Unsaturated alkenal compound with anti-inflammatory and expectorant activity, and preparation method and application thereof
The unsaturated enaldehyde compound TRX, produced by fermentation from the endophytic fungus strain GIZ45-A37 in the intestine of the bat moth, solves the problems of inflammation and hypersecretion of mucus in COPD, achieving significant anti-inflammatory and expectorant effects, and is suitable for the preparation of anti-inflammatory and expectorant drugs.
Patent Information
- Application Number
- CN202411120588.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-15
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2044-08-15
AI Technical Summary
Existing technologies are insufficient to effectively suppress inflammation and mucus hypersecretion in chronic obstructive pulmonary disease (COPD), leading to airway obstruction and exacerbation of inflammation. There is a lack of safe and effective anti-inflammatory and expectorant agents.
An unsaturated enaldehyde compound was produced by fermentation from the endophytic fungus strain GIZ45-A37 in the gut of the bat moth. The compound TRX, which has significant anti-inflammatory and expectorant activities, was prepared by extraction with ethyl acetate, silica gel column chromatography, reversed-phase ODS column chromatography, gel column chromatography, and high-performance liquid chromatography.
The compound TRX exhibits significant anti-inflammatory and expectorant activities, effectively inhibiting IL-6 expression and MUC5AC secretion, reducing mucus accumulation, and alleviating the inflammatory response of COPD. It also has low cytotoxicity, making it suitable for the preparation of anti-inflammatory and expectorant drugs.
Smart Images

Figure CN119019355B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the technical field of natural products, and particularly relates to a strain of endophytic fungus in the gut of bats and a compound with anti-inflammatory and expectorant activity produced by fermentation of the strain. BACKGROUND
[0002] Chronic obstructive pulmonary disease (COPD) is a chronic airway inflammatory disease characterized by airflow limitation, with progressive decline in lung function, which seriously affects the labor capacity and quality of life of patients. It is a heterogeneous and systemic disease that continues to worsen and is not completely reversible in modern society. It is the third leading cause of death worldwide and has risen to the fifth position in the world disease economic burden. COPD is mainly related to non-specific chronic inflammatory reactions of the bronchial wall mucosa, blood vessels, and alveoli caused by long-term exposure of patients to harmful gases such as chemical particles or cigarette smoke. One of the important pathological features of COPD is high mucus secretion. Under normal circumstances, appropriate mucus secretion has a protective effect on the airway, but under pathological conditions, there are often abnormalities in the amount or quality of mucus. Excessive mucus accumulation can exacerbate local respiratory tract inflammation and infection. Mucin 5AC (5AC) is the main protein component of airway mucus, and the massive secretion of MUC5AC is the main cause of high mucus secretion. COPD also has a high mortality rate in China, especially during the acute exacerbation of COPD (AECOPD). Patients have severe inflammatory reactions in the respiratory tract, causing irreversible obstruction of the respiratory tract, further exacerbation of respiratory muscle fatigue, and often progression to type II respiratory failure, further increasing the mortality rate and making clinical treatment more difficult. Inhibiting the occurrence and development of inflammation and mucin is an effective means to alleviate and treat chronic diseases such as COPD. Therefore, it is necessary to develop safe and efficient anti-inflammatory and expectorant preparations.
[0003] Fungi are one of the important sources of structurally novel and uniquely active compounds. The applicant previously isolated a new macrolide compound with significant anti-inflammatory activity from the metabolites of endophytic fungus GIZ45-A37 in the gut of bats. The applicant further studied the metabolites of endophytic fungus GIZ45-A37 (preservation number: GDMCC No. 64050) in the gut of bats and found a new unsaturated alkenal compound with significant anti-inflammatory and expectorant activity. SUMMARY
[0004] The purpose of the present application is to provide a new compound-unsaturated alkenal compound with significant anti-inflammatory and expectorant activity obtained by fermentation from Talaromyces rugulosus GIZ45-A37 strain.
