An agricultural composition containing Bacillus velezinii and its application

Abstract

The present invention discloses an agricultural composition containing Bacillus Velez-like bacteria and its application, belonging to the technical field of pesticides. The agricultural composition of the present invention comprises Bacillus Velez-like bacteria, Bacillus amyloliquefaciens, and clove extract as active ingredients, wherein the mass ratio of Bacillus Velez-like bacteria, Bacillus amyloliquefaciens, and clove extract is 20-60:10-30:5-10. Indoor bioassay results show that the agricultural composition of the present invention has a significant inhibitory effect on the mycelial growth of Botrytis cinerea. Spraying the agricultural composition of the present invention on tomato plants can reduce the incidence of tomato gray mold, significantly increase the relative expression of the tomato disease resistance gene SlPR1, and enhance the resistance of tomatoes to whiteflies.

Description

Technical Field

[0001] The invention belongs to the technical field of pesticides and relates to an agricultural composition containing Bacillus velezensis and application thereof. Background Art

[0002] Tomato gray mold is a fungal disease that affects tomato cultivation, causing massive fruit rot and resulting in reduced yield and quality. Caused by the fungus Botrytis cinerea Pers., it primarily occurs during the flowering and fruiting stages, harming flowers, fruit, leaves, and stems, with green fruit being particularly severely affected.

[0003] The existing technology for the prevention and control of tomato gray mold mainly includes agricultural prevention and control and chemical prevention. Agricultural prevention and control reduces the occurrence of the disease by improving field management, such as increasing ventilation, reducing humidity, rational crop rotation and removing diseased and residual parts. However, agricultural prevention and control has problems such as difficulty in completely cutting off the source of infection, long cycle, high cost, and difficulty in environmental regulation. Chemical prevention and control includes the use of fungicides such as procymidone, fluopyram·trifloxystrobin, fenpropimorph, pyrimethanil, fludioxonil, and boscalid. However, the long-term application of chemical fungicides can easily lead to the development of drug resistance in gray mold pathogens, thereby reducing the prevention and control effect. Excessive use of chemical fungicides can also lead to pesticide residues and environmental pollution. Therefore, it is of great significance to develop a biopesticide that is easy to use, has a good prevention and control effect, and is environmentally friendly. Summary of the Invention

[0004] To address the above technical problems, the present invention provides an agricultural composition containing Bacillus Velez-like bacteria and its use. This agricultural composition comprises Bacillus Velez-like bacteria, Bacillus amyloliquefaciens, and clove extract in a mass ratio of 20-60:10-30:5-10. Within the mass ratio range provided by the present invention, this composition exhibits excellent inhibitory activity against Botrytis cinerea. Bioactivity assays demonstrate that this agricultural composition can increase the relative expression of disease-resistance genes in tomato plants and enhance resistance to whiteflies.

[0005] To achieve the technical purpose of the present invention, on the one hand, the present invention provides an agricultural composition containing Bacillus Velez subtilis, wherein the active ingredients of the agricultural composition are composed of Bacillus Velez subtilis, Bacillus amyloliquefaciens and clove extract, and the mass ratio of the active ingredients of Bacillus Velez subtilis, Bacillus amyloliquefaciens and clove extract is 20-60:10-30:5-10; preferably, the mass ratio of the active ingredients of Bacillus Velez subtilis, Bacillus amyloliquefaciens and clove extract is 20-60:10-30:7 or 40-50:15-20:5 or 40-50:15-20:10; further preferably, the mass ratio of the active ingredients of Bacillus Velez subtilis, Bacillus amyloliquefaciens and clove extract is 40:20:7.

