing kanamycin, the shaker speed was 220rpm, the temperature was 37°C, and cultured for 16 hours. After shaking until the bacterial solution was turbid, the plasmid was extracted using a plasmid extraction kit (NO.omega; REF: D6943-02) (the extraction steps were the same as the knockout plasmid extraction), and then the plasmid was sent to the sequencing department of Qingke for sequencing, and the overexpression vector containing the target gene was screened.

[0051] Rice genetic transformation and phenotypic identification: After the vector was successfully constructed, the plasmid vector was sent to Wuhan Boyuan Company for genetic transformation, and the transformed receptor material was WT. After obtaining the overexpression transgenic plants, the transgenic rice seedlings were planted in the base, and normal water and fertilizer management and normal irrigation measures were taken to obtain sufficient homozygous strain seeds. The WT, left, and overexpression strains (LEFT-OE) were cold treated. The results showed that the survival rate of the WT and LEFT-OE strains after cold treatment was significantly greater than that of left ( Figure 5 ), proving that the gene LEFT can regulate the cold tolerance of plants. Figure 6 A), conventional field planting was carried out on WT and LEFT-OE strains, and the plant height and yield traits were identified after maturity. The results showed that the average tiller number of LEFT-OE per plant was 6.1, which was 29.8% higher than the average tiller number of WT per plant of 4.7, and the increase was extremely significant; the average yield of LEFT-OE per plant was 19.8g, which was 27.7% higher than the average yield of WT per plant of 15.5g, and the increase was extremely significant ( Figure 6 BE), while plant height, number of grains per panicle, fruit setting rate and 1000-grain weight had no significant differences. The above results indicate that under low temperature conditions, upregulating the expression level of LEFT can further increase rice yield, and LEFT is a potential yield-increasing gene.

[0052] Example 4 Application of LEFT gene in breeding new cold-tolerant crop varieties

[0053] In the process of cultivating new crop varieties, a transgenic method can be used to transform a recipient crop using a plant expression vector containing the LEFT gene of the present invention to obtain a transgenic crop plant, thereby improving the cold tolerance and yield of the recipient crop. It is also possible to hybridize a crop plant containing the LEFT gene provided by the present invention with another crop plant to obtain a progeny crop plant, and the cold tolerance of the progeny crop plant obtained is improved and the yield is increased. The crops include rice, corn, sorghum, wheat, barley, etc.

[0054] The embodiments of the present invention are described in detail above with reference to the accompanying drawings, but the present invention is not limited thereto, and various changes can be made within the knowledge scope of technicians in the relevant technical field without departing from the purpose of the present invention.

[0055] Although the present invention has been described in detail above with general descriptions and specific embodiments, some modifications or improvements can be made to it based on the present invention, which is easy for those skilled in the art. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

[0056] Sequence Listing

[0057] A gene for regulating rice tillering in response to low temperature proposed in the present invention, the nucleotide sequence of the LEFT gene is shown in SEQ ID NO: 1:

[0058]

[0059] The open reading frame sequence of the LEFT gene is shown in SEQ ID NO: 2:

[0060]

[0061] The amino acid sequence of the encoded protein LEFT is shown in SEQ ID NO:3:

[0062] MASRSLSPLSSASKLCSRCGQADEPKMAATTFSSSPSKVTTAKLGGGVTRSSSPYTQLTFCSRHHFQKAATTAAAFHHKPPPAELSLLLSPARSKHARTCPAADNDRAAPAAQEATNTPPPPAAPSANGSPPQEPPKRAPLTARERLRAARVLGKYAEPGGSSPKGKASAASAAAGAAGKKPEFGSRVLDALRETDGKAGKKRSSRLPEAPSNMFDDSKRGLPKEGWTFEALPFGTDVIVIAASFTLITVVMFGTTYLVWKLGAIHFNEF

[0063] The nucleotide sequence of the LEFT gene promoter is shown in SEQ ID NO:4

[0064] AACATGATCGAAGTGCGTTTTTTTTCCTTTCTTGTTCCCCCAGTAGGCTACTAGTACTATGATACTATCATGTGCTGATGTGCGACTGTCGTCTCTATCTCTCACTCTGAATTCTGAAAATGATCAGTTCCTTGTGTGTAAACAAGTGAGATGGTTGATTGGATTGGTGGAGCAAAACAGGTTGTGTATGGATATTCGTAAGTTCTTTTTCATTCTGCCATAGAATTCATAAAAGAATTCTGTGGACATGAGAGTTTCAGACTTTGAGCCGAACACGCTACTAATTGTCAGCTTGCCTGTTACGGAGTACATGTTACTTGTGCGTAATCGTACTTTAGTTGAAAGCTTGCTCCTCCAGCAGGCTGGCTTATGCAGGCTGCTGGCACACACATTTGGCCCGGCCCAAAGAGTTGTCGGGTCTAAGCATTCATCCCCAGGACCCGATTTGCGG

Claims

1. Application of rice gene LEFT in improving plant cold tolerance and yield, characterized in that: The amino acid sequence of the protein encoded by the rice gene LEFT is shown in SEQ ID NO: 3; The plant is rice.

2. A method for improving cold tolerance and yield of rice, characterized in that: The method comprises: 1) making rice contain the rice gene LEFT; or 2) Overexpression of the rice gene LEFT in rice; Wherein, the rice gene LEFT is the rice gene LEFT described in claim 1.

3. The method for improving cold tolerance and yield of rice according to claim 2, characterized in that: The methods include transgenic, hybridization, backcrossing, selfing or asexual reproduction.

4. The method for improving cold tolerance and yield of rice according to claim 2, characterized in that: The method comprises the steps of using Ti plasmid, plant virus vector, direct DNA transformation, microinjection, gene gun, electroporation, Agrobacterium-mediated method to introduce a recombinant expression vector containing rice gene LEFT into plant cells to obtain transgenic plants.

Images