[0005] The present application provides an unsaturated alkenal compound represented by Formula I, or a pharmaceutically acceptable salt thereof, or a solvate thereof:
[0006]
[0007] wherein R1, R2, R3, R4, R5 are independently selected from methyl or hydroxyl.
[0008] Further, the aforementioned R1 is methyl.
[0009] Further, the aforementioned R2 is methyl.
[0010] Further, the aforementioned R3 is methyl.
[0011] Further, the aforementioned R4 is hydroxyl.
[0012] Further, the aforementioned R5 is methyl.
[0013] Further, the structure of the aforementioned compound is as follows:
[0014]
[0015] The present application also provides a preparation method of the aforementioned compound, which is isolated from a fermentation culture of Talaromyces rugulosus GIZ45-A37.
[0016] Specifically comprising the following steps:
[0017] S1, inoculating Talaromyces rugulosus GIZ45-A37 into a fermentation culture medium to obtain a fermentation product;
[0018] S2, adding ethyl acetate into the fermentation product obtained in S1, mixing and extracting to obtain an extraction liquid;
[0019] S3, concentrating the extraction liquid obtained in S2 under reduced pressure to obtain a crude extract;
[0020] S4, performing silica gel column chromatography on the crude extract obtained in S3, using an eluent composed of petroleum ether and ethyl acetate, and performing gradient elution according to the volume ratio of petroleum ether to ethyl acetate in the order of 50:1, 25:1, 10:1, 5:1, 2:1 and 1:1, collecting the eluent with a volume ratio of petroleum ether to ethyl acetate of 5:1, and drying to obtain a crude product;
[0021] S5, performing reverse phase ODS column chromatography on the crude product obtained in S4, using an eluent composed of methanol and water, and performing gradient elution according to the methanol concentration in the order of 20%, 40%, 60% and 80%, collecting the eluent with 40% to 60% methanol / water, and drying to obtain a crude product;
[0022] S6, the crude product obtained in S5 is subjected to gel Sephadex LH-20 column chromatography, eluted with dichloromethane-methanol v / v 2:1 as the eluent, and the eluate is collected and detected by high performance liquid chromatography; the detection is performed with a C18 chromatographic column, 60% methanol / water, and 254 nm wavelength as the chromatographic conditions; the eluate containing the main peak is collected and dried to obtain a crude product;
[0023] S7, the crude product obtained in S6 is subjected to high-pressure preparation liquid chromatography to obtain the product.
[0024] Further, the fermentation medium in step S1 is composed of the following components by weight: 90-100 g of rice and 100 ml of water, which is sterilized by high-pressure steam at 120°C for 20 min.
[0025] Further, the culture in step S1 is placed at a constant temperature of 25°C for static culture for 30 days.
[0026] Further, in step S2, the ethyl acetate is added to the fermentation product obtained in S1, and the mass / volume ratio of the fermentation product to ethyl acetate is 1:3; the extraction is ultrasonic extraction for 15 min, and the extraction is performed for 3 times; the power used for ultrasonic extraction is 400 W, and the working frequency is 40 KHz.
[0027] Further, in step S7, the high-pressure preparation liquid chromatography is performed with a mobile phase of a mixed solution of acetonitrile and water, wherein the volume percentage of acetonitrile is 70%.
[0028] The application also provides the use of the above-mentioned compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof in the preparation of an anti-inflammatory and expectorant drug; preferably, the drug is a drug for preventing and treating chronic obstructive pulmonary disease (COPD).
[0029] The application also provides a drug, which is a preparation prepared from the above-mentioned compound, or a pharmaceutically acceptable salt thereof, or a solvate thereof as an active ingredient, and a pharmaceutically acceptable excipient or auxiliary ingredient.
[0030] The application has the following beneficial effects:
[0031] (1) The strain of the endophytic fungus of the bat gut in the application can ferment to produce a new compound, which has stable performance, low cytotoxicity, and significant anti-inflammatory and expectorant activity.