[0006] Furthermore, the present invention has learned from the indoor toxicity test that the extracts of Bacillus velezensis, Bacillus amyloliquefaciens and cloves are used alone to inhibit the EC 50 The values ​​are 0.65g / L, 12.61g / L, and 2.37g / L, respectively. Compounding the three in a mass ratio of 20-60:10-30:5-10 can improve the inhibitory effect of the agricultural composition on Botrytis cinerea and have a synergistic effect. When the mass ratio of Bacillus Velez, Bacillus amyloliquefaciens and clove extract was in the range of 20-60:10-30:5-10, they had a good inhibitory effect on the mycelial growth of Botrytis cinerea, and the SR was greater than 1.5; when the mass ratio of Bacillus Velez, Bacillus amyloliquefaciens and clove extract was in the range of 20-60:10-30:7, 40-50:15-20:5 and 40-50:15-20:10, the synergistic effect was better, and the SR was greater than 2.0; when the mass ratio of Bacillus Velez, Bacillus amyloliquefaciens and clove extract was in the range of 40:20:7, the synergistic effect was optimal, with an SR of 3.61. When the mass ratio of Bacillus velezensis, Bacillus amyloliquefaciens and clove extract is in the range of 20-60:10-30:3, the three components exhibit an additive effect, indicating that when the ratio range provided by the present invention is exceeded, the agricultural composition has a poor inhibitory effect on Botrytis cinerea.

[0007] On the other hand, the present invention claims protection for the use of the agricultural composition containing Bacillus Velezii in inhibiting Botrytis cinerea.

[0008] In another aspect, the present invention claims use of the agricultural composition containing Bacillus velezensis for controlling tomato gray mold, the pathogen of which is Botrytis cinerea Pers. The agricultural composition increases the relative expression of a disease-resistant gene in tomato plants, the disease-resistant gene being S1PR1.

[0009] Furthermore, the present invention measured the relative expression levels of disease-resistant genes in tomato leaves after application of the agricultural composition and found that the relative expression level of the gene SlPR1 was extremely significantly increased after foliar spraying of the agricultural composition of the present invention, indicating that foliar spraying of the agricultural composition of the present invention can significantly enhance the expression of disease-resistant genes in tomato plants and significantly enhance the resistance of tomato plants to pathogens.

[0010] On the other hand, the present invention claims protection for the use of the agricultural composition containing Bacillus Velezii for improving the resistance of tomatoes to whiteflies.

[0011] Furthermore, the present invention found through selection experiments on the tomato pest Bemisia whitefly that Bemisia whitefly prefers to choose water-treated tomato plants. Compared with water-treated tomato leaves, the egg production and number of pupae of Bemisia whitefly in tomato leaves treated with the agricultural composition were significantly reduced. It can be seen that the agricultural composition of the present invention can significantly improve the insect resistance of plants.

[0012] In addition, the present invention claims protection for a method for preventing and controlling tomato gray mold, using the above-mentioned agricultural composition containing Bacillus Velez, the active ingredient content of the agricultural composition is 75 mg / L, the application method is foliar spraying, and the application amount is 3 mL / plant.

[0013] Furthermore, the present invention applied the above-mentioned agricultural composition to tomato plants and found that foliar spraying could significantly reduce the incidence of tomato gray mold. Soil mixing, root irrigation, and foliar spraying of 1-3 mL of the agricultural composition all reduced the area of ​​tomato leaves infected with gray mold. The experimental group that sprayed 3 mL of the agricultural composition foliarly significantly reduced the susceptible area of ​​plants infected with tomato gray mold, effectively preventing the occurrence of tomato gray mold. This shows that foliar spraying can effectively inhibit the colonization of tomato gray mold pathogen Botrytis cinerea on tomato leaves and reduce the incidence of tomato gray mold.

[0014] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages:

[0015] The agricultural composition containing Bacillus Velez subtilis of the present invention has the effect of inhibiting the growth of Botrytis cinerea hyphae, and also has a synergistic effect within the ratio range provided by the present invention. The present invention has shown through indoor toxicity tests that when the mass ratio of Bacillus Velez subtilis, Bacillus amyloliquefaciens, and clove extract is in the range of 20-60:10-30:5-10, it has a good inhibitory effect on the growth of Botrytis cinerea hyphae, with SR greater than 1.5. When the mass ratio of Bacillus Velez subtilis, Bacillus amyloliquefaciens, and clove extract is in the range of 20-60:10-30:7, 40-50:15-20:5, and 40-50:15-20:10, the synergistic effect is better, with SR greater than 2.0. When the mass ratio of Bacillus Velez subtilis, Bacillus amyloliquefaciens, and clove extract is in the range of 40:20:7, the synergistic effect is optimal, with an SR of 3.61. When the mass ratio of Bacillus velezensis, Bacillus amyloliquefaciens and clove extract is in the range of 20-60:10-30:3, the three components exhibit an additive effect, indicating that when the ratio range provided by the present invention is exceeded, the agricultural composition has a poor inhibitory effect on Botrytis cinerea.