[0032] (2) The compound in the application is produced by solid fermentation of fungi, and can be prepared by ethyl acetate extraction of the fermentation product, followed by silica gel column chromatography, reverse phase ODS column chromatography, gel column chromatography, and high performance liquid chromatography separation and purification; the separation steps are simple, easy to implement, and easy to mass produce industrially, and have broad application prospects.
[0033] Biological material preservation:
[0034] Talamyces rugulosus GIZ45-A37 was deposited on November 22, 2023, at the Guangdong Provincial Microbial Culture Collection Center (GDMCC), located at 5th Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province, 510070, China, with accession number GDMCC No. 64050.
[0035] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions, or alterations can be made without departing from the basic technical concept of the present invention.
[0036] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description
[0037] Figure 1 The high-resolution mass spectra of the compounds having the structure of Formula I of this invention are shown.
[0038] Figure 2 The compounds of this invention having the structure of Formula I 1 H NMR spectrum.
[0039] Figure 3 The compounds of this invention having the structure of Formula I 13 C NMR spectrum.
[0040] Figure 4 The compounds of this invention having the structure of Formula I 1 H- 1 H COSY spectrum.
[0041] Figure 5 The HSQC spectrum of the compound having the structure of Formula I in this invention is shown.
[0042] Figure 6 The HMBC spectrum of the compound having the structure of Formula I in this invention is shown.
[0043] Figure 7 The NOESY spectrum of the compound having the structure of Formula I in this invention is shown.
[0044] Figure 8 The growth rate of cells at different concentrations of the compound having the structure of Formula I of this invention is shown.
[0045] Figure 9The results of the cell IL-6 secretion inhibition assay for the compound having the structure of formula I of the present application.
[0046] Figure 10 The results of the cell MUC5AC secretion inhibition assay for the compound having the structure of formula I of the present application. DETAILED DESCRIPTION
[0047] The raw materials and equipment used in the present application are known products, which are obtained by purchasing commercially available products.
[0048] Example 1, Preparation of the compound of the present application
[0049] I. Fermentation of the strain
[0050] 1. The strain Talaromyces rugulosus GIZ45-A37 was inoculated into a PDA culture medium plate and cultured at 28°C in the dark for 7 days to obtain a plate seed.
[0051] 2. The seed obtained in step 1 was transferred to a liquid seed culture medium and cultured at 28°C, 150 rpm in the dark for 4 days to obtain a seed culture solution.
[0052] The seed culture medium: the solvent is potato juice (preparation method of potato juice: 200 g of potato, add water about 1 L, boil for 30 min, filter, and supplement the filtrate to 1 L), and the solutes and their contents are as follows: glucose 20 g / L, agar 20 g, sterilize for standby use.
[0053] 3. About 10 mL of the seed culture solution was inoculated into a flask containing a fermentation culture medium and incubated at 25°C for 30 days.
[0054] 4. Preparation method of the fermentation culture medium: take 100 g of rice, add water 100 ml, put into a 500 mL flask, high pressure sterilization (120°C, 20 min).
[0055] II. Extraction, separation and purification of the compound of the present application
[0056] 1. 300 ml of ethyl acetate was added to the fermented flask, and ultrasonic extraction was carried out at 30°C for 15 min, 3 times, the ultrasonic power was 400 W, and the working frequency was 40 KHz. The extract was filtered, and all the extract was combined and concentrated under reduced pressure at 40°C to obtain the total extract.
[0057] 2. The total extract was dissolved with ethyl acetate, mixed with silica gel in a ratio of 1:1 by mass, and dried, then loaded onto a column and subjected to silica gel column chromatography (filler: 200-300 mesh silica gel powder), eluted with a petroleum ether / ethyl acetate mixture (v / v: 50:1, 25:1, 10:1, 5:1, 2:1, 1:1, 0:100), and the eluate with a volume ratio of petroleum ether to ethyl acetate of 5:1 was collected, then rotary evaporated to obtain crude product A.
[0058] 3. Crude product A was further subjected to reverse phase column chromatography (filler: ODS C-18 column chromatography silica gel, gradient elution, eluent: methanol / water mixture, eluted with 20%, 40%, 60%, and 80% methanol / water in turn, 2 column volumes of solvent for each, the 40%-60% methanol / water eluate was collected, concentrated and dried under reduced pressure to obtain crude product A-1.
[0059] 4. Crude product A-1 was further separated by gel Sephadex LH-20 column chromatography, eluted with dichloromethane-methanol (v / v 2:1) as eluent, and the eluate was collected and detected by high performance liquid chromatography, using a C18 column (4.6x100mm, 2.7μM), 60% methanol / water by volume, a flow rate of 0.5ml / min, and a wavelength of 254nm as the chromatographic conditions, the eluate containing the main peak (retention time 7.15min) was collected and dried to obtain crude product A-2; and prepared by medium-high pressure preparative liquid chromatography (C18 column: 10x250mm, 5μM; flow rate: 1ml / min, mobile phase: 70% acetonitrile / water, v / v; wavelength: 254nm; Rt=21.5min) to obtain a white powder:
[0060] 5. Figure 1 High resolution mass spectrum of the compound of the present application having the structure of Formula I. Figure 2 HNMR spectrum of the compound of the present application having the structure of Formula I. 1 HNMR spectrum of the compound of the present application having the structure of Formula I. Figure 3 HNMR spectrum of the compound of the present application having the structure of Formula I. 13 HNMR spectrum of the compound of the present application having the structure of Formula I. Figure 4 HNMR spectrum of the compound of the present application having the structure of Formula I. 1 HNMR spectrum of the compound of the present application having the structure of Formula I. 1 HNMR spectrum of the compound of the present application having the structure of Formula I. Figure 5 HNMR spectrum of the compound of the present application having the structure of Formula I. Figure 6 HNMR spectrum of the compound of the present application having the structure of Formula I. Figure 7 HNMR spectrum of the compound of the present application having the structure of Formula I.
[0061] The compound of the present application is white solid powder, easily soluble in chloroform, methanol and DMSO, HR-ESI-MS: m / z 235.13399 [M-H] - (As Figure 1 ), 1 H NMR (600 MHz, CDCl3) spectrum shows δ H : 9.62 (1H, d, J = 7.8 Hz), which is likely to be aldehyde hydrogen signal, δ H : 7.41 (1H, dd, J1= 15.0 Hz, J2= 15.0 Hz), 6.20 (1H, dd, J1= 15.0 Hz, J2= 7.8 Hz), 6.40 (1H, d, J = 11.4 Hz), which is deduced from the shift and coupling constant that three hydrogen atoms are trans double bond hydrogen atoms and are in adjacent positions, 5.73 (1H, s) which is also likely to be double bond hydrogen atom, other hydrogen atom signals are distributed in δ H : 4.60 (1H, s), 3.50 (2H, m), 1.87 (3H, d, J = 1.2 Hz), 1.51 (3H, s), 1.24 (3H, m), 1.17 (3H, s). 13 C NMR (150 MHz, CDCl3) spectrum shows 14 carbon atom signals, of which δ C : 147.8, 146.9, 135.2, 132.4, 131.3 and 128.0 are six carbon atom signals of double bond carbon atoms, δ C : 194.0 is aldehyde carbon atom signal. DEPT spectrum can deduce that the compound has 3 quaternary carbons (C), 7 tertiary carbons (CH), 4 primary carbons (CH3). 1 H- 1 H COSY spectrum shows that δ H : 9.62 and 6.20, δ H : 7.41 and 6.20, 6.40, δ H : 3.50 and 1.24 respectively exist correlation signals, indicating that the hydrogen atoms are in adjacent positions. In HSQC spectrum, δ H : 6.40 and δ C : 128.0, δ H : 5.73 and δ C : 131.3, δ H : 4.60 and δ C : 84.7, δ H : 3.50 and δ C : 77.2, δ H : 1.87 and δ C : 14.1, δ H : 1.51 and δ C : 18.4, δ H1.24 and δ C :12.9, δ H :1.19 and δ C :23.6, respectively, can be attributed to carbon and corresponding hydrogen atoms. HMBC spectrum shows long-range coupling of hydrogen atoms with carbon atoms, such as δ H :9.62 and δ C :132.4 with long-range coupling signals. Based on the above information from various spectra, the structure of the compound is identified.