[0016] Foliar spraying of the present invention's agricultural composition containing Bacillus velezensis can prevent and control tomato gray mold and increase the relative expression of disease-resistance genes in tomato plants. Foliar spraying of tomato plants with the agricultural composition revealed a significant increase in the relative expression of the SlPR1 gene, indicating that foliar spraying significantly enhances the expression of disease-resistance genes in tomato plants and their resistance to pathogens. Foliar spraying significantly reduced the incidence of gray mold in tomatoes. Soil mixing, root irrigation, and foliar spraying of 1-3 mL of the agricultural composition all reduced the area of ​​tomato leaves infected with gray mold. Foliar spraying of 3 mL of the agricultural composition significantly reduced the susceptible area of ​​plants infected with gray mold, effectively preventing the occurrence of gray mold. This indicates that foliar spraying effectively inhibits the colonization of the gray mold pathogen, Botrytis cinerea, on tomato leaves, reducing the incidence of gray mold.

[0017] The present invention's agricultural composition containing Bacillus Velezii can improve insect resistance in tomato plants. Selection experiments with the tomato pest Bemisia whitefly revealed that the whitefly preferred water-treated tomato plants. Compared to water-treated tomato leaves, the whitefly egg production and pupal population on tomato leaves treated with the agricultural composition were significantly reduced, demonstrating that the present invention's agricultural composition can significantly improve plant insect resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 Statistical graph of the area of ​​tomato leaves infected with gray mold under different agricultural composition application methods and application rates. Mock is a simulated control group; * indicates a significant difference.

[0019] Figure 2 These are pictures of tomato leaves infected with gray mold under different application methods and application rates of the agricultural compositions. Figure 2 A in the figure is a picture of tomato leaves infected with gray mold under different agricultural composition application methods; Figure 2 B in the figure is a picture of tomato leaves infected with gray mold under different spraying rates of the agricultural composition. Mock is a simulated control group.

[0020] Figure 3 The effect of foliar spraying of the agricultural composition on the relative expression of disease resistance genes in tomato leaves. Mock is the simulated control group; * indicates significant difference; ** indicates extremely significant difference.

[0021] Figure 4 Flowchart of experiment selection for Bemisia tabaci.

[0022] Figure 5 This is a statistical graph of the results of the Bemisia tabaci selection experiment. Mock is the simulated control group.

[0023] Figure 6This is a statistical chart showing the number of whitefly eggs / female adults and pupae. Figure 6 A in the figure is the statistical result of the number of whitefly eggs / female adults; Figure 6 B in the figure is the statistical result of the number of whitefly pupae; Figure 6 Figure C shows tomato leaves from the water-treated and agricultural composition-treated groups in the whitefly bioassay experiment. Mock is a simulated control group. DETAILED DESCRIPTION

[0024] The technical solutions of the present invention are described with reference to the following examples, but the present invention is not limited to the following examples. The experimental methods and detection methods described in each example are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0025] The deposit number of Bacillus velez is CGMCC No.14384.

[0026] The deposit number of Bacillus amyloliquefaciens is CGMCC No.11457.

[0027] Clove extract was purchased from Shaanxi Mufan Biotechnology Co., Ltd., with an active ingredient content of 99% and a specification content of 10:1. It is derived from the nearly mature fruit of the Myrtaceae plant clove (Clove), and the production process uses water extraction.

[0028] NA solid medium: peptone 10.0 g / L, beef extract powder 3.0 g / L, sodium chloride 5.0 g / L, agar 15.0 g / L, pH 7.2.

[0029] NB liquid culture medium: peptone 10.0 g / L, beef extract powder 3.0 g / L, sodium chloride 5.0 g / L, pH 7.2.

[0030] LB medium: tryptone 10 g / L, NaCl 5 g / L, yeast extract 5 g / L, agar 15.0 g / L, pH 7.2.

[0031] The difference between LB liquid medium and LB medium is that no agar is added.

[0032] PDA culture medium: potato extract powder 3.0 g / L, glucose 20.0 g / L, agar 15.0 g / L.

[0033] Example 1

[0034] This example provides an indoor toxicity test of an agricultural composition containing Bacillus Velez-Pinelli et al. against the pathogen of tomato gray mold.