[0062] 6. NMR characterization data are as follows:
[0063] 1 H NMR (600MHz, CDCl3) δ H :1.17 (3H, s), 1.23 (3H, d, J = 6.0 Hz), 1.51 (3H, s), 1.87 (3H, d, J = 1.2 Hz), 3.50 (1H, q, J = 6.0 Hz), 4.46 (1H, s), 5.73 (1H, s), 6.19 (1H, dd, J1= 7.8 Hz, J2= 15.0 Hz), 6.39 (1H, d, J = 11.4 Hz), 7.41 (1H, dd, J1= 11.4 Hz, J2= 15.0 Hz), 9.62 (1H, d, J = 7.8 Hz), see Figure 2 .
[0064] 13 C NMR (150MHz, CDCl3) δ C :12.7 (q), 14.1 (q), 18.4 (q), 23.6 (q), 67.1 (s), 77.3 (d), 84.7 (d), 128.0 (d), 131.3 (d), 132.4 (d), 135.2 (s), 146.9 (d), 147.8 (s), 194.0 (d), see Figure 3 .
[0065] The structure of the compound is identified, and the molecular formula of the compound is C 14 H 20 O3, and the structure is as follows:
[0066]
[0067] The compound is named as TRX.
[0068] The following experimental examples demonstrate the beneficial effects of the compounds of the present application.
[0069] Example 2, Identification of Talaromyces rugulosus strain of the endophytic fungus of the bat moth in the present application
[0070] The Talaromyces rugulosus GIZ45-A37 of the present application is isolated from the gut of a moth. It is identified by Guangdong Microbial Institute and is preserved in a refrigerator at 4°C on PDA slant medium.
[0071] According to the DNA sequence of internal transcribed spacer (ITS), the fungal strain is identified as Talaromyces rugulosus through NCBI BLAST analysis. The following sequence is used in the BLAST search.
[0072] SEQ ID NO. 1:
[0073] CGTTGTGACTGCGGAGGTCATTACCGAGTGCGGGTTCCAACGAGCCCAACCTCCCACCCGTGTTTACCATGACCGCGTTGCCTCGGCGGGCCCACTGGGGCCTGGCCCCGGTCGCCGGGGGGCTTCTGCCCCCGGGTCCGCGCCCGCCGAAGCGCCCTGGAACCCTGTCTGAATAGTGAGTCTGAGTCTATGATTAAATCATTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCCAGCCCGGCTGGGTGTTGGGTGTTGTCCCCCCGGGGACACGCCCCAAAGGCAGTGGCGGCGCCGCGTCGGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCGGGACGGACTCGTCGGCGCTGGTCTTCCTCCAGGCGACCCTTCGGGGCCCGTCTACCTTCGGTTGACCTCGGATCAGGTAGGGTTACCCGCTGAACTTAAGCATATCAATAAGCGGAGAGAA
[0074] The strain is named: Talaromyces rugulosus GIZ45-A37, which was preserved in Guangdong Microbial Culture Collection Center (GDMCC) on November 22, 2023, the address of the preservation center is No. 59, Building 5, 100, Xianlie Middle Road, Yuexiu District, Guangzhou, Guangdong Province, China, Postcode: 510070, and the preservation number is GDMCC No. 64050. The strain is disclosed in CN202311729129.1, a Chinese patent application with the title of "A macrolide compound with anti-inflammatory activity and its preparation method and application".
[0075] Example 3: Anti-inflammatory activity experiment of the compound of the present application
[0076] Interleukin-6 (IL-6) is an important inflammatory factor, and increased expression of IL-6 promotes the development of inflammation. Therefore, IL-6 can be used as an index substance for the development of inflammation, and it may also be a potential target for COPD treatment (Winslow S, Odqvist L, Diver S, et al. Multi-omics links IL-6 trans-signalling with neutrophil extracellular trap formation and Haemophilus infection in COPD [J]. Eur Respir J. 2021, 58(4): 1-14.). In the present application, the compound prepared in Example 1 (hereinafter referred to as TRX) is used to act on lipopolysaccharide (LPS)-induced human bronchial epithelial cells Beas2b, and the anti-inflammatory activity of TRX is evaluated by detecting the content of IL-6 produced in the cell culture supernatant.
[0077] 1. Reagents and instruments
[0078] Human bronchial epithelial cells Beas-2b; lipopolysaccharide (LPS); DMEM high-sugar culture medium; fetal bovine serum (FBS); phosphate buffer (PBS); dimethyl sulfoxide (DMSO); 1% P / S double antibody; enzyme-linked immunoassay kit (Elisa kit); precision electronic balance; biological safety cabinet; carbon dioxide incubator; inverted microscope; low-speed refrigerated centrifuge; microplate reader; digital constant temperature water bath.
[0079] 2. Culture of Beas-2b cells
[0080] The basic culture medium is DMEM culture solution + 10% FBS + 1% P / S double antibody; the culture conditions are 37℃, 5% CO2 and saturated humidity; and the cells can be used for experiments after being cultured for 2-3 days to reach a cell density of 90%.
[0081] 3. Cell viability assay
[0082] Beas-2b cells in the logarithmic growth phase were used to prepare 2×10⁻⁶ cells. 5 Single-cell suspensions of 100 μl / well were seeded into 96-well plates (3 replicates per group). After cell attachment, the cells were cultured until approximately 80% confluence. The original culture medium was discarded. The control group was treated with normal culture medium (1 μl of the compound solvent and 99 μl of DEME medium), while the TRX group was treated with culture medium containing different concentrations of the compound (1 μl of TRX compound solution and 99 μl of DEME medium; final TRX concentrations were 100 μM, 50 μM, 25 μM, 12.5 μM, and 6.25 μM). The cells were cultured for another 24 h, and cell growth and changes in the culture medium were observed under an inverted microscope. After culture, 10 μl of CCK-8 working solution was added to each well, and the cells were incubated at 37°C for 2 h. Cells were then detected at 450 nm.
[0083] Cell inhibition rate = 1 - (drug-treated wells - background value) / (control wells - background value) × 100%
[0084] Experimental results are as follows Figure 8 As shown, TRX had no significant inhibitory effect on Beas2b cells within the concentration range of 6.25 μM to 100 μM, indicating that TRX is safe within this range and has very low cytotoxicity.
[0085] 4. Determination of the anti-inflammatory activity of compound TRX
[0086] Beas-2b cells in logarithmic growth phase were harvested, and the cell density was adjusted to 2 × 10⁻⁶ cells using cell counting. 6 Cells were seeded at a rate of 500 μl / well in 48-well plates. After cell attachment, the cells were cultured until confluence reached approximately 80%. The culture medium was then discarded. Control, model, and TRX groups were established. The control group received no LPS or TRX. The model group received LPS solution (final LPS concentration 1 μg / ml) in the culture medium. The TRX group received fresh DMEM medium containing LPS (final LPS concentration 1 μg / ml) and TRX solution (final TRX concentrations of 10 μM and 20 μM). The cells were cultured for another 24 h. After culture, the supernatant from each well was collected into a 1.5 ml centrifuge tube and centrifuged at 6000 rpm for 5 min. The supernatant was then transferred to another 1.5 ml centrifuge tube and stored at -20°C for ELISA detection. IL-6 levels were measured according to the ELISA kit instructions.