[0035] Preparation of Bacillus Velezii powder: Bacillus Velezii with the deposit number CGMCC No. 14384 was activated on NA solid medium for 24 h, and a single colony was picked and inoculated into NB liquid medium. The culture was carried out on a shaker at 28°C and 180 rpm until the bacterial suspension concentration was 1×10 9 cfu / mL, stop the fermentation, centrifuge at 4000 r / min for 15 min, discard the supernatant, wash the precipitate with sterile water and resuspend it, centrifuge at 4000 r / min for 15 min, repeat the above washing and centrifugation operations three times, and spray dry to prepare the bacterial powder of Bacillus Velezii.

[0036] Preparation of Bacillus amyloliquefaciens powder: Bacillus amyloliquefaciens with the deposit number CGMCC No. 11457 was activated on LB medium for 24 h, and a single colony was picked and inoculated into LB liquid medium. The culture was carried out on a shaker at 28°C and 180 rpm until the bacterial suspension concentration was 5 × 10 8 cfu / mL, stop the fermentation, centrifuge at 4000 r / min for 15 min, discard the supernatant, wash the precipitate with sterile water and resuspend it, centrifuge at 4000 r / min for 15 min, repeat the above washing and centrifugation operations three times, and spray dry to prepare Bacillus amyloliquefaciens powder.

[0037] Preparation of Botrytis cinerea bacteria: Botrytis cinerea B79 (collected from the leaves of diseased tomato plants in the field) was activated on PDA medium for 5-6 days. A small amount of activated Botrytis cinerea was taken and diluted to 1×10 8 cfu / mL, and prepare a spore suspension. Spread 100 μL of the spore suspension on PDA medium and streak culture at 25°C for 5-6 days. Use a sterile punch to punch the cultured Botrytis cinerea into 5 mm diameter blocks for later use.

[0038] The Bacillus velezensis bacterial solution, Bacillus amyloliquefaciens bacterial solution and clove extract were dissolved in water to prepare single-dose mother solutions, which were compounded according to the mass ratio shown in Table 1 to obtain a mixed mother solution. Five mass concentration gradients were set for each single dose and the mixed dose according to the equal ratio method.

[0039] The mycelial growth rate method was used to determine the toxicity of each single agent and mixture against Botrytis cinerea. The Wadley method was used to evaluate the synergistic effect of the combination. Botrytis cinerea clumps were aseptically inoculated with the mycelial side facing down onto the center of a solidified culture dish (R = 9 cm) containing PDA medium (9 mL) and a solution (1 mL) of the agent (single agent or mixture). A blank control was used without the agent. Each group was repeated three times. The inoculated culture dish was placed at a temperature of 25 ± 1 ° C, a relative humidity of 80%, and a 12-hour light-dark cycle (light intensity of 6000 Lux). When the colony diameter of the control group grew to more than 2 / 3 of the diameter of the culture dish, the colony diameter of each treatment was measured using the cross-hatch method, and the mycelial growth inhibition rate of the different treatments was calculated. The experimental data were analyzed using the logarithm of the agent concentration as the horizontal axis and the mycelial growth inhibition rate as the vertical axis. The effective inhibitory concentration (EC) of each treatment was calculated. 50 ), and the expected effective inhibitory concentration (EC 50exp ) and the synergistic coefficient (SR), the calculation formula is as follows, and the calculation results are shown in Table 1.

[0040] Mycelial growth inhibition rate (%) = [(colony diameter of control group - colony diameter of treated group) / (colony diameter of control group - diameter of fungus cake)] × 100;

[0041] EC 50exp =(a+b+c) / [(a / EC 50a )+(b / EC 50b )+(c / EC 50c )];

[0042] SR=EC 50exp / EC 50实际 ;

[0043] In the formula, a is the percentage of the content of the Bacillus velezensis liquid in the agricultural composition, b is the percentage of the content of the Bacillus amyloliquefaciens liquid in the agricultural composition, c is the percentage of the content of the clove extract in the agricultural composition, EC 50a EC is the effective inhibitory concentration of Bacillus velezensis solution (a) when used alone. 50b EC is the effective inhibitory concentration of Bacillus amyloliquefaciens solution (b) when used alone. 50c The effective inhibitory concentration of clove extract when used alone. SR ≥ 1.5 indicates synergistic effect, SR ≤ 0.5 indicates antagonistic effect, and 0.5 < SR < 1.5 indicates additive effect.