[0087] Experimental data are expressed as mean ± standard deviation (x ± s). One-way ANOVA was performed using SPSS 22.0 statistical software to analyze significant differences between groups. Comparisons between the model group and the control group were also performed. # p<0.05, ##p<0.01 means significant difference, statistically significant; sample group compared with model group * p<0.05, ** p<0.01 means significant difference, statistically significant.
[0088] As Figure 9 shown, the IL-6 content of the model group has a significant difference from the control group, indicating that the modeling is successful, and the IL-6 content of the TRX group is significantly lower than that of the model group, indicating that TRX has an inhibitory activity on the expression of IL-6, thereby playing an anti-inflammatory role.
[0089] Example 4: Experiment of expectorant activity of the compound of the present application
[0090] One of the important pathological features of chronic inflammatory diseases of the airway is high mucus secretion. Under normal circumstances, appropriate mucus secretion has a protective effect on the airway, but under pathological conditions, there are often abnormalities in the amount or quality of mucus, and excessive mucus accumulation will exacerbate local respiratory tract inflammation and infection. Mucin 5AC (5AC) is the main protein component of airway mucus, and the massive secretion of MUC5AC is the main reason for the high mucus secretion state (Zhao et al. Effects of PM2.5 on mucus secretion and tissue remodeling in a rabbit model of chronic rhinosinusitis. Int Forum Allergy Rhinol, 2018, 8(11): 1349-13552).
[0091] 1. Reagents and instruments
[0092] Human bronchial epithelial cells Beas-2b; exogenous epidermal growth factor (EGF); DMEM high-sugar culture medium; fetal bovine serum (FBS); phosphate buffer (PBS); dimethyl sulfoxide (DMSO); 1% P / S double antibody; Mucin 5AC (MUC5AC) enzyme-linked immunoassay kit (Elisa kit); precision electronic balance; biological safety cabinet; carbon dioxide incubator; inverted microscope; low-speed refrigerated centrifuge; enzyme label instrument; digital display constant temperature water bath.
[0093] 2. Culture of Beas-2b cells
[0094] The basic culture medium is DMEM culture solution + 10% FBS + 1% P / S double antibody; the culture conditions are 37℃, 5% CO2 and saturated humidity; and the cells can be used for experiments after being cultured for 2-3 days to reach a cell density of 90%.
[0095] 3. Determination of the expectorant activity of the compounds
[0096] Human Beas-2b cells were cultured in DMEM medium containing 10% FBS, and control, model and sample groups were set up. The cells were inoculated into a 48-well plate and placed in a 37℃, 5% CO2 incubator. When the cell confluence reached 70%, the cells in the three groups were replaced with serum-free medium, the model group was stimulated with exogenous epidermal growth factor (EGF) (25 ng / ml), the TRX group was added with fresh DMEM medium containing LPS and TRX solution (final concentration 10 μM and 20 μM), and was stimulated for 24 h, respectively. The culture supernatant was collected. The cell supernatant was centrifuged at 6000 rpm for 5 min, and the supernatant was transferred to another 1.5 ml centrifuge tube and stored at -20℃ for ELISA detection. The content of MUC5AC was detected according to the instructions of the ELISA kit.
[0097] The experimental data are expressed as mean ± standard deviation The significant difference analysis was performed by one-way analysis of variance using SPSS 22.0 statistical software, and * represents a significant difference p<0.05, and ** represents a significant difference p<0.01.
[0098] As Figure 10 shown, the MUC5AC content of the model group has a significant difference from that of the control group, indicating that the modeling is successful. The MUC5AC content of the TRX group is significantly lower than that of the model group, indicating that TRX has an inhibitory activity on the expression of cell MUC5AC, thereby playing an expectorant role.