[0044] Table 1: Inhibitory effect of the agricultural composition on the mycelial growth of Botrytis cinerea

[0045]

[0046]

[0047] As shown in Table 1, the EC values ​​of Bacillus velezensis, Bacillus amyloliquefaciens and clove extracts used alone against Botrytis cinerea 50 The values ​​are 0.65g / L, 12.61g / L, and 2.37g / L, respectively. Compounding the three in a mass ratio of 20-60:10-30:5-10 can improve the inhibitory effect of the agricultural composition on Botrytis cinerea and have a synergistic effect. When the mass ratio of Bacillus Velez, Bacillus amyloliquefaciens and clove extract was in the range of 20-60:10-30:5-10, they had a good inhibitory effect on the mycelial growth of Botrytis cinerea, and the SR was greater than 1.5; when the mass ratio of Bacillus Velez, Bacillus amyloliquefaciens and clove extract was in the range of 20-60:10-30:7, 40-50:15-20:5 and 40-50:15-20:10, the synergistic effect was better, and the SR was greater than 2.0; when the mass ratio of Bacillus Velez, Bacillus amyloliquefaciens and clove extract was in the range of 40:20:7, the synergistic effect was optimal, with an SR of 3.61. When the mass ratio of Bacillus velezensis, Bacillus amyloliquefaciens and clove extract is in the range of 20-60:10-30:3, the three components exhibit an additive effect, indicating that when the ratio range provided by the present invention is exceeded, the agricultural composition has a poor inhibitory effect on Botrytis cinerea.

[0048] Example 2

[0049] This example provides the control effects of different application methods of the agricultural composition on tomato gray mold.

[0050] 1. The control effect of different application methods on tomato gray mold

[0051] The agricultural composition (Bacillus velezensis, Bacillus amyloliquefaciens and clove extract in a mass ratio of 40:20:7) was diluted to a concentration of 75 mg / L by mixing with soil, irrigating roots and spraying on leaves. The mixture was then inoculated into adult tomato plants (Pink Crown tomato variety) with an inoculum volume of 1 to 3 mL per plant and colonized for three days. Spores of Botrytis cinerea B79 grown on PDA medium were scraped and prepared with water to a concentration of 4.9×10 8 cfu / mL suspension, 5 μL was taken and inoculated into the leaves of tomato plants after application of the agricultural composition. The disease incidence of the leaves was counted two days later. The mock group was treated with clean water. The statistical results are shown in the figure. Figures 1 and 2 shown.

[0052] Depend on Figure 1 and Figure 2It can be seen that applying 1-3 mL of the agricultural composition to the soil, irrigating the roots, or spraying it on the leaves can all reduce the area of ​​tomato leaves infected with gray mold. The group spraying 3 mL of the agricultural composition on the leaves significantly reduced the area of ​​tomato plants infected with gray mold, effectively controlling tomato gray mold. This shows that foliar spraying can effectively inhibit the colonization of the tomato gray mold pathogen, Botrytis cinerea, on tomato leaves and reduce the incidence of gray mold.

[0053] 2. Detection of relative expression levels of tomato disease resistance genes

[0054] The tomato leaves sprayed with 3 mL of the agricultural composition were taken for quantitative PCR detection. 0.5 g of tomato leaves were placed in a 1.5 mL centrifuge tube, quickly frozen in liquid nitrogen, and stored at -80 ° C for later use. qRT-PCR was performed using a fluorescent quantitative PCR instrument, with SlActin as the internal reference gene and specific primers for the gene SlPR1 for real-time quantitative PCR. The reaction conditions were: pre-denaturation at 95 ° C for 2 min; denaturation at 94 ° C for 30 s, annealing at 60 ° C for 15 s, extension at 72 ° C for 15 s, and 40 cycles. Each treatment group was repeated 3 times, and the Ct value of each repeat and its average and standard deviation were generated by the quantitative PCR instrument by manually adjusting the baseline. The Ct value was averaged and 2 -△△CT Methods The relative expression of gene S1PR1 was calculated ( Figure 3 ).