[0099] Chronic obstructive pulmonary disease (COPD) is a chronic disease closely related to inflammation and mucus secretion. Inhibition of inflammation and mucus development is an important method and approach for treating COPD. The compound TRX of the present application has significant anti-inflammatory and expectorant activity, and the active concentration is as low as 10 μM. The cell viability experiment shows that the cytotoxicity is very small. Therefore, the compound TRX of the present application has the potential to develop anti-inflammatory and expectorant drugs for treating COPD.
Claims
1. Unsaturated enal compounds represented by Formula I, or pharmaceutically acceptable salts thereof:
2. The method of producing the unsaturated alkenal compound according to claim 1, characterized by, It was isolated from the fermentation culture of Talamoyces rugulosus GIZ45-A37, which has the accession number GDMCC No. 64050. Specifically, the steps include the following: S1. Talaromyces rugulosus GIZ45-A37 was inoculated into fermentation medium and cultured to obtain fermentation products. S2. Add ethyl acetate to the fermentation product obtained in S1, mix and extract, then filter to obtain the extract. S3. Concentrate the extract obtained in S2 under reduced pressure to obtain crude extract; S4. The crude extract obtained in S3 was subjected to silica gel column chromatography. The eluent was composed of petroleum ether and ethyl acetate. The eluent was eluted in a gradient manner according to the volume ratio of petroleum ether to ethyl acetate of 50:1, 25:1, 10:1, 5:1, 2:1 and 1:
1. The eluent with a volume ratio of petroleum ether to ethyl acetate of 5:1 was collected and dried to obtain the crude product. S5. The crude product obtained in S4 is subjected to reversed-phase ODS column chromatography. The eluent is composed of methanol and water. The eluent is eluted in a gradient manner with methanol concentrations of 20%, 40%, 60%, and 80% in sequence. The eluent of 40% to 60% methanol / water is collected and dried to obtain the crude product. S6. The crude product obtained in S5 was subjected to gel Sephadex LH-20 column chromatography with dichloromethane-methanol v / v 2:1 as the eluent. The eluent was collected and detected by high performance liquid chromatography with C18 column, 60% methanol / water, and 254nm wavelength. The eluent containing the main peak was collected and dried to obtain the crude product. S7. The crude product obtained in S6 is purified by medium- and high-pressure preparative liquid phase purification. The fermentation medium described in step S1 consists of the following components by weight: 90-100g of rice, 100ml of water, sterilized by autoclaving at 120℃ for 20min; the culture described in step S1 is a static culture at 25℃ for 30 days. In step S7, the high-pressure preparative liquid chromatography purification uses a mobile phase of a mixed solution of acetonitrile and water, wherein the volume percentage of acetonitrile is 70%.
3. The preparation method according to claim 2, characterized in that, In step S2, ethyl acetate is added to the fermentation product obtained in S1. The mass-to-volume ratio of the fermentation product to ethyl acetate is 1:
3. The extraction is performed by ultrasonic extraction for 15 minutes, and the extraction is repeated 3 times. The ultrasonic extraction uses a power of 400W and a working frequency of 40KHz.
4. Use of the unsaturated enal compound of claim 1, or a pharmaceutically acceptable salt thereof, in the preparation of an anti-inflammatory and expectorant drug.
5. The use according to claim 4, characterized in that, The drug is used to prevent and treat chronic obstructive pulmonary disease.
6. A drug, characterized in that, It is a formulation prepared by using the compound of claim 1, or a pharmaceutically acceptable salt thereof, as the active ingredient, plus pharmaceutically acceptable excipients or auxiliary ingredients.
Citation Information
Patent Citations
Macrolide compound with anti-inflammatory activity as well as preparation method and application thereof
CN117721024A
Compound with anti-inflammatory activity as well as preparation method and application thereof
CN118221598A