[0055] SlPR1-forward primer: CCCAGAACTCTCCACAGGAC;

[0056] SlPR1-reverse primer: GCAGCTACAGTGTCGTTCCA;

[0057] SlActin-forward primer: TCCGTTCTCAGAGATCAACAA;

[0058] SlActin-reverse primer: ACTCTCTCATCTCAAGATATTCTATGG.

[0059] Depend on Figure 3 It can be seen that the relative expression level of the gene SlPR1 is extremely significantly increased after foliar spraying of the agricultural composition of the present invention, indicating that foliar spraying of the agricultural composition of the present invention can significantly enhance the expression of disease-resistant genes in tomato plants and significantly enhance the resistance of tomato plants to pathogens.

[0060] Example 3

[0061] This example provides the control effect of foliar spraying of the agricultural composition on Bemisia tabaci.

[0062] The mock group was sprayed with 3 mL of water, and the drug group was sprayed with 3 mL of agricultural composition (Bacillus velezensis, Bacillus amyloliquefaciens and clove extract in a mass ratio of 40:20:7) on the leaves. The selection experiment of tomato pest Bemisia tabaci (obtained from field sampling) was conducted on the two test groups respectively. The experimental process is as follows: Figure 4 As shown in the figure, the selection of whiteflies on the plants of the two experimental groups was statistically analyzed ( Figure 5 ) and found that whiteflies preferred to choose tomato plants treated with water. The capture rate of whiteflies on tomato plants in the water-treated group was 68%, while the capture rate on tomato plants in the agricultural composition-treated group was 31%. At the same time, the number of whiteflies eggs / female insects and the number of pupae on the plants of the two experimental groups were counted ( Figure 6 ), it was found that compared with tomato leaves treated with water, the egg production and pupae number of whitefly in tomato leaves treated with the agricultural composition were significantly reduced, indicating that the agricultural composition of the present invention can significantly improve the insect resistance of plants.

[0063] The embodiments described above are some of the embodiments of the present invention, rather than all of them. The detailed description of the embodiments of the present invention is not intended to limit the scope of the invention as claimed, but rather merely represents selected embodiments of the present invention. All other embodiments obtained without creative effort and through deduction and substitution by a person of ordinary skill in the art based on the concept of the present invention are within the scope of protection of the present invention.

Claims

1. An agricultural composition containing Bacillus Velezii, characterized in that The active ingredients of the agricultural composition are composed of Bacillus Velez, Bacillus amyloliquefaciens and clove extract, and the mass ratio of Bacillus Velez, Bacillus amyloliquefaciens and clove extract is 20-60:10-30:5-10; The deposit number of the Bacillus Velez is CGMCC No.14384; The deposit number of the Bacillus amyloliquefaciens is CGMCC No.11457; The production process of the clove extract adopts water extraction.

2. The agricultural composition containing Bacillus Velezii according to claim 1, wherein The mass ratio of Bacillus Velez, Bacillus amyloliquefaciens and clove extract in the agricultural composition is 20-60:10-30:7 or 40-50:15-20:5 or 40-50:15-20:

10.

3. The agricultural composition containing Bacillus Velezii according to claim 2, characterized in that The mass ratio of Bacillus Velez subtilis, Bacillus amyloliquefaciens and clove extract in the agricultural composition is 40:20:

7.

4. Use of the agricultural composition containing Bacillus Velezii according to any one of claims 1 to 3 in inhibiting Botrytis cinerea.

5. Use of the agricultural composition containing Bacillus Velezii according to any one of claims 1 to 3 in preventing and treating tomato gray mold, characterized in that: The pathogen of tomato gray mold is Botrytis cinerea Botrytis cinerea Pers. .

6. The use according to claim 5, characterized in that The agricultural composition increases the relative expression level of disease-resistant genes in tomato plants.

7. The use according to claim 6, characterized in that The tomato plant disease resistance gene is a gene SlPR1 .

8. Use of the agricultural composition containing Bacillus Velezii according to any one of claims 1 to 3 for improving insect resistance of plants, characterized in that: The plant is tomato; the insect resistance is the effect of resisting Bemisia tabaci.

9. A method for preventing and controlling tomato gray mold, characterized in that: Use of the agricultural composition containing Bacillus Velezii according to any one of claims 1 to 3; The active ingredient content of the agricultural composition is 75 mg / L.

10. The method for preventing and controlling tomato gray mold according to claim 9, characterized in that: The agricultural composition is applied by foliar spraying.

